Chemical Modification Procedures Research Articles

Chemical toughening of epoxies. I. Structural modification of epoxy resins by reaction with hydroxy‐terminated poly(butadiene‐co‐acrylonitrile)

AbstractIn an attempt to toughen the epoxy resin matrix for fiber‐reinforced composite applications, a chemical modification procedure of a commercially available bisphenol‐A‐based epoxy resin using reactive liquid rubber HTBN [hydroxy‐terminated poly(butadiene‐co‐acrylonitrile)] and TDI (tolylene diisocyanate) is described. The progress of the reaction and the structural changes during modification process are studied using IR spectroscopy, viscosity data, and chemical analysis (epoxy value determination). The studies support the proposition that TDI acts as a coupling agent between the epoxy and HTBN, forming a urethane linkage with the former and an oxazolidone ring with the latter. The chemical reactions that possibly take place during the modification are discussed.

Chemical modification as an approach to elucidation of sodium pump structure-function relations

Chemical modification of specific residues in enzymes, with the characterization of the type of inhibition and properties of the modified activity, is an established approach in structure-function studies of proteins. This strategy has become more productive in recent years with the advances made in obtaining primary sequence information from gene-cloning technologies. This article discusses the application of chemical modification procedures to the study of the Na(+)-K(+)-ATPase protein. A wide array of information has become available about the kinetics, enzyme structure, and various conformational states as a result of the combined use of inhibitors, ligands, modifiers, and proteolytic enzymes. We will review a variety of reagents and approaches that have been employed to arrive at structure-function correlates and discuss critically the limits and ambiguities in the type of information obtained from these methodologies. Chemical modification of the Na(+)-pump protein has already provided a body of data and will, we anticipate, guide the efforts of mutagenesis studies in the future when suitable expression systems become available.

Core histone‐DNA interactions in sea urchin sperm chromatin

A three-stage chemical modification procedure [Lambert, S. F. & Thomas, J. O. (1986) Eur. J. Biochem. 160, 191-201; Thomas, J. O. & Wilson, C. M. (1986) EMBO J. 5, 3531-3537] for selectively radiolabelling lysine residues that interact with DNA has been used to investigate core histone--DNA interactions in sea urchin sperm chromatin, in particular to determine the binding site of the long N-terminal domain of sperm-specific H2B. Comparison of the patterns of radiolabelling of core histones from extended chromatin and nucleosome core particles (which lack linker DNA) reveals the regions of the histones involved in interactions with the linker. The results show that the N-terminal domain of H2B is bound to DNA outside the 146-bp nucleosome core, presumably to the linker DNA. H2A and H4 make no substantial contacts with the linker in extended chromatin; the N-terminal tail of H4 is bound within the core particle, but the N-terminal tail of H2A is not bound in core particles or in extended chromatin, and may therefore have a role in higher-order structure. H3, like H2B, makes contacts with DNA outside the 146-bp nucleosome core in its N-terminal region, as well as elsewhere, and probably interacts with the two 10-bp extensions that complete the two turns of DNA in the nucleosome and/or with the linker.

Electron microscopy studies of α2-Macroglobulin Conformational Intermediates Obtained by Derivatization with cis-Dichlorodiammineplatinum (II)

Abstract The structure of human alpha 2-macroglobulin (alpha 2M) after reaction with cis-dichlorodiammineplatinum (II) (cis-DDP) was studied by electron microscopy. The cis-DDP stabilized a novel conformation of the native inhibitor resembling a doughnut surrounded by two, three, of four well defined spherules. When only two spherules were present, these structures were usually oriented on opposite sides of the doughnut. The protein region joining a spherule to the central structure did not include sufficient mass to exclude stain and was, therefore, invisible. Other images showed spherules that were partially superimposed on the doughnut. A comparison of many molecules suggested great flexibility of the peripheral spherules relative to the central structure. The cis-DDP prevented complete conformational change when the alpha 2M was reacted with trypsin. The products of this reaction included apparent conformational intermediates. These intermediates most closely resembled either native alpha 2M or the well established structure of alpha 2M-proteinase, depending on the initial conditions used to modify the alpha 2 M with cis-DDP. When cis-DDP-treated alpha 2M was reacted with trypsin, purified by chromatography and subsequently treated with diethyldithiocarbamate, complete conformational change was observed. Based on an analysis of the alpha 2M structural intermediates obtained using the chemical modification procedures described here, a new model of alpha 2M conformational change was developed. We postulate that conformational change initially involves contraction of the peripheral spherules towards the central doughnut. These spherules then unfold and elongate in the perpendicular direction to form the lateral walls of the proteinase transformed alpha 2M H structure.

Evidence for the existence of at least two different binding sites for 5HT-reuptake inhibitors within the 5HT-reuptake system from human platelets

Chemical modification procedures have been used to study the interaction of tricyclic and non-tricyclic 5HT-reuptake inhibitors with the [ 3]imipramine binding site (IBS). N-Ethoxycarbonyl-2-ethoxy-1,2-dihydroquinoline (EEDQ) induced a pronounced loss in [ 3H]imipramine binding due to a reduction in B max. Preincubation with reuptake inhibitors and subsequent inactivation by EEDQ revealed that imipramine and 5HT prevented the EEDQ-induced inhibition, but citalopram and fluoxetine did not. Thiol modification studies demonstrated that reduction by dithiothreitol (DTT) enhanced the binding of [ 3H]imipramine by increasing the B max. The thioselective reagents 1,1-diazobis- ( N,N-dimethylformamide) (diamide), phenyl-arsineoxide (PAO) and N-ethylmaleimide (NEM) attenuated the binding capacity by lowering the B max. PAO, a reversible thiol reagent, prevented NEM alkylation indicating that dithiols are involved in the NEM-induced inactivation. Binding of tricyclics or non-tricyclics prior to PAO inactivation revealed that tricyclics provide complete protection against thiol modification, while the non-tricyclics do not. The results support the hypothesis that the 5HT-reuptake system of human platelets possesses at least two distinguishable binding sites.

A new sensitive non-isotopic method using sulfonated probes to detect picogram quantities of specific DNA sequences on blot hybridization.

The use of non-radioactive systems to detect target DNA or RNA displays many advantages such as safe manipulation, potential use in non-specialized scientific area and prolonged lifetime of the probes (one year or more). We here describe a method we have improved and optimized using sulfonated DNA probes for hybridization on dot and Southern blots. Sulfonation is an easy chemical modification procedure which does not require enzymatic coctail as does nick-translation. Sensitivity of this method has been particularly improved by using a new blocking solution, containing heparin, which allows easy and fast detection of picogram quantities of DNA. This method allows the use of nitrocellulose as well as nylon membranes with very low background. Equal resolution is obtained in comparative experiments involving both sulfonated and 32P-radiolabelled probes. Single copy gene sequences are readily detected in nuclear DNA. These results allow the use of this procedure for restriction fragment length polymorphism (RFLP) studies.

Magelona haemerythrin: Tissue specificity, molecular weights and oxygen equilibria

1. 1. The polychaete Magelona papillicornis has heterogeneous haemerythrin, not only in the anucleate cellular fragments, “haemerythrocytes”, which circulate in the vascular system, but also in the muscles (myohaemerythrins). 2. 2. The major vascular haemerythrin resolves as a very sharp zone in a number of electrophoretic systems but the major muscle haemerythrin is insoluble. 3. 3. The minor vascular and muscle haemerythrins migrate cathodally in the standard electrophoretic buffers (pH 6–8.6); while these basic haemerythrins are very similar proteins, the muscle and vascular minor haemerythrins can be differentiated in some electrophoretic systems. 4. 4. The major vascular haemerythrin of M. papillicornis has a mol. wt of 693,000 ± 32,000 (SE of the mean); this extremely high mol. wt is without precedent among haemerythrins and violates the rule that intracellular respiratory proteins have low mol. wts. 5. 5. Magelona and sipunculid haemerythrins show similar responses to a variety of chemical modification procedures and dissociate into similar-sized subunits. 6. 6. Oxygen binding properties of M. papillicornis haemerythrin are somewhat different inside and outside the “haemerythrocyte”, the latter yielding a distinct curve with n = 1.0 below 40–50% oxyhaemerythrin and with n = 2.1 above that percentage; the Bohr effect is small ( φ = −0.13) and probably not physiologically significant.

Production and characteristics of ultrafiltration membranes with uniform pores from two-dimensional arrays of proteins

Surface or S-layers, which represent the outermost cell wall component of many eubacteria archaebacteria, were used for the production of isoporous ultrafiltration membranes. S-layers are paracrystalline arrays of protein or glycoprotein subunits that are linked by non-covalent interactions and completely cover the cell surface. The porosity of S-layers ranges from 20 to 50%. So far, channels of 2–6 nm diameter have been identified in S-layer lattices, either by application of high-resolution electron microscopy or by permeability studies. For the production of S-layer ultrafiltration membranes (SUM), the isoporous S-layer material isolated from highly thermophilic eubacteria was deposited on commercially available microfiltration membranes by a pressure-dependent deposition procedure. The active ultrafiltration layer, which was responsible for the rejection characteristics, consisted of coherent S-layer material, whereas the only function of the microfiltration membrane was to provide the mechanical support. In order to improve the stability of the ultrafiltration membranes, the S-layer protein was crosslinked with glutaraldehyde. As expected for an isoporous structure, S-layer ultrafiltration membranes displayed very steep rejection curves, when proteins of progressively increasing molecular weight were taken as test molecules. SUM exhibited a remarkable resistance towards acid, alkali and organic solvents. Depending on the chemical modification procedures performed on the S-layer protein, SUM had different surface net charges. The amount of macromolecules adsorbed to SUM surfaces was strongly influenced by both the solution properties and the membrane surface characteristics.

Dihydroxypropylation of amino groups of proteins: use of glyceraldehyde as a reversible agent for reductive alkylation.

The mode of derivatization of amino groups of proteins by glyceraldehyde, an aldotriose, depends on the presence or absence of reducing agent. In the presence of sodium cyanoborohydride, the Schiff base adducts of the aldehyde with the amino groups are reduced, and dihydroxypropylation of amino groups takes place (reductive mode). The reductively glycated lysine residue, N epsilon-(2,3-dihydroxypropyl)lysine, is a substituted alpha-amino alcohol. This alpha-amino alcoholic function of the derivatized lysine should be susceptible to periodate oxidation, and this oxidation is anticipated to result in the regeneration of the lysine residue. This aspect has been now investigated. Indeed, on mild periodate oxidation (15 mM periodate, 15 min at room temperature) of dihydroxypropylated ribonuclease A, nearly 95% of its N epsilon-(2,3-dihydroxypropyl)lysine residues were regenerated to lysine residues. The removal of the dihydroxypropyl groups by periodate oxidation could be accomplished within a wide pH range with little variation in the recovery of lysines. The possible usefulness of this reversible chemical modification procedure in the primary structural studies of proteins was investigated with a tryptic peptide of dihydroxypropylated streptococcal M5 protein, namely, DHP-T4. This 12-residue tryptic peptide contains one internal N epsilon-(dihydroxypropyl)lysine. The dihydroxypropylated peptide released most of its dihydroxypropyl groups on mild periodate oxidation. Redigestion of the periodate-treated peptide with trypsin generated the two expected peptides, demonstrating the generation of a trypsin-susceptible site. Reductive dihydroxypropylation of amino groups of RNase A resulted in the loss of its enzyme activity, the extent of inactivation increasing with the concentration of the glyceraldehyde used.(ABSTRACT TRUNCATED AT 250 WORDS)

The reactions of cuprolinic blue with glycoconjugate-containing tissues in light microscopy.

In a series of mammalian tissues, the reactions of cuprolinic blue with glycoconjugates were studied under light microscopy. The dye solutions were adjusted to pHs 1.0, 1.5, 2.5, 3.0 and 5.6 and applied to different glycoconjugate-containing tissues in combination with certain chemical modification and enzyme digestion procedures. The results obtained revealed that (a) the ortho- and metachromatic staining intensities with the dye increase with advancing pH levels, (b) most proteoglycan-containing structures exhibit purple shades of metachromatic stainings at higher pHs, whereas glycoprotein-containing ones show reddish shades of staining at every pH level and (c) the effects of chemical modification and enzyme digestion procedures upon the staining reactions lead to a possible correlation of individual glycoconjugates with their cuprolinic blue stainabilities in tissues.

41] Labeling of recombinant interferon with [35S]methionine in vivo

Publisher Summary This chapter illustrates a method for uniformally labeling interferon alpha A (IFN-αA) with [ 35 S]methionine by the in vivo maxicell labeling technique. Study of interferon binding to the plasma membrane receptor is the first step in the establishment of interferon function. The number of interferon receptors is relatively low on the cell surface membrane (about 500–5000 receptors per cell). Therefore, to characterize the interferon receptor, it is necessary to obtain radiolabeled interferon with high specific radioactivity. IFN-αA has been iodinated to a reasonably high specific radioactivity with enzymobeads, Bolton–Hunter reagent, and chloramine T. The iodination of interferon does not consistently produce active proteins. This might be due to the oxidation of polypeptide chains or the modification of amino acids, which are required for binding to the receptor and for the functional activity of interferons. Other interferon species (e.g., fibroblast and immune) are highly sensitive to modification by iodination. Any chemical modification procedure produces a heterogeneous population of interferon molecules. The maxicell procedure described in the chapter is a simple method for obtaining [ 35 S]Met-labeled IFN-αA. In this method, chromosomal DNA of E.coli is damaged extensively upon ultraviolet (UV) irradiation. This results in diminished synthesis of E. coli proteins. The plasmid DNA, which survived UV treatment, continues to replicate at a high level.

Structure-function Relationship of antitumor beta-1,3-glucan obtained from matted mycelium of cultured Grifola frondosa.

The structure-function relationship of the antitumor 6-branched β-1, 3-glucan (grifolan NMF-5N) extracted from the matted mycelium of Grifola frondosa was examined by using various chemical modification procedures (periodate oxidation, Smith degradation, and enzymic hydrolysis). The antitumor activity of grifolan NMF-5N was not lowered by periodate oxidation. Partial removal of branches by mild hydrolysis did not affect the activity. However, the linear β-1, 3-glucan obtained by Smith degradation lacked antitumor activity. From the results of enzymic hydrolysis of grifolan NMF-5N, this glucan contains a β-1, 3-glucanase-resistant core structure. The core structure is present randomly in this glucan, and does not itself show antitumor activity. These results suggest that some of the branches at C-6 in grifolan NMF-5N are important for the antitumor activity, and that the activity requires a relatively high molecular weight.

Microprobe analysis of noble gas encapsulates in zeolites

Electron microprobe analysis has been employed for the first time to investigate gases immobilized in zeolites. Two trapping procedures and two different molecular sieves were tested: on one hand Kr as well as one to one Xe Kr and Xe Ar mixtures were trapped hydrothermally in X-ray amorphous zeolite 5A, and on the other, Kr was immobilized in mordenites by a combination of physical sorption and chemical modification procedure. The results show that the noble gases Ar, Kr and Xe can be quickly and specifically identified in these inorganic matrices. Because in all samples the density of the noble gas follows exactly the density of the aluminosilicate framework it is concluded that the noble gas is homogeneously distributed in the zeolite material. Analysis of noble gas mixtures indicates that each of the noble gases Ar, Kr and Xe can be specifically monitored in the presence of the two others. In addition, an analysis of other elements present in the pellet can be simultaneously carried out. The variation of the concentration of these elements with structure can be followed with resolution of ≈ 1μm.

Sialomucin in Paget cells of extramammary Paget's disease.

The cytoplasmic sialomucin in Paget cells of extramammary Paget's disease was examined by means of a battery of histochemical techniques. The staining methods used involved an electrolyte--Alcian Blue (pH 5.8), periodic acid--Schiff and azure A at selected pH levels. Methylation, saponification, borohydride reduction, acid hydrolysis, and digestion with diastase, neuraminidase (Vibrio cholerae) or chondroitinase ABC, were also employed. The cytoplasmic mucin was found to exhibit positive reaction for the above staining which were variously altered by the chemical modification procedures and diminished in intensity or abolished by digestion with neuraminidase. These results suggest that the cytoplasmic mucin is sialomucin without side-chain substituent in extramammary Paget's disease located in axillary or genital area, and with a substituent at C7 in the disease located in perianal area.

Sequence determination of rat U5 RNA using a chemical modification procedure for counteracting sequence compression.

Using post-labeling techniques, the nucleotide sequence of a major species of U5 RNA isolated from rat liver was determined to be: XpppAmUmACUCUGGUUUCUCUUCAGAUCGUAUAAAUCUUUCGmCCUUmUpsiACmNAAAGAUpsiUCCGUGGAGAGGA ACAACUCUGAGUCUUAAACCAAUUUUUUGAGGCCUUGUCUUGA(G)CAAGGCUOH. The 5'-end of the RNA is blocked with a cap structure. In addition to the modified nucleotides around the 5'-end (XpppAmUmA), U5 RNA contains Gm at position 38, Um at position 42, psi at position 44, Cm at position 46, N at position 47, and psi at position 54 as modified nucleotides. U5 RNA is present as a mixture of several species with microheterogeneity, whose lengths are 117, 118, or 119 nucleotides. The major species, with 117 nucleotides, comprised approximately 60% of the total U5 RNA. A region near the 3'-end forms a stable second structure, which causes sequence compression on electrophoresis in polyacrylamide gel. To surmount with this obstacle, we developed a chemical modification procedure with sodium bisulfite prior to partial hydrolysis in formamide, which allows denaturation of the secondary structure in polyacrylamide gel containing 7 M urea. The procedure provides a good system for checking RNA sequences determined by electrophoresis in polyacrylamide gel which might have apparent deletions on account of sequence compression.

Chemical requirements of vasopressins for barrel rotation convulsions and reversal by oxytocin.

When vasopressin is administered into the lateral ventricles of rats it produces severe convulsive activity characterized by a rapid barrel rotation. Electrical recordings from the dorsal hippocampus indicate marked elevations in the amplitude and frequency at doses of 5 microliter of 2 x 10(-5) M vasopressin. No significant behavioral effects were noted with oxytocin, somatostatin, beta-melanophore-stimulating hormone, adrenocorticotropin, or leu-enkephalin. Pretreatment of the rats with intraventricularly administered oxytocin, beta-MSH, or systemically administered Dilantin prevented the vasopressin-induced seizures. With the use of chemical and enzymic modification procedures, the essential fragment and amino acids of vasopressin needed for the activity were determined. It was concluded that although the peptide could be acting by vasoconstricting blood arterioles and capillaries in the brain, it may also be exerting a direct excitatory action on neurons.

Chemical modification of ribosomes with dimethyl sulfate: a probe to the structural organization of ribosomal proteins and RNA.

Ribosomal proteins from [14-C]dimethyl sulfate treated with 30S and 50S subunits of Escherichia coli ribosomes were separated by two-dimensional polyacrylamide gel electrophoresis and the degree of methylation of each protein was determined. Comparison of the results from this relatively non-specific chemical modification procedure with results from the milerd lysine-specific reductive alkylation procedure reported previously (Moore, G. & Crichton, R.R. (1974) Biochem. J. 143, 607-612) has permitted a topographical classification of ribosomal proteins in terms of 'degree of exposure' in the 30S and 50S subunits. The reaction of dimethyl sulfate with ribosomal RNA, both in intact subunits and after isolation from the subunits, has indicated that approximately half of the RNA in 30S and 50S subunits is exposed on the surface of the ribonucleoprotein complexes, and that no large sections (extended sequences) of 16S RNA are concealed in the 30S subunit. It is proposed that modification of ribosomes with dimethyl sulfate is a potentially useful technique for probing exposed and hidden regions and also exposed single-stranded regions of RNA in ribosomes.

The Presence of Arginyl Residues and Carboxylate Groups in the Phosphorylcholine-Binding Site of Mouse Myeloma Protein, HOPC 8

Abstract The participation of certain amino acid residues in the phosphorylcholine-binding sites of the mouse myeloma protein, HOPC 8, has been investigated by chemical modification procedures. Glyoxalation of two-thirds of the arginyl residues of HOPC 8, in the absence of protecting ligand, resulted in the complete loss of binding activity; glyoxalation in the presence of phosphorylcholine resulted in retention of about 50% of the sites. Maleylation of all free amino groups of HOPC 8 caused a minor loss (∼20%) of binding activity whether or not ligand was present during the modification. Esterification of approximately one-quarter of the carboxylate groups of HOPC 8 resulted in a significant loss of binding sites and this loss could be partially prevented by the presence of ligand. These results are interpreted as indicating the presence of arginyl and glutamyl or aspartyl residues as contact amino acids in the binding site of HOPC 8, providing complementary positive and negative charges for binding, respectively, the negatively charged phosphoryl moiety and the positively charged choline moiety of the ligand. Lysyl residues are probably not involved directly in the specific site-ligand interaction.

Arginine and lysine in binding sites of anti-5-azoisophthalate antibodies

Antibodies from individual rabbits, directed against 5-azoisophthalate have been examined for the presence of lysine in their combining sites by complete maleylation of amino groups in the absence and presence of hapten, and for arginine by glyoxalation of guanidinium groups in the absence and presence of hapten. By each procedure, antibody sites were lost when hapten was absent and this loss could be partially prevented when hapten was present during the chemical modification procedure. The results indicate that a large proportion of the sites of anti-5-azoisophthalate antibodies studied contain arginine and that a small proportion contain lysine.

Identification of Essential Carboxyl Groups in the Specific Binding Site of Bovine Trypsin by Chemical Modification

Abstract The carboxyl groups essential for the enzyme activity of bovine trypsin were labeled and identified by means of a chemical modification procedure. Chromatographically purified bovine β-trypsin, which contains a single polypeptide chain, was treated with the water-soluble carbodiimide, 1-ethyl-3-dimethylaminopropyl carbodiimide, and glycinamide, according to the method of Koshland et al. (13–15). Coupling of the protein carboxyl groups with glycinamide in amide linkage resulted in nearly complete loss of the enzyme activity as determined by an esterolytic assay using Nα-benzoyl-l-arginine ethyl ester as substrate. The extent of modification of the carboxyl groups and the extent of enzyme inactivation were found to be decreased in the presence of the competitive inhibitor benzamidine, indicating that certain essential carboxyl groups were protected from modification by the inhibitor. The carboxyl groups masked by the inhibitor were then reacted, after removal of the inhibitor by dialysis, with the carbodiimide reagent and 14C-glycinamide. After enzymatic degradation of the radioactive trypsin derivative, the labeled peptides were isolated and identified by their amino acid composition. The primary site of labeling was found to be aspartyl-177, strongly suggesting that this residue provides the anionic center for specific substrate binding. Some radioactivity was also associated with Asp-182. This residue reacted very slowly with the carbodiimide reagent, but it could be readily modified in the presence of 8 m urea, indicating that it is partially buried in the molecule. In 8 m urea, another carboxyl group, Asp-90, became available to modification. The failure of this residue to react in the native state suggests that Asp-90, which is homologous with an aspartyl residue known to be buried in chymotrypsin (21), is completely buried in the trypsin molecule. The enzyme which had been modified in the absence of benzamidine and had lost 99% of its specific esterolytic activity retained its reactivity toward diisopropyl phosphorofluoridate to a significant extent, indicating that the inactivation was due primarily to loss of the specificity site. The reaction of tyrosine with the carbodiimide was not a major cause of the inactivation because the regeneration of tyrosyl residues by hydroxylamine resulted in no significant change in the activity of modified trypsin preparations.