Concatenated logic gates by amplified chemiluminescence of hemin/G-Quadruplex DNAzyme based on a nonlinear hybridization chain reaction

Abstract

A nonlinear hybridization chain reaction (non L-HCR) is presented here, in which series of toehold-mediated strands hybridization and branch migration reaction initiate in the presence of a trigger DNA. It leads to self-sustained assembly of double-stranded substrates into fractal nanostructures. The formed fractal nanostructures were about 10μm length×1.5μm wide×30nm high. Furthermore, the 3′ part (TAGGGTTGGGCGGGATGGGT) of Gx DNA are exposed and ready to combined with hemin to form hemin/G-quadruplex DNAzyme, which could amplify the generation of chemiluminescence (CL) in the presence of luminol and H2O2. Under optimal conditions, the CL intensity linearly increased with the concentration of the trigger DNA from 0.5×10−6 to 1.0×10−11M and the detection limit is 7.0×10−12M. In this assay, three-input concatenated logic gates operating as a biocomputing keypad-lock security system also have been successfully constructed. When the inputs are all introduced the “lock” opens. This simple non L-HCR design realizes the fractal nanostructures construction, CL detection and logic gates operating. It can be used in the nanotechnology and biological assay.