Chardonnay Vines Research Articles

Vine Performance and Phenology Postponement in Cane-Pruned Chardonnay Vines Grown in a Temperate Climate: The Effects of a Delayed Winter Pruning

In a global warming context, the advancement and compression of maturity in early ripening grape varieties suited to sparkling wine making can easily expedite harvest within the first two weeks of August (in northern Italy). Such earliness, albeit safeguarding acid retention, involves potential suboptimal grape composition and triggers logistical issues related to grape harvest and delivery. Hence, this three-year study beginning in 2020 was conducted on cane-pruned Chardonnay vines, grown in the Franciacorta district of Lombardy, to assess if a single-step delayed winter pruning was able to postpone vine phenology and ripening, without harming yield potential. Control (C) vines pruned midwinter were compared with those subjected to late winter pruning (LWP), performed when the apical shoots growing on the unpruned canes had reached the 2-3 unfolded leaf stage (T1) as well as 7-8 days later (T2). In 2022, a fourth treatment was added, consisting of a two-step procedure with finishing performed at T1 (LWP-two canes). Vegetative growth, yield components, ripening dynamics, and maturity at harvest were followed in each year of this study. Budburst delay induced by LWP treatments across seasons varied between 4 and 9 days, whereas harvest was postponed by 5–14 days. The extent of delay was especially pronounced in 2020, when the removed leaf area (LA) was also found to be the highest. The higher the removed LA, the higher the yield constrain was in the concomitant year. In 2020 and 2021, despite the harvest delay, LWP vines were able to assure full matching with desirable features in must composition, set at total soluble solids (TSS) of about 18°Brix and a titratable acidity (TA) of at least 8 g/L. In the very hot and dry phase of 2022, none of the treatments facilitated the required ripening status, while data showed that an even earlier ripening would not have allowed the harvest to reach the minimum TSS level. Notably, even in 2021 and 2022, when the removed LA was quite low, a delaying effect was prompted in the seasonal trends of all main ripening parameters. This suggested that besides the amount of LA removal, other unknown factors drive the postponement of ripening. In 2022, the behavior of added-treatment LWP-two canes was found to be quite similar to that of the C vines. Depending upon the desired yield level and local climate feature, the protocol entailing a single-step late winter pruning, performed at any time between the T1-T2 time window used in this study, is deemed as effective in achieving a significant harvest delay while maintaining or even improving the compositional patterns recorded for midwinter pruned vines.

Effects of Nighttime Applications of Germicidal Ultraviolet Light upon Powdery Mildew (Erysiphe necator), Downy Mildew (Plasmopara viticola), and Sour Rot of Grapevine.

Nighttime applications of germicidal ultraviolet were evaluated as a means to suppress three diseases of grapevine. In laboratory studies, UV-C light (peak 254 nm, FWHM 5 nm) applied during darkness strongly inhibited the germination of conidia of Erysphe necator, and at a dose of 200 J/m2 germination was nil. Reciprocity of irradiance and duration of exposure with respect to conidial germination was confirmed for UV-C doses between 0 and 200 J/m2 applied at 4 or 400 seconds. When detached grapevine leaves were exposed during darkness to UV-C at 100 J/m2 up to 7 days before they were inoculated with zoospores of Plasmopara viticola, infection and subsequent sporulation was reduced by over 70% compared to untreated control leaves, indicating an indirect suppression of the pathogen exerted through the host. A hemicylindrical array of low-pressure discharge UV-C lamps configured for trellised grapevines was designed and fitted to both a tractor-drawn carriage and a fully autonomous robotic carriage for vineyard applications. In 2019, in a Chardonnay research vineyard with a history of high inoculum and severe disease, weekly nighttime applications of UV-C suppressed E. necator on leaves and fruit at doses of 100 and 200 J/m2. In the same vineyard in 2020, UV-C was applied once or twice weekly at doses of 70, 100, or 200 J/m2, and severity of E. necator on both leaves and fruit was significantly reduced compared to untreated controls, and twice-weekly applications at 200 J/m2 provided suppression equivalent to a standard fungicide program. None of the foregoing UV-C treatments significantly reduced the severity of P. viticola on Chardonnay vines compared to the untreated control in 2020. However, twice-weekly applications of UV-C at 200 J/m2 to the more downy mildew-resistant Vitis interspecific hybrid cultivar Vignoles in 2021 significantly suppressed foliar disease severity. In commercial Chardonnay vineyards with histories of excellent disease control in Dresden, NY, E. necator remained at trace levels on foliage and was nil on fruit following weekly nighttime applications of UV-C at 200 J/m2 in 2020, and after weekly or twice-weekly application of UV-C at 100 or 200 J/m2 in 2021. In 2019, weekly nighttime applications of UV-C at 200 J/m2 also significantly reduced the severity of sour rot, a decay syndrome of complex etiology, on fruit of the Vitis interspecific hybrid cultivar 'Vignoles', but not the severity of bunch rot caused by Botrytis cinerea. A similar level of suppression of sour rot was observed on Vignoles vines treated twice-weekly with UV-C at 200 J/m2 in 2021. Nighttime UV-C applications did not produce detectable indications of metabolic abnormalities, phytotoxicity, growth reduction, or reductions of fruit yield or quality parameters, even at the highest doses and most frequent intervals employed.

Occurrence of grapevine-associated tymo-like virus in wine grapes in the United States.

Grapevine-associated tymo-like virus (GaTLV) was reported to infect several grapevine cultivars in France (Hily et al. 2018). Recently, GaTLV-specific reads were identified among high-throughput sequencing (HTS) outputs from a pooled sample of grapevines in Tennessee, but the virus presence in individual plants was not confirmed by the RT-PCR testing with specific primers (Hu et al. 2021). In Idaho, several viruses infect wine grapes, such as grapevine leafroll-associated virus 3 (GLRaV-3; Mekuria et al. 2009; Thompson et al. 2019a), grapevine fleck virus (Kanuya et al. 2012), grapevine red blotch virus (Thompson et al. 2019b), and grapevine rupestris vein feathering virus (Dahan et al. 2021), while GaTLV status was not tested for previously. In September 2020 leaf and petiole samples of six different cultivars were collected from six vineyards in Canyon and Nez Perce counties of Idaho, for a total of 16 samples. Most of the samples were selected based on symptoms of vine decline, grapevine leafroll disease (GLD), or other abnormalities. Ribodepleted total RNAs prepared from these samples as described previously (Thompson et al. 2019a) were subjected to a HTS analysis on a NovaSeq platform, producing between 15,095,042 and 31,500,611 250-bp paired-end reads per sample. Raw reads were adapter and quality cleaned and mapped against the Vitis vinifera L., reference genome. Unmapped paired-end reads were assembled, and contigs were analyzed using BLASTn and DIAMOND (Buchfink et al. 2021) programs. Three of the samples, two collected from own-rooted Chardonnay vines planted in 1981, and one from an own-rooted, 20-yr old Cabernet franc vine, yielded large, 6,005 to 6,024-nt contigs exhibiting 99.0% identity to the sequence of the GaTLV (MH383239) described in France (Hily et al. 2018). Conceivably, these 6,005 to 6,024-nt sequences represented nearly complete genomes of the Idaho isolates of GaTLV; they were designated GaTLV-ID1 to -ID3 and deposited in the GenBank database under the accession numbers ON853767-ON853769. Two specific primer pairs, GaT1_2009F (5'-GGCTGAGTTAAAGGACGAGAA-3') and GaT1_2648R (5'-CGCCACGCCAAGCCAATAATGCT - 3'), and GaT2_5499F (5' - GCCAGAGTTTTCGGAGGCAAA - 3') and GaT2_5905R (5'-CGCGGAAAAACAATTCAGCAA-3') amplifying 662-bp and 427-bp products, respectively, were used to test for GaTLV presence in these 2020 samples, and also in additional 18 samples collected in September 2021 from nine grapevine cultivars in three vineyards of Canyon County, Idaho. Twelve GaTLV-positive samples, out of the 34 total, were identified in five out of the seven tested vineyards located in Canyon and Nez Perce counties of Idaho (Supplementary Fig. S1), in Chardonnay (nine positives), Gewürztraminer (one positive), Cabernet franc (one positive), and an unknown cultivar (one positive). The two RT-PCR products were Sanger sequenced for ten GaTLV-positives and displayed 100% identity to the HTS-derived GaTLV-ID genomic sequences at the targeted regions. The exact role of GaTLV in the development of the symptoms of decline in Chardonnay or in GLD symptoms in Cabernet franc vines is not clear at the moment. These same Chardonnay and Gewürztraminer samples contained other GLD-associated viruses, such as GLRaV-3 (Dahan et al. 2021), while the GaTLV-positive Cabernet franc had only common viroids, hop stunt viroid and grapevine yellow speckle viroid 1, not normally associated with GLD symptoms in wine grapes (Di Serio et al. 2017). To the best of our knowledge, this is the first report of GaTLV in Idaho, and, given the lack of RT-PCR amplifications of GaTLV sequences reported by Hu et al. (2021), also the first confirmed report of GaTLV presence in wine grapes in the United States.

First report of grapevine rupestris vein feathering virus in wine grapes in Idaho.

Grapevine rupestris vein feathering virus (GRVFV) was found associated with chlorotic discolorations of leaf veins in a Greek grapevine cultivar (El Beaino et al. 2001; Abou Ghanem-Sabanadzovic et al. 2003) or with Syrah decline (Al Rwahnih et al. 2009). In the United States, GRVFV was reported to occur in California (Al Rwahnih et al. 2009) and in Washington State (Chingandu et al. 2021). Wine grape production in Idaho is known to be affected by several viruses, such as grapevine leafroll-associated virus 3 (GLRaV-3; Mekuria et al. 2009; Thompson et al. 2019a), grapevine fleck virus (GFkV; Kanuya et al. 2012), and grapevine red blotch virus (GRBV; Thompson et al. 2019b), but the GRVFV status was not addressed previously. In 2018, leaf and petiole samples from five declining Chardonnay vines were collected from a single vineyard in Canyon County of Idaho. Ribodepleted total RNA prepared from these samples was subjected to a high-throughput sequencing (HTS) analysis on a MiSeq platform as described previously (Thompson et al. 2019a), yielding between 3,623,716 and 4,467,149 300-bp paired-end reads. Briefly, raw reads were adapter and quality cleaned, mapped against the Vitis vinifera L., reference genome. Unmapped paired reads were assembled, producing between 829 and 1,996 contigs over 1,000-nt in length. All five samples were found to contain GLRaV-3 and the two common viroids, hop stunt viroid and grapevine yellow speckle viroid, while four contigs ranging in size from 1,361 to 6,736 and exhibiting homology with the GRVFV were found in three out of the five Chardonnay samples analyzed. Those GRVFV-specific contigs had 98.5-98.7% pairwise identity. A nearly complete genome of GRVFV-ID was assembled from the HTS data of one sample, and the 3'-terminus of the genome was acquired using the RACE methodology; the 6,736-nt sequence has been deposited in the GenBank database under the accession number MZ027155. BLASTn analysis of this sequence revealed 90.7% identity to the closest match in the GenBank database (MH544699, isolate SK931from Slovakia). In the fall of 2020, six commercially operating vineyards in Canyon and Nez Perce Counties of Idaho, including the original one, were sampled for the total of 26 sampled plants of white and red wine grape cultivars, based on visual symptoms of leaf reddening, leaf rolling, and chlorosis, and tested by reverse transcription (RT)-PCR using newly designed GRVFV-specific primers, GRVFV-F1 (5'- GAAGCAACAGTGCCCGTCTC -3') and GRVFV-R1 (5'- AGGTCGCTTTACGGACCTTTTCTT -3'). Four plants were found positive for GRVFV by RT-PCR; these positive samples came from three vineyards in Canyon County, from the same wine grape cultivar, Chardonnay. Amplified RT-PCR products were directly sequenced using conventional Sanger methodology, and confirmed to represent 662-nt segments of the GRVFV genome exhibiting 98.6-99.1% pairwise identity to the HTS-derived full-length genome of GRVFV-ID (MZ027155). The four corresponding partial sequences were deposited under the accession numbers MZ020577 to MZ020580. This close identity between the GRVFV sequences from three different Idaho vineyards, coming from the same cultivar Chardonnay, may suggest a common origin of the original GRVFV infection, possibly the same supplier of the original Chardonnay planting material. The California GRVFV sequence AY706994 was 80% identical to the GRVFV-ID, while the recently reported partial sequences of GRVFV from Washington State (MT782067-MT782070; Chingandu et al. 2021) were found to be only 82-85% identical to the GRVFV-ID. Presence of GRVFV might have contributed to the decline of the original Chardonnay vines, although the exact role of GRVFV in a mixed infection with GLRaV-3 is not clear at the moment. To the best of our knowledge, this is the first report of GRVFV in wine grapes in Idaho.

Seasonal dynamics and tissue distribution of two major viruses associated with grapevine Leafroll under cool climate condition

Grapevine leafroll-associated virus-2 (GLRaV-2) and GLRaV-3 are both (+) ssRNA viruses of the family Closteroviridae and are involved in grapevine leafroll, the most destructive viral disease affecting the global grape/wine industry. Outbreaks of the disease were recently reported in Canada, causing serious concerns to the grape/wine industry. Reliable, sensitive and timely detection is key to the control of the disease. However, information on their seasonal dynamics and tissue distribution under cool climate conditions has been rather limited. We conducted a two-year comprehensive study to elucidate the temporal variation and spatial distribution of both viruses through symptom monitoring, Western blotting and RT-qPCR. Sampling was done monthly from commercial Cabernet Franc and Chardonnay vines from May to October in 2015 and 2016. Both viral RNA and capsid protein levels in leaves remained low during May and June, steadily increased from late July, and peaked in September or October. Interestingly, young berries collected in June contained high levels of viral RNA for both viruses. As expected, the viral RNA levels of GLRaV-2 detected by RT-qPCR using primers targeting the CP region were much higher than those by using primers targeting the genomic RNA. Surprisingly, virtually the same levels of viral RNA were detected for GLRaV-3 regardless of the targeted genomic regions. To ensure accurate detection of both viruses, we recommend using young berries early in the season and leaves and cambial scrapings from late July to harvest. To our knowledge, this is the first report on the seasonal dynamics and tissue distribution of two major grapevine viruses in Canada.

Stomatal and non-stomatal limitations at different leaf temperatures to the photosynthetic process during the post-harvest period for Vitis vinifera cv. Chardonnay vines.

ABSTRACTPhotosynthesis in Vitis vinifera cv. Chardonnay leaves was measured during the post-harvest period in relation to leaf temperatures and chloroplast CO2 concentrations to evaluate the limitations to photosynthesis once the fruit sink was removed. Photosynthesis was optimal at 30°C and rates were higher at high compared to low temperatures, consistent with the current climate. Stomatal limitation of photosynthesis ranged from 20% at low temperatures to 45% at high temperatures. RuBP carboxylation (Vcmax) and regeneration (Jmax) were optimal at 39 and 36°C, but their capacities were low below 25°C accounting for low assimilation rates. Chloroplast CO2 concentration transitioning between RuBP regeneration and RuBP carboxylation-limited assimilation, increased steeply with increasing temperature. Assimilation of Chardonnay leaves was limited by RuBP regeneration below 35°C and by RuBP carboxylation above 35°C, consistent with increased photorespiration at high temperatures. Results provide a quantitative explanation for the photosynthetic performance of Chardonnay vines in the post-harvest period.

The accuracy and utility of a low cost thermal camera and smartphone-based system to assess grapevine water status

Smartphones have several advantages over specialist monitoring systems including ubiquity, price, and ease of implementing updates. Thermal imaging can be used to assess plant water status and allow more informed irrigation decisions; unfortunately, this technique has not been widely adopted due to the high cost of equipment and the lack of a system to provide analysis and results in real-time. Several inexpensive thermal cameras that connect to smartphones have recently been released and one of these (FLIR One) was evaluated as part of a system to assess grapevine water status. Irrigation treatments were established on Cabernet Sauvignon and Chardonnay vines in an arid region. Thermal images were taken from the shaded side of the grapevine canopy and software was developed to automatically determine the temperature of the canopy and artificial reference leaves. The temperature readings and metrological inputs were used to calculate five indices of water status including the Crop Water Stress Index (CWSI) and the stomatal conductance index. The best performing was the CWSI, which does not require input from a weather station. Over 30 days of assessment, and a range of irrigation levels, measurements collected with the thermal camera were correlated with stem water potential (R2 = 0.61) and stomatal conductance (R2 = 0.74). Windy conditions appeared to be the major cause of variation between CWSI and stomatal conductance. Inexpensive thermal cameras have the potential to be an easy and accessible tool for the assessment of plant water status and to make better irrigation decisions.

Temperature and CO2 dependency of the photosynthetic photon flux density responses of leaves of Vitis vinifera cvs. Chardonnay and Merlot grown in a hot climate

Comparisons of the photosynthetic responses to light and temperature between related cultivars are important to understand how well matched they are to the climate where they are grown. Photosynthetic light responses at a range of leaf temperatures and two CO2 concentrations were measured on leaves of two grapevine cultivars (Vitis vinifera L.) Chardonnay and Merlot vines growing in field conditions. The objective was to assess the interaction between photon flux density (PFD), leaf temperature and CO2 on photosynthesis and to compare the two cultivars. Merlot leaves maintained higher light-saturated rates of photosynthesis at all leaf temperatures compared with the Chardonnay leaves. At low temperatures, a reduced photon yield offset with a high stomatal conductance accounted for the low rates of the Chardonnay leaves. At moderate to high temperatures, photon yields, PFDs at light saturation and stomatal conductances did not account for differences between Merlot and Chardonnay leaves. At elevated CO2 (800 μmol mol−1) concentrations, the differences in photosynthetic performance between the cultivars were enhanced, with 30% higher light saturated rates for Merlot compared with Chardonnay leaves. Merlot berries accumulated more sugar, consistent with published data. These results demonstrate Chardonnay, unlike Merlot, appeared to be poorly matched to the hot climate. However, considering the current market and political trends, low alcoholic wines (and, thus, low sugar grapes) should be preferred. Especially in hot climates, it is always hard to obtain such kind of wines and, thus, the most interesting agronomical challenge, especially for Chardonnay vines could be interpreted in an opposite way.

Pruning management of Chardonnay grapevines at high altitude in Brazilian southeast

ABSTRACT The agronomical responses of Chardonnay, a variety indicated for sparkling wine production, is influenced by the vineyard management and the edaphoclimatic conditions of the region. The objective of this study was to evaluate the effects of two pruning types (Royat and double Guyot) on vegetative and reproductive development of Chardonnay vine growing at high altitude in the Brazilian southeastern region. The experiment was carried out in a commercial vineyard located at 1,280 m of altitude in Divinolândia, São Paulo State, Brazil. The Chardonnay vines (clone 96), grafted onto 1103 Paulsen rootstock and trained in a vertical shoot positioning trellis system, were assessed. Vegetative vigor, bud fruitfulness, production and physicochemical composition of grapes were evaluated during 2014 and 2015 growing seasons. The Royat pruning induced higher vegetative vigor and increased the bud fruitfulness, the cluster number and the productivity of Chardonnay vine when compared to Guyot pruning. Even though the increase on yield was observed, there was no effect of pruning type on grape final quality. Therefore, the choice of pruning method in function of variety genetic characteristics and their interaction with environment can optimize the vineyard profitability. In the Brazilian southeast, the Royat system is the most suitable one to grow Chardonnay for sparkling wines production.

Cane pruning on Chardonnay grapevine in the high-altitude regions of Southern Brazil

High-altitude regions of southern Brazil, located above 900 m above sea level, the cordon training with spur pruning is widely used because of easier application. In these regions, Chardonnay wine grape shows potential to produce quality wines, however, in commercial vineyards, the training system used has not provided productivities that makes economically viable the cultivation of this variety. Given this, the present study aimed to evaluate the effect of different cane-pruning systems on the vegetative, productive and enological potential of Chardonnay grapevines grown in the high-altitude region of Southern Brazil. The experiment was conducted in a commercial Chardonnay vineyard, located in Sao Joaquim – Santa Catarina State (28o 17 ′39”S and 49∘ 55′56” W, to 1230 m a.s.l) during 2015 and 2016 vintages. Chardonnay vines (grafted on 1103 Paulsen) were planted in 2010, with a 3.0 m (row) × 1.0 m (vine) spacing. The treatments consisted of different cane-pruning systems: Cordon spur-pruning (control); Sylvoz; Cazenave; Capovolto; single Guyot and double Guyot. Pruning was performed in August of each year when the buds were in the green tip developmental stage. Data was analyzed by Scott Knott test (p g−1 grape at 2016 vintage. Commercial maturity of grapes (soluble solids, acidity and polyphenols) did not differ among training systems studied. The results suggest that cane-pruning systems could be an alternative to increase production efficiency of Chardonnay in high-altitude region of southern Brazil.

Vessel embolism and tyloses in early stages of Pierce's disease

Background and Aims Tyloses and embolisms have been reported to impair water transport during the development of Pierce's disease (PD), caused by the xylem-dwelling pathogen Xylella fastidiosa. This work investigates the relative importance of these xylem conduit obstructions in stems of inoculated Vitis vinifera plants. Methods and Results After 18 weeks in a greenhouse, internodes from control and needle-inoculated Chardonnay vines were assessed for embolisms using non-destructive magnetic resonance imaging (MRI). Tyloses were identified by subsequent destructive histology and light microscopy examination. Embolism of individual or small sectors of vessels was detected by MRI analysis of a control shoot, usually in the proximity of the pith; virtually no tyloses were observed in the corresponding histological sections. From a symptomatic (inoculated) shoot, MRIs revealed large areas of embolised vessels extending radially towards the epidermis in most of the internodes; several individual or groups of two to three vessels appeared to be occluded with tyloses. Conclusions In all assessed internodes, MRI-detected embolisms were found more frequently than tyloses, suggesting that over the course of PD embolism formation precedes tylose development. Significance of the Study Embolisms appear to be the first and predominant type of occlusion in stems during early PD progression; nevertheless, their importance for explaining water transport impairment has been overlooked in most studies.

Effect of temperature on symptom expression and sequence polymorphism of grapevine yellow speckle viroid 1 in grapevine

Symptom expression of yellow speckle disease was studied in a row of 32 individual Vitis vinifera cv. Chardonnay vines in the warmer summer of 2009/2010 as compared with the cooler summer of 2011/2012 in South Australia. RT-PCR analysis showed that all these vines were positive for hop stunt viroid, grapevine yellow speckle viroid 1 (GYSVd-1) and grapevine rupestris stem pitting-associated virus. Four vines named Vines 1, 8, 11 and 15 were selected for further analyses. Vines 1 and 8 had never shown yellow speckle (YS) symptoms, Vine 11 had always been symptomatic, and Vine 15 showed YS symptoms only in the summer of 2009/2010, but not in 2011/2012. Analysis of partial nucleotide (nt) sequence of GYSVd-1 from these vines showed two major sequence polymorphisms in the pathogenicity domain coinciding with the YS symptoms and the prevailing temperature in each season. One group designated UA group had a uridine (U) at position 309 and an adenine (A) at position 311, while another group designated AU group had the other way around: an “A” at position 309 and a “U” at position 311. The AU group had never been reported before. The AU group was a minor variant in the GYSVd-1 population and not present in symptomatic Vine 11. In contrast, the UA group was dominant and present in all the vine samples. Surprisingly, all the asymptomatic vines, but not symptomatic vines, had the signature of the AU group. Whether the AU group is associated with the YS symptom expression is interesting. Our result provides a new insight into the sequence variability of viroid-inducing symptoms during two significantly different growing seasons.

Effect of delaying budburst on shoot development and yield of Vitis vinifera L. Chardonnay ‘Mendoza’ after a spring freeze event

Background and Aims: Spring freeze events can result in substantial grapevine yield losses in many parts of the world. Understanding vine responses following early spring freeze events will aid in the development of decision support systems for vineyards damaged by freezing temperatures. Methods and Results: The date of budburst of spur-pruned Chardonnay vines was manipulated by pruning time and/or the application of sodium alginate gel. A spring freeze event occurred at bud swell/woolly bud, killing 33% of the developing shoots. Treatments that delayed bud development expressed a lower incidence of freeze damage (as low as 3%). Where primary shoots had been killed, secondary shoots developed in their place. The yield from secondary shoots was 32% of that from primary shoots, with the majority of fruiting secondary shoots bearing only one bunch. Average bunch weight, number of berries per bunch and average berry weight of secondary shoots were comparable with those from primary shoots. Conclusions: The damage to primary shoots caused by early spring freeze events can be reduced by using treatments that delay bud development. Secondary shoots develop in response to death of the primary shoot, and although they have reduced fruitfulness, they can partially mitigate the potential yield losses associated with the death of primary shoots. Significance of the Study: The number and fruitfulness of secondary shoots that develop after a spring freeze event determine the extent of mitigation of yield losses associated with the death of primary shoots.

Impact of rootstock on yield and ion concentrations in petioles, juice and wine of Shiraz and Chardonnay in different viticultural environments with different irrigation water salinity

Background and Aims: Within-site comparisons were made of rootstock effects on yield, and chloride and sodium concentrations in petioles, juice and wine of Shiraz and Chardonnay vines at sites with irrigation water salinities (ECiw) ranging from low (0.4 dS/m) to moderate-high (1.8 to 3.3 dS/m). It also compared consistency of yield performance of the various rootstocks with both scions over 8 years at one site with an ECiw of 2.1 dS/m. Methods and Results: Chardonnay and Shiraz on own roots and on Ramsey, 1103 Paulsen, 140 Ruggeri, K51-40, Schwarzmann, 101-14, Rupestris St. George and 1202 Couderc were compared. Ramsey resulted in better yields relative to most of the other rootstocks at three of the four sites for each scion. Exceptions were the low salinity site where Schwarzmann was best with Chardonnay, and Padthaway where 140 Ruggeri was best with Shiraz. Chardonnay wine chloride concentrations were similar to grape juice chloride concentrations, but Shiraz wine chloride concentrations were on average 1.7-fold higher than grape juice chloride. Conclusions: Shiraz on own roots, K51-40 and 1202C rootstocks carry some risk of accumulating unacceptable levels of chloride in grape juice and wine when the salinity of the irrigation water is at moderate to high levels. Rootstocks K51-40 (with Chardonnay and Shiraz) and potentially 101-14 (with Shiraz) should be avoided in situations of long term irrigation with moderate to high salinity water. Significance of the Study: The study identifies rootstocks with acceptable yields and grape juice chloride concentrations for potential use in regions affected by salinity.

Association of Grapevine fanleaf virus, Tomato ringspot virus and Grapevine rupestris stem pitting-associated virus with a grapevine vein-clearing complex on var. Chardonnay

A disease complex was observed on grapevine var. Chardonnay (Vitis vinifera) in a commercial vineyard in Missouri that destroyed the affected vineyard. Conspicuous vein-clearing symptoms on the leaves of originally diseased Chardonnay vines and bud-grafted Chardonnay, V. vinifera ‘Cabernet Franc’, V. vinifera ‘Baco Blanc’, and hybrid ‘LN-33’ vines are characteristics of the disease complex, which is referred to as the grapevine vein-clearing complex (GVCC). By applying reverse-transcription polymerase chain reaction (RT-PCR) using virus-specific primers, we detected combinations of Grapevine fanleaf virus (GFLV), Tomato ringspot virus (ToRSV) and Grapevine rupestris stem pitting-associated virus (GRSPaV), in symptomatic Chardonnay vines. Sequencing of RT-PCR amplified DNA fragments confirmed the identity of each virus, indicating the occurrence of ToRSV yellow vein strain, and two distinct strains of GRSPaV in the GVCC-affected Chardonnay vines. This is the first report of the co-infection of two nepoviruses and GRSPaV in var. Chardonnay. This study demonstrated that mixed infections of grapevine viruses belonging to different taxonomic groups pose a great threat to vineyards under certain climatic and soil conditions.

Mealybugs and the spread of grapevine leafroll-associated virus 3 (GLRaV-3) in a New Zealand vineyard

The spread of grapevine leafroll-associated virus 3 (GLRaV-3) through a newly planted block of Merlot and Chardonnay grapevines in a commercial vineyard was measured between 1998 and 2003. The population changes of the mealybug vector (Pseudococcus longispinus) were recorded over the same period in 12–17-year-old GLRaV-3-infected grapevines immediately adjacent to two sides of the new block. Relationships between the spread of GLRaV-3 and mealybug numbers were examined. Mealybugs developed through three generations a year and populations were low for 4 of the 6 years. Numbers were usually higher in the 12–17-year-old Sauvignon Blanc vines and adjacent young 1–6-year-old Merlot vines than in the 12–17-year-old Breidecker and adjacent young 1–6-year-old Chardonnay vines on the other side of the block. However, GLRaV-3 spread more rapidly in young Chardonnay vines than in young Merlot vines. New infections in both Merlot and Chardonnay initially occurred at random, but newly infected vines were more often clustered from 2002 to 2003, and especially in Merlot. Most newly infected Chardonnay were recorded in the years following the highest numbers of mealybugs, in 1997–98 and 2000–01, but the disease spread more gradually in the Merlot. The data indicated that GLRaV-3 did not spread into the new block when third generation mealybug populations in adjacent infected vines were lower than ∼5 mealybugs/leaf. Three methods for virus transmission by mealybug were proposed: one method was from natural, crawling dispersal of infected mealybugs, leading predominantly to within-row, vine-to-vine transmission; another method was from human-assisted movement of mealybug crawlers (such as on vineyard machinery) leading to random but localised infection on a within- or between-block scale; and a third method was through aerial dispersal of infectious mealybugs, resulting in random infections of vines and particularly operating on a between-block or between-vineyard scale. Infection in any vineyard probably occurs by all three methods, mediated by the poorly understood, and possibly site- and grape variety-specific, transmission ecology that underpins the mealybug-virus-vine relationships.

Observations on the morphology and development of star flowers ofVitis viniferaL. cvs Chardonnay and Shiraz

Background and Aims: Following our original discovery of star flowers on grapevines in Australia, further variants of the star flower phenotype have been discovered on other varieties in South Australia. The objective of this report was to describe star flowers on Vitis vinifera L. cvs Chardonnay and Shiraz. Methods and Results: Field and microscopic observations revealed that star flowers on both varieties opened precociously; there was neither pollen nor pollen tubes on the stigmas of the star flowers, and both Chardonnay and Shiraz star flowers contained aberrant ovules. The Chardonnay vines with star flowers produced bunches with an abundance of seedless berries; however, star flowers on Shiraz vines did not develop into berries. Conclusions: The inability of the Shiraz star flowers to develop into berries suggests that either there are two different mutations affecting these two varieties, or else the difference lies in their contrasting parthenocarpic tendencies. Significance of the Study: The star flower variants described here and previously may be the result of deviations to the normal molecular pathway for flower development in Vitis species. The identification of star flowers on numerous varieties and in several different regions suggests that the occurrence of star flowers may be more widespread than previously realised, and the association of star flowers with the production of seedless berries and poor fruitset suggests that star flowers may also play a significant role in the problem of poor fruitset.

Effect of reduced irrigation on growth, yield, ripening rates and water relations of Chardonnay vines grafted to five rootstocks

Background and Aims: In the first decade of the 21st century, drought within the Murray–Darling Basin has reduced the amount of water available for irrigation. We investigated whether the response of vines to reduced irrigation was modified by rootstock. Methods and Results: Reduced irrigation (5 versus 8 ML/(ha·year)) was applied to Chardonnay vines grafted to five rootstocks (Ramsey, 140 Ruggeri, 1103 Paulsen, 110 Richter and K51-40) for four seasons. It decreased the yield from 29.3 to 26.7 kg/vine, and increased the irrigation water use index (IWUI) from 4.7 to 6.6 t/(ha·ML), but gains in this index declined as the trial progressed. The values of mid-afternoon leaf water potential were not affected by reduced irrigation, but leaf CO2 assimilation declined from 13.1 to 11.7 µmol/(m2·s). These effects were independent of rootstock. Reduced irrigation did not increase soil salinity (ECe) or vine tissue Na and Cl concentrations. Vines on Ramsey and 1103 Paulsen rootstocks had higher yields, 32.2 and 30.0 kg/vine, respectively, and the highest IWUIs, 5.9 and 5.5 t/(ha·ML). In two of the three seasons, reducing irrigation did not affect the rates of ripening (°Brix/growing degree days) excepting vines on 1103 Paulsen. Ripening rates varied by 1.5-fold between seasons. Conclusion: The yield and growth responses of Chardonnay vines to a 35% reduction in irrigation were not modified by rootstock. Significance of the Study: Reducing irrigation did not lead to a build-up of soil salts. The response of vines to reduced irrigation on rootstocks rated as having good drought tolerance was the same as that for vines on a rootstock rated as having poor drought tolerance.

Development of inflorescence primordia in Vitis vinifera L. cv. Chardonnay from hot and cool climates

Background and Aims: The purpose of this study was to gain a quantitative understanding of environmental effects on the formation of yield potential; it is critical that the timing of anlagen initiation and differentiation in latent buds is defined for economically important Vitis vinifera L. cultivars in a range of environments. Methods and Results: This study combined scanning electron microscopy with light microscopy to compare the timing and extent of inflorescence primordia (IP) initiation and differentiation (branching) in primary latent buds of Chardonnay vines grown in a hot (mean January temperature (MJT) 22.3°C) and a cool (MJT 18.1°C) climate. Initiation of anlagen (uncommitted primordia) in dormant buds at node 4 commenced 4 weeks after budburst (BB) in the hot climate and 6 weeks after BB in the cool climate. Subsequent differentiation of anlagen was first observed 6 and 9 weeks after BB in the hot and cool climate, respectively. Conclusions: The extent of IP differentiation varied with climate, with hot climate buds at modified Eichorn and Lorenz scale (E-L) (Coombe 1995) stage 33 being more advanced, larger and exhibiting more widespread secondary branching than cool climate buds. Significance of the Study: This research provides new insights into the timing and extent of reproductive development in Australia's most important white grape cultivar, Chardonnay, thereby having implications for strategic management and forecasting potential yield.

Characterization of a Severe Virus-like Disease in Chardonnay Grapevines in Missouri

A severe virus-like disease emerged on Chardonnay vines in a Missouri vineyard that resulted in significant reduction of vine vigor and yield. The pathogens can be transmitted via cutting and grafting. Chardonnay, Cabernet franc and Baco franc vines that were grafted with the buds of the original diseased Chardonnay vines exhibited distinct vein-clearing symptom. The result of reverse transcription polymerase chain reaction indicated the association of Grapevine fanleaf virus with this disease.Accepted for publication 26 September 2007. Published 19 November 2007.