Chemical Shift Time Scale Research Articles

Preliminary investigation of the interaction between the R2R3 DNA binding domain of the oncoprotein c-Myb and DNA fragments

The interaction between the R2R3 DNA binding domain of the oncoprotein c-Myb and oligodeoxynucleotides was investigated by 1H-NMR spectroscopy and fluorescence anisotropy assays. Titration of 12 and 16 base-pair DNA fragments containing the TAACGGTC sequence with R2R3 revealed the presence of two complexed forms (in a 40/60 ratio): either two complexes or two conformations in slow exchange at the NMR chemical shift time scale. The largest variations of imino proton chemical shifts were observed for the imino proton of the base pairs 2, 3, 4 and 6 of the DNA sequence, suggesting a direct involvement of these base pairs in the interaction. Using fluorescence anisotropy measurements, a dissociation constant of 5.12 ± 1.49 nM for the specific DNA-R2R3 complex was found, whereas a value of 2.7 ± 0.1 μM was determined for the nonspecific complex. © 1996 John Wiley & Sons, Inc.

Salt-stabilized globular protein structure in 7 M aqueous urea solution

A 7 M aqueous urea solution of the 63-residue N-terminal domain of the 434-repressor at pH 7.5 and 18°C contains a mixture of about 10% native, folded protein and 90% unfolded protein. Interconversion between the two conformations is slow on the NMR chemical shift time scale, so that observation of separate resonances can be used to monitor the equilibrium between folded and unfolded protein when changing the solution conditions. In this paper we describe the influence of various salts or non-ionic compounds on this conformational equilibrium. Solution conditions are described which contain a homogenous preparation of the folded protein in the presence of 6 to 7 M urea, providing a basis for an NMR structure determination in concentrated urea and for studies of the solvation of the folded protein in mixed water/urea/salt environments.

Detection of Insulin Aggregates with Pulsed-Field Gradient Nuclear Magnetic Resonance Spectroscopy

Self-association of metal-free human insulin in aqueous solution at pH 9.4 has been studied using pulsed-field gradient (PFG) NMR spectroscopy. The diffusion coefficients were measured for two different insulin concentrations, 0.72 mM in which the dimer is the predominant species and 3 mM which is a mixture of dimer and tetramer. In the more concentrated solution, exchange between the two aggregates is slow on the NMR chemical shift time scale. As a result, the dimer and tetramer give rise to separated resonances in the aromatic region of the 1H NMR spectrum. The diffusion coefficient determined for the tetramer by PFG NMR is 1.07 × 10 −6 cm 2 s −1 at 298 K, while that for the dimer is 1.38 × 10 −6 cm 2 s −1. The hydrodynamic diameters calculated for the tetramer and dimer are 46 and 36 Å, respectively, which are in good agreement with those measured by dynamic light scattering. The advantage of PFG NMR for the measurement of insulin aggregation in these solutions results from the chemical shift selectivity which allows diffusion coefficients to be directly calculated for the different aggregates. The T 1 and T 2 relaxation times of the dimer and tetramer aromatic protons were also measured in order to optimize the parameters of the PFG NMR experiment and correctly interpret the results of the measured spectra.

Conformational flexibility in DNA duplexes containing single G.G mismatches.

Purine-purine mismatches can base-pair in a variety of configurations depending on solution conditions. The G.G mismatch, which also occurs in the G-quartet structure, has been shown by both x-ray crystallography and NMR to adopt G(anti).G(syn) mispairs, with very different hydrogen bonding patterns [Skelly, J., Edwards, K., Jenkins, T. C. & Neidle, S. (1993) Proc. Natl Acad. Sci. USA 90, 804-808; Cognet, J. A. H., Gabarro-Arpa, J., Le Bret, M., van der Marel, G. A. van Boom, J. H. & Fazakerley, G. V. (1991) Nucleic Acids. Res. 19, 6771-6779] while we have recently suggested the presence of weakly hydrogen-bonded G(anti).G(anti) pairs in solution [Borden, K. L. B., Jenkins, T. C., Skelly, J. V., Brown, T. & Lane, A. N. (1992) Biochemistry 31, 5411-5422]. Spectral overlap and additional exchange processes have made detailed structural analysis difficult in these mismatched oligomers. We have used NMR to characterise the conformations of four duplexes containing single G.G mismatches, including a nonamer d(CATCGGATG), two undecamers d(GCATTGAATGC) and d(CATGTGACGTG) that can each form a self-complementary duplex with a single G.G mispair in the centre, and the non-self-complementary d(GTAACGACATG).d(CATGTGGTTAC). The three self-complementary duplexes have a single set of NMR resonances, and all four duplexes show evidence of conformational exchange at the mismatch site. The N1H resonances of the mismatched G residues each integrate to two protons, ruling out the enol tautomer. They resonate between 10.5-10.7 ppm, far upfield of the Watson-Crick hydrogen-bonded GN1H and exchange readily with water protons. Intraresidue GH8-H1' NOE intensities are two-threefold larger for the mismatched G residues than in G.C base pairs, indicating the presence of syn conformations. NOE time courses for the self-complementary duplexes were consistent with an equimolar mixture of G(syn).G(anti) and G (anti).G(syn) states. By symmetry, these states must be interconverting at a rate that is fast on the chemical shift timescale. In the non-self-complementary undecamer, the NOE data indicated that the distinguishable mismatched G residues also spend a significant, but different, fraction of the time in both the syn and anti conformations. The rate constant for the syn/anti transition in the non-self-complementary undecamer was determined as approximately 14,000 s-1 at 303 K from rotating frame T1 measurements, and the apparent frequency difference was > 250 Hz. Calculations based on NOEs and coupling constants showed that the duplexes are overall in the B form.(ABSTRACT TRUNCATED AT 250 WORDS)

Multiple native-like conformations trapped via self-association-induced hydrophobic collapse of the 33-residue β-sheet domain from platelet factor 4

Native platelet factor 4 (PF4) (70 residues) has a hydrophobic three-stranded anti-parallel beta-sheet domain on to which is folded an amphipathic C-terminal alpha-helix and an aperiodic N-terminal domain. The 33-amino acid beta-sheet domain from PF4 (residues 23-55) has been synthesized and studied by c.d. and n.m.r. At 10 degrees C and low concentration, peptide 23-55 appears to exist in aqueous solution in a random-coil distribution of highly flexible conformational states. Some preferred conformation, however, is observed, particularly within a relatively stable chain reversal from Leu-45 to Arg-49. As the peptide concentration and/or temperature is increased, a new conformational state(s) appears and intensifies as slowly exchanging (600 MHz 1H-n.m.r. chemical-shift time scale) random-coil resonances disappear. Hill plots of the concentration-dependence indicated mostly tetramer formation as found in native PF4. Although apparent resonance linewidths in aggregate state(s) are of the order of 100 Hz, sequence-specific assignments for most resonances could be made. N.m.r./nuclear Overhauser effect structural analysis indicates the formation of multiple native-like anti-parallel beta-sheet conformations, kinetically trapped via subunit-association-induced hydrophobic collapse and stabilized by low-dielectric electrostatic interactions among/between Gly-28 and Lys-50 in opposing subunits. Results are discussed in terms of protein folding.

Two-Dimensional Transferred Nuclear-Overhauser Effects with Incomplete Averaging of Free- and Bound-Ligand Resonances

Two distinct time scales prevail in the study of conformational exchange in general and specifically in deriving the protein-bound conformations of ligands by two-dimensional transferred-NOE experiments. Fast-exchange compared to the chemical-shift difference leads to a complete averaging of the free and bound resonances of the ligands, while fast exchange compared to the longitudinal relaxation rate 1/ T 1 and cross relaxation results in an average of the relaxation matrices in the free and bound states. Slower chemical exchange leads to incomplete averaging of the free and bound resonances, giving rise to a reduction of transferred NOEs compared to fast-exchange conditions, Theoretical analysis and simulation results indicated that, in the absence of information on the chemical-shift time scale, transferred NOEs may be quantitated only to an accuracy with average NOE intensities and transferred NOEs to the free ligands as upper and lower bounds, respectively. Regardless of the exchange conditions, NOE intensities can be approximated by the NOEs transferred to the free ligands when a large excess of the free ligands (α b < 0.1) is used to amplify the NOE transfers between the bound protons, These results suggest that two-dimensional transferred-NOE experiments (transferred NOESY) can be applied in situations of intermediate and slow exchange as long as the fraction of bound ligands is small and the exchange rates are fast enough to transfer the cross-relaxation pathways in the protein-ligand complex to the easily detected resonances of the free ligands,

Quarternary structure amplification of protein folding differences observed in ‘native’ platelet factor-4

Platelet factor 4 (PF4), a protein of 70 residues, exists in solution as a distribution of monomer, dimer and tetramer (M-D-T) states in slow exchange on a 600 MHz 1H-NMR chemical shift time scale. Well-resolved Y60 ring proton resonances in each aggregate state allow derivation of M-D-T populations. Under the same set of solution conditions, M-D-T aggregate state distributions vary from prep to prep or with repeated freeze-drying or raising/lowering the solution pH. These variations are not the result of chemical modifications and reflect differences in the strength of subunit associations and therefore folding. Variations are greatest at pH values at or below the pK as of carboxylate groups, supporting the idea that electrostatic interactions modulate PF4 subunit interactions. Treating these distributions as true equilibria results in free energy differences of about 0.5 kcal/mol subunit. Quarternary structure amplifies free energy differences among various folded states of monomer PF4.

Redox-dependent 1H NMR spectral features and tertiary structural constraints on the C-terminal region of putidaredoxin.

Putidaredoxin (Pdx) is a 106-residue Fe2S2 ferredoxin which acts as the physiological reductant and effector of cytochrome P-450cam. Pdx has two accessible oxidation states, Fe+3-Fe+3 (oxidized) and Fe+3-Fe+2 (reduced), and exhibits redox-dependent binding affinities for cytochrome P-450cam, with reduced Pdx binding over 100-fold more tightly than oxidized Pdx to the oxidized cytochrome P-450cam [Hintz, M. J., Mock, D. M., Peterson, L. L., Tuttle, K., & Peterson, J. A. (1982) J. Biol. Chem. 257, 14324-14332]. The analysis of two-dimensional 1H NMR experiments has yielded sequential 1H resonance assignments for the diamagnetic regions of the reduced form of Pdx, which are compared to those of oxidized Pdx, described previously [Ye, X. M., Pochapsky, T. C., & Pochapsky, S. S. (1992) Biochemistry 31, 1961-1968]. Increased unpaired electron-spin density on the metal cluster in reduced relative to oxidized Pdx increases the number of 1H resonances which are broadened by the metal cluster, and the pattern of paramagnetic broadening provides information concerning the placement of the metal cluster within the protein. Two-dimensional exchange experiments on half-reduced samples of Pdx indicate that electron self-exchange is slow on the chemical shift time scale, with a second-order rate constant < or = 66 M-1 s-1 at 290 K. Spectral changes unrelated to increases in unpaired electron-spin density are also observed. The largest changes of this type are observed for features structurally contiguous with the C-terminal region Pro 102-Trp 106. The C-terminal residue Trp 106 has been implicated in binding to cytochrome P-450cam.(ABSTRACT TRUNCATED AT 250 WORDS)

Recognition of DNA by GAL4 in Solution: Use of a Monomeric Protein-DNA Complex for Study by NMR

The complex of a monomer of GAL4 with DNA has been investigated by two-dimensional 1H nuclear magnetic resonance (NMR) spectroscopy. Previous X-ray analysis has revealed a structure in which a dimer of the N-terminal 65-residue fragment of GAL4 forms a complex, 27 kDa in molecular mass, with a 19 base pair full-binding-site DNA [Marmorstein, R., Carey, M., Ptashne, M., & Harrison, S. C. (1992) Nature 356, 408-414]. We have developed a smaller system, half in molecular mass, which is amenable for detailed analysis using NMR. Titration of a 10 base pair half-binding-site DNA with GAL4-(65) shows 1:1 binding, illustrating that one monomer of the protein binds in a specific manner to half-site DNA. The components of the protein-DNA complex are mainly in fast exchange on the NMR chemical shift time scale, with an equilibrium dissociation constant of 161 +/- 12 microM. With a basis of chemical shift data for free GAL4 protein and for the free half-site DNA, the fast exchange facilitates 1H resonance assignments in the complex since cross-peak positions can be examined at different protein:DNA ratios. Chemical shift changes in the DNA reveal the base pairs that are important for recognition by GAL4. Intermolecular NOE cross-peaks are also observed in spectra of the protein-DNA complex. Their identification places the C-terminal end of the first alpha-helix (residues 12-17) in a position such that the amino acids are able to read the DNA sequence in a manner entirely consistent with the X-ray structure of the related complex.(ABSTRACT TRUNCATED AT 250 WORDS)

21] Nuclear magnetic resonance measurements of slow conformational dynamics in macromolecules

The combined use of rotating-frame relaxation methods, temperature-dependent measurements of line shapes and magnetization transfer experiments allows in favorable cases the examination in some detail of exchange processes that occur on the millisecond time scale. It is possible to determine not only the rate constants, but also the activation parameters and chemical shifts even for events that are in fast exchange on the chemical shift time scale. Such measurements complement the information obtainable from heteronuclear relaxation methods that probe mainly the fast librational motions in macromolecules and may provide information important for functional studies of biological macromolecules.

Determination of conformational transition rates in the trp promoter by 1H NMR rotating-frame T1 and cross-relaxation rate measurements

Rotating-frame relaxation measurements have been used in conjunction with spin-spin relaxation rate constants to investigate a conformational transition previously observed in the -10 region of the trp promoter d(CGTACTAGTTAACTAGTACG)2 (Lefèvre, Lane, Jardetzky 1987). The transition is localised to the sub-sequence TAAC, and is in fast exchange on the chemical shift time-scale. The rate constant for the exchange process has been determined from measurements of the rotating-frame relaxation rate constant as a function of the spin-lock field strength, and is approximately 5000 s-1 at 30 degrees C. Measurements have also been made as a function of temperature and in two different magnetic fields: the results are fully consistent with those expected for the exchange contribution in a two-site system. A similar transition has been observed in d(GTGATTGACAATTA).d(CACTAACTGTTAAT), which contains the -35 region of the trp promoter. This has been investigated in the same way, and has been found to undergo exchange at a faster rate under comparable conditions. In addition, the cross-relaxation rate constants for Ade C2H-Ade C2H pairs have been measured as a function of temperature, and these indicate that certain internuclear distances in YAAY subsequences increase with increasing temperature. These changes in distance are consistent with a flattening of propellor twist of the AT base-pairs. The occurrence of conformational transitions in YAAY subsequences depends on the flanking sequence.

Interaction of carboxylate inhibitors with the active site of nickel(II) carboxypeptidase A

The binding of several carboxylate inhibitors to nickel(II)-substituted carboxypeptidase A, NiCPA, has been investigated through 1H, 13C NMR and electronic absorption spectroscopies. Both β-phenylpropionate and phenylacetate interact with NiCPA forming two complexes of stoichiometries 1 : 1 and 1 : 2 and their affinity constants were determined. Whereas the first inhibitor molecule binds at a non-metallic site, the second binds directly to the metal ion in slow exchange on the chemical shift time-scale. Proton nuclear Overhauser effect measurements have been performed on the 1 : 2 β-phenylpropionate complex, allowing a full correlation between the isotropically shifted signals. From the 1H T1 values of the meta-like protons of the co-ordinated histidines and the molar absorbances of the 1 : 2 complexes formed, five-co-ordination for the nickel ion is suggested. The NMR data indicate that upon binding of the carboxylate to the metal ion a conformational change occurs. In contrast, acetate displays no evidence for more than a single binding mode to the nickel enzyme. Thus 1H and 13C NMR data indicate that acetate binds to the metal ion forming a 1 : 1 complex in a fast-exchange regime. The Ni ⋯13C distance, r= 2.7 Å, calculated by means of the Solomon equation, is consistent with direct co-ordination of the acetate to the metal ion.

Microscopic model for the structural phase transitions in NH4SCN and KSCN

Abstract The 39K quadrupole coupling tensors and chemical-shift tensors have been determined in KSCN and the SCN and NH4 nitrogen quadrupole coupling tensors have been determined in NH4SCN as a function of temperature. The results for KSCN show, that the symmetry of the paraelectric phase is broken on the quadrupole-coupling time scale but not on the chemical-shift time scale, implying that the characteristic time for structural fluctuations is between 10−5 sec and 10−2 sec. The high temperature phase of NH4SCN is dynamically disordered with the hydrogen-bonded NH4 ions moving between 4 equivalent off-center sites. In the orthorhombic phase two of the 4 NH4-sites freeze out, so that this phase is partially ordered.

Molecular basis for methoxyamine initiated mutagenesis: 1H Nuclear magnetic resonance studies of base-modified oligodeoxynucleotides

In order to reach a more detailed understanding of the mechanism of the mutagenic action of methoxyamine and of N4-methoxycytidine and its 2′-deoxyribo-analogue, the solution structures of the self-complementary octanucleotide, d(CGAATTCG) and its analogues, d(CGAATCCG), d(CGAATMCG) and d(CGAATPCG) (designated 8mer-AT, 8mer-AC, 8mer-AM, and 8mer-AP, respectively), were investigated by 1H nuclear magnetic resonance spectroscopy; M is N4-methoxycytosine (mo 4C) and P is an analogue, the bicyclic dihydropyrimido[4,5-c][1,2]oxazin-7-one, in which the NO bond is held in the anti configuration with respect to N3 of the cytosine ring. Correlated spectroscopy and nuclear Overhauser spectroscopy allowed assignment of the base, anomeric and H2′/H2′′ protons in 8mers-AT, -AM and -AP, and showed that all three had features consistent with a regular B-DNA duplex structure. Duplex-to-coil transition temperatures were determined to be 52(± 2) °C (8mer-AT), 51(± 2) °C (8mer-AP), 32(± 2) °C (8mer-AM); on the chemical shift timescale, the melting transition was fast for 8mer-AT and 8mer-AP, but slow for 8mer-AM. Imino proton spectra were indicative of Watson-Crick base-pairing in 8mers-AT, -AP and -AM. The 8mer-AP duplex had a structure and melting characteristics virtually identical with those of the 8mer-AT duplex. The preferred syn configuration of the methoxyl group in M had a destabilising effect on the 8mer-AM duplex. At low temperatures, the A · M base-pair was in fast equilibrium between Watson-Crick and wobble configurations, with the methoxyl function anti-oriented, but the melting transition was accompanied by isomerization of the methoxyl group to the syn conformation. This syn-anti isomerization was the rate-determining step in the duplex-to-coil transition. The 8mer-AC oligomer did not form a stable duplex.

Base pairing of cytosine analogues with adenine and guanine in oligonucleotide duplexes: evidence for exchange between Watson–Crick and wobble base pairs using1H NMR spectroscopy

1 H NMR spectra of oligodeoxynucleotide duplexes incorporating N4-methoxycytosine and a related analogue paired with adenine and guanine demonstrate that Watson–Crick and wobble base pairs are in slow exchange on the chemical shift timescale.

Protein-DNA contacts in the structure of a homeodomain-DNA complex determined by nuclear magnetic resonance spectroscopy in solution.

The 1:1 complex of the mutant Antp(C39----S) homeodomain with a 14 bp DNA fragment corresponding to the BS2 binding site was studied by nuclear magnetic resonance (NMR) spectroscopy in aqueous solution. The complex has a molecular weight of 17,800 and its lifetime is long compared with the NMR chemical shift time scale. Investigations of the three-dimensional structure were based on the use of the fully 15N-labelled protein, two-dimensional homonuclear proton NOESY with 15N(omega 2) half-filter, and heteronuclear three-dimensional NMR experiments. Based on nearly complete sequence-specific resonance assignments, both the protein and the DNA were found to have similar conformations in the free form and in the complex. A sufficient number of intermolecular 1H-1H Overhauser effects (NOE) could be identified to enable a unique docking of the protein on the DNA, which was achieved with the use of an ellipsoid algorithm. In the complex there are intermolecular NOEs between the elongated second helix in the helix-turn-helix motif of the homeodomain and the major groove of the DNA. Additional NOE contacts with the DNA involve the polypeptide loop immediately preceding the helix-turn-helix segment, and Arg5. This latter contact is of special interest, both because Arg5 reaches into the minor groove and because in the free Antp(C39----S) homeodomain no defined spatial structure could be found for the apparently flexible N-terminal segment comprising residues 0-6.

Metall-π-komplexe von benzolderivaten: XXXV. Bis(η 6-bimesityl)chrom. Magnetische Abschirmung und konformative Beweglichkeit

Metal-atom ligand-vapor cocondensation affords the complexes bis(η 6-bimesityl)chromium ( 2), (η 6-bimesityl)(η 6-benzene)chromium ( 5) and bis(η 6-2,4,8,10-tetramethylbiphenyl)chromium ( 4), and conventional carbonyl substitution yields the compounds (η 6-bimesityl)(tricarbonyl)chromium ( 7) and μ(η 6:η 6-bimesityl)bis[(tricarbonyl)chromium] ( 8). 1H NMR data for 2 suggest that in the rotamer of lowest energy the two bimesityl ligands with regard to the sandwich axis have a twist angle, α, of about 90 or 270°, respectively. These two rotamers undergo torsional interconversion with an activation barrier of Δ G c ≠ 75 kJ/mol. The 1H NMR spectra of 2, 5, 7 and 8 are assigned and the large chemical shift differences are traced to the unique positions the protons adopt in the periphery of the bis(η 6-arene)metal core. The NOE difference spectrum of 2 is temperature dependent; rapid exchange on the T 1 scale is achieved at 53°C, a temperature at which, on the chemical shift time scale, slow exchange still prevails. In 4, the ortho-methyl groups of the 8,10-dimethyl substituent relative to the central metal, exclusively occupy exo-positions. Correspondingly, the activation barrier for the conformational interconversion is decreased in 4 compared to 2. Owing to the lower symmetry of the ligand o, o′, p, p′-tetramethylbiphenyl ( 3), the binary complex ( 3) 2Cr is formed as a mixture of the forms meso- 4 and rac- 4. Although 4 is already in the fast exchange region at room temperature, the 1H NMR spectrum still displays a marked temperature dependence. The latter is caused by the fact that for meso- 4 the two equilibrating rotamers are enantiomers, whereas for rac- 4 they are diastereomers. Thus, in contrast to meso- 4, for rac- 4 the population ratio of the interconverting rotamers is temperature dependent.

Binding of a calcium sensitizer, bepridil, to cardiac troponin C. A fluorescence stopped-flow kinetic, circular dichroism, and proton nuclear magnetic resonance study.

Stopped-flow fluorescence kinetic measurements, circular dichroism (CD), and 1H nuclear magnetic resonance (NMR) spectroscopy at 360 MHz have been used to study the interaction of the calcium-channel blocker and calmodulin antagonist bepridil with cardiac troponin C (cTnC) in the presence of calcium. The kinetic data show that bepridil reduces the rate of calcium release only from the low affinity, calcium-specific site and not from the two high affinity calcium/magnesium sites. CD measurements indicate that drug binding leads to a small increase in the alpha-helical content of the complex. 1H NMR shows that the protein binds one equivalent of bepridil, with a dissociation constant of approximately 20 microM, only when the low affinity calcium site is occupied. Exchange is fast or intermediate on the chemical shift time scale. Drug binding is shown to be largely localized in the N-terminal domain, containing the low affinity calcium site, by observing the shifting and broadening of several resonances associated with that domain. These include assigned aromatic signals together with methionyl and other methyl signals. Observation of intermolecular nuclear Overhauser effects was precluded by extensive spectral overlap. Consideration of the data from the three techniques permitted a model of the bepridil-cTnC complex to be constructed, using the model of cTnC derived from the x-ray structure of calmodulin (MacLachlan L. K., Reid, D. G., and Carter, N. (1990) J. Biol. Chem. 265, 9754-9763). Binding of bepridil to a prominent hydrophobic depression in the N-terminal domain can be invoked to explain many of the induced changes in the spectral and kinetic properties of the protein. The implications of the model for the calcium sensitizing action of bepridil are discussed.

Determination of the secondary structure and molecular topology of interleukin-1.beta. by use of two- and three-dimensional heteronuclear nitrogen-15-proton NMR spectroscopy

A study of the regular secondary structure elements of recombinant human interleukin-1 beta has been carried out using NMR spectroscopy. Using a randomly 15N labeled sample, a number of heteronuclear three- and two-dimensional NMR experiments have been performed, which have enabled a complete analysis of short-, medium-, and long-range NOEs between protons of the polypeptide backbone, based on the sequence-specific resonance assignments that have been reported previously [Driscoll, P. C., Clore, G. M., Marion, D., Wingfield, P. T., & Gronenborn, A. M. (1990) Biochemistry 29, 3542-3556]. In addition, accurate measurements of a large number of 3JHN alpha coupling constants have been carried out by two-dimensional heteronuclear multiple-quantum-coherence-J spectroscopy. Amide NH solvent exchange rates have been measured by following the time dependence of the 15N-1H correlation spectrum of interleukin-1 beta on dissolving the protein in D2O solution. Analysis of these data indicate that the structure of interleukin-1 beta consists of 12 extended beta-strands aligned in a single extended network of antiparallel beta-sheet structure that in part folds into a skewed six-stranded beta-barrel. In the overall structure the beta-strands are connected by tight turns, short loops, and long loops in a manner that displays approximate pseudo-three-fold symmetry. The secondary structure analysis is discussed in the light of the unrefined X-ray structure of interleukin-1 beta at 3-A resolution [Priestle, J. P., Schär, H.-P., & Grütter, M. G. (1988) EMBO J. 7, 339-343], as well as biological activity data. Discernible differences between the two studies are highlighted. Finally, we have discovered conformational heterogeneity in the structure of interleukin-1 beta, which is characterized by an exchange rate that is slow on the NMR chemical shift time scale.

NMR Studies of the Interaction of Bleomycin with (dC-dG)3

The interaction of bleomycin A2 and Zn(II)-bleomycin A2 with the oligonucleotide (dC-dG)3 has been monitored by nuclear magnetic resonance spectroscopy. Binding of the drug to the oligonucleotide is indicated by an upfield shift of the bithiazole proton resonances consistent with partial intercalation of this group between base pairs. The effect of temperature and ionic strength on the binding of both free bleomycin and the Zn(II) complex has been studied. Consistent with earlier studies on polynucleotides, the rate of exchange between the free drug and the drug-oligonucleotide complex is rapid on the 1H NMR chemical shift time scale. Binding of the oligonucleotide induced changes in resonances assigned to protons in the metal-binding region of Zn(II)-bleomycin. Intermolecular nuclear Overhauser effect enhancements between bleomycin and the oligonucleotide have not been detected.