Cereblon Mutations Research Articles

Investigating the Functional Impact of CRBN Mutations on Response to IMiD/Celmod Agents in Myeloma

Introduction Immunomodulatory drugs (IMiDs) have revolutionized the treatment of myeloma (MM), with lenalidomide (Len) and pomalidomide (Pom) approved and novel cereblon E3 ligase modulators (CELMoDs, e.g. iberdomide, Iber and mezigdomide, Mezi) in clinical trials. IMiDs and CELMoDs bind to cereblon (CRBN), which is part of the CRL4 CRBN Ubiquitin E3 ligase complex, leading to the ubiquitination and subsequent degradation of neo-substrates including the transcription factors Ikaros and Aiolos which are critical for MM cell survival. Previous data suggests almost one third of myeloma patients acquire CRBN mutations by the time they are Pom refractory. Some events, including stop codons/frameshift mutations and copy loss, have clearly explicable effects on cereblon function. However, many are point mutations with some occurring outside of the thalidomide binding domain and at variable cancer clonal fractions. We sought to understand which mutations were deleterious to cereblon function and whether any mutations were associated with a differential response between IMiDs and CELMoDs. Methods From the 36 CRBN mutations previously reported in patient datasets, 12 missense mutations were selected for functional investigation (fig.1a). All mutations were mapped on to the publicly available crystallographic 3D structures of CRBN bound to IMiDs and CELMoDs to aid in predicting the potential functional effect of each mutation. CRBN knock out (KO) MM1.s cell lines were generated using CRISPR-Cas9 and confirmed to have homozygous loss at the first few exons of the CRBN sequence. Once validated, two independent MM1.s CRBNKO cell line clones were transduced with plasmids expressing either CRBN wild type control (CRBN WT) or mutated CRBN (generated using site directed mutagenesis) leading to stable expression. All cell lines were assessed for response to IMiDs and CELMoDs using cell viability assays (CellTitre Blue, 5 days, Len max. concentration 20uM, Pom 8uM, Iber 2uM and Mezi 1uM) and their ability to degrade neo-substrates assessed using Western blotting for Aiolos and downstream effects using RT-qPCR for IRF4, at 24 hrs. Results Knock out of CRBN in MM1.s cells led to complete resistance to IMiDs/CELMoDs. The re-expression of wild type CRBN re-sensitised MM1.s CRBNKO cells to IMiDs/CELMoDs with degradation of Aiolos, downregulation of IRF4 and a similar effect on cell viability to that seen in parental MM1.s. In contrast, the “positive control” mutation p.W386A located within the tri-tryptophan IMiD/CELMoD binding pocket appeared to completely inactivate CRBN with no change in Aiolos/IRF4 expression levels and no effect on cell viability after incubation with all IMiDs/CELMoDs. A second mutation, also in very close proximity to the tri-tryptophan binding pocket and within the neo-substrate binding area (p.H397Y), had the same effect suggesting mutations here entirely prevent all IMiD and CELMoD activity (fig.1b). In contrast, some CRBN mutations appeared to have no deleterious effect on CRBN function with response to all IMiDs and CELMoDs regained on re-expression at the same magnitude as seen with wild type CRBN re-expression. These mutations included all those located in the Lon protease-like domain (p.D50H, p.A143V, p.L190F, p.R283K) and two within the thalidomide binding domain but not close to the tri-tryptophan binding pocket nor neo-substrate binding area (p.A347V and p.W415G)(fig.1b). The remainder of the mutations studied appeared to abrogate the activity of the IMiDs lenalidomide and pomalidomide but retained some response (both degradation and viability) to iberdomide (p.C326G), and to a greater extent mezigdomide (p.C326G, p.P352S, p.C366Y and p.F381S), suggesting these compounds were able to partially compensate the effect of the mutation (fig.1b). This may be due to the more potent CELMoD compounds being able to overcome structural changes induced by some mutations but not others. Discussion These data highlight key differences in the functional impact of different CRBN missense mutations that have been previously identified in patients. These results may have important implications for the interpretation of CRBN sequencing results from patients for future therapy decisions, particularly differentiating those who may, despite relapsing on IMiDs with CRBN mutations, have the potential to still benefit from the use of CELMoD agents.

Multiomics Analysis of IMiD/CELMoD Resistant Multiple Myeloma Models Uncovers Novel and Targetable Vulnerabilities in the SREBP Lipid Synthesis Pathway

Background Acquired resistance to immunomodulatory drugs (IMiDs)/cereblon (CRBN) E3 ligase modulators (CELMoDs) is a major challenge in multiple myeloma (MM) treatment. These drugs bind to the CRBN component of the CRL4CRBN E3 ubiquitin ligase and designate a new set of substrates for degradation via the proteasome. Generation of resistance is frequently associated with decreased CRBN expression and this is due to genetic alteration in ~1/3rd of patients. Alternative drivers of the low CRBN state, and other mechanisms of resistance, need to be elucidated. To tackle this complex problem, MM models with acquired IMiD/CELMoD resistance were generated and multiomics analysis performed. Methods IMiD/CELMoD resistant human MM cell lines were generated by treating MM1s and H929 cells with lenalidomide (Len), pomalidomide (Pom) or iberdomide (Iber) at ~10x GI50 concentration for ~12 weeks until resistance was achieved. Resistant cell lines and controls were characterised by whole exome sequencing (WES), RNA-Seq and proteomics. A genome-wide loss-of-function CRISPR screen (Brunello library) was carried out in Iber-resistant MM1s; gene effect scores were calculated with the Chronos model and compared to parental MM1s using data from the Broad Institute DepMap portal. Pathway analysis was performed using g:Profiler. The Membrane Bound Transcription Factor Peptidase, Site 1 (MBTPS1) inhibitor PF-429242 was used to inhibit activation of the Sterol Regulatory-Element Binding Protein (SREBP) pathway and the effect on cell viability measured using CellTiter-Blue®. The Multiple Myeloma Research Foundation CoMMpass database was used to explore the correlation between mRNA expression of SREBP pathway genes in newly diagnosed patients and progression-free survival (PFS). Results All models were resistant to the IMiD/CELMoD with which they were generated (to 20-100x the GI50 concentration) and exhibited cross-resistance to other IMiDs/CELMoDs. Functional assays showed that well-characterised effects of IMiD/CELMoD treatment, e.g. degradation of Ikaros/Aiolos, were abrogated. WES showed Pom-resistant MM1S and Pom- and Iber-resistant H929 cells had acquired mutations in CRBN predicted to have a high impact on function. Len-resistant H929 cells had new copy number loss at the CRBN locus but Len- and Iber-resistant MM1s cells had no genetic changes in CRBN. CRBN protein expression was reduced in all resistant lines compared to control (log2 fold changes (FCs) by proteomics ranging from -0.25 to -1.95, adj p <0.05). Together these models display diverse resistance mechanisms, reflecting the clinical picture. Proteomic analysis of the resistant lines identified key changes in the SREBP pathway. The proteomes of the resistant lines were heterogeneous and the only pathway with common significant enrichment was SREBP/fatty acid metabolism (on analysis performed per cell line of proteins with significantly decreased expression). Stearoyl-CoA Desaturase (SCD), a key effector of the SREBP pathway, was one of only 5 proteins with significantly altered expression in all 6 cell lines compared to control. SCD had log2FCs ranging from -0.37 to -1.50 (adj p <0.05). Other key pathway members are shown in Figure 1. A genome-wide CRISPR screen using Iber-resistant MM1s cells identified potential new dependencies (gene effect score <-1 in resistant cells and >-0.5 in parental cells) in 47 genes including SCD and MBTPS1. MBTPS1 is critical for activation of the SREBP pathway and demonstrated one of the largest changes in gene effect (-1.4 vs -0.3). The activity of PF-429242, an inhibitor of MBTPS1, was explored in the resistant lines. A significant difference in GI50 between Iber-resistant H929 cells and control was found (1uM and >10uM respectively) with greater activity in the resistant cells. The same pattern was observed with the other resistant H929 cell lines, but not the resistant MM1s. Other pathway inhibitors are being explored. The expression of genes encoding SREBP pathway components was explored in the CoMMpass dataset. High SCD or MBTPS1 mRNA expression was associated with significantly worse PFS (logrank p<0.01), providing a further rationale for targeting the pathway. Conclusions Models representing multiple different IMiD/CELMoD resistance mechanisms have unified alterations in the SREBP pathway, highlighting a role in resistance biology and potential novel and targetable vulnerabilities. Figure 1View largeDownload PPTFigure 1View largeDownload PPT Close modal

A Molecular Analysis of Cereblon-Related Immunomodulatory Drug Resistance in Commpass Multiple Myeloma Patients

Immunomodulatory drugs (IMiDs) are commonly used in first-line therapy to treat multiple myeloma (MM), a plasma cell malignancy. Previous studies have shown that cereblon (CRBN) is critical for the efficacy of IMiDs, such as lenolidomide, pomalidomide and thalidomide, in MM. In a small cohort of 9 patients with lenalidomide-resistant MM, CRBN expression decreased 20-90% after treatment. In a MM cell line, acquired deletion of CRBN was the primary genetic event conferring IMiD resistance. Although CRBN expression is copy number (CN) dependent, CN aberrations affecting CRBN are thought to be rare, with less than 2% of patients exhibiting monoallelic deletion of CRBN. We analyzed clinical and molecular data from the Multiple Myeloma Research Foundation (MMRF) CoMMpass trial (NCT145429) IA11 release to better understand the molecular basis underlying CRBN-related IMiD resistance.IMiDs were used in first-line therapy for 75% (728/971) of patients in the CoMMpass cohort. We identified five CRBN mutations in 5/891 (<1%) patients with available whole exome sequencing data at baseline, before therapeutic intervention. Four baseline CRBN mutations were nonsynonymous; two occurred in exon 3, and one each in exon 10 and 11, which are involved in forming the IMiD binding pocket. None of the four patients with both follow up data and CRBN mutations at baseline had relapsed, with follow up ranging from 18-30 months. Despite IMiD treatment in 68/84 (81%) patients between serial timepoints, no patient developed a CRBN mutation at relapse, suggesting that acquired mutations in CRBN do not play a large role in the development of IMiD resistance in treated patients.RNAseq data was available for 32 serial patients of which 23 (72%) were IMiD treated. Only a subset of IMiD-treated patients (13/23, 57%) exhibited a decrease (ranging from 5-75%) in CRBN expression at relapse, however the decrease from baseline (mean = 41.4 transcripts per million (TPM)) to relapse (mean = 26.8 TPM) was significant (p=0.004) in this group. We analyzed the change in transcript expression of nine noncoding and four protein-coding CRBN transcripts from baseline to relapse in this patient subset and found four differentially expressed non-coding transcripts and two differentially expressed protein coding transcripts; CRBN-001 ENST00000231948 (17.4 versus 10.7 mean TPM; p = 0.04) which codes the full length CRBN protein, and CRBN-010 ENST00000450014 (3.3 versus 2.1 mean TPM; p = 0.02) which is missing exons 10 and 11. Reduced expression of CRBN-001 plays the greatest role in the overall reduction of CRBN and since it contains the IMiD binding motifs, likely also plays a greater role in CRBN resistance in IMiD-treated patients. Of the 13 patients who exhibited a decrease in CRBN expression at relapse, 10 had whole genome sequencing (WGS) CN data at both timepoints and 2/10 (20%) patients experienced CRBN CN loss from baseline to relapse. This suggests that CRBN CN loss may account for acquired IMiD resistance in a larger subset of patients than previously reported.Across the cohort, 14/871 (2%) patients with WGS data exhibit CRBN CN loss at baseline, while 342/871 (39%) patients exhibit CRBN CN gain, primarily whole chromosome gains related to trisomies of chr3 in a subset of hyperdiploid patients at baseline. Survival analyses revealed that IMiD-treated patients with CRBN CN gains at baseline exhibit better progression free survival (PFS) (median = 43 months) and overall survival (OS) (median = 55 months) than non IMiD-treated patients with CRBN CN gains (median PFS = 24 months, p<0.0001, median OS not reached, p<0.001). Although not significant, IMiD-treated patients with CRBN CN gains exhibit better PFS than IMiD-treated CN-normal patients (median = 39 months), suggesting that patients with CRBN CN gains at baseline may benefit from an IMiD based treatment regimen. Overall, these results highlight that chr3/CRBN CN gain can be a predictor of good outcome in IMiD treated patients and demonstrate the clinical benefit of obtaining CRBN CN and expression data throughout a MM patient's disease course. DisclosuresNo relevant conflicts of interest to declare.

IKZF1/3 and CRL4CRBN E3 Ubiquitin Ligase Mutations Associate with IMiD Resistance in Relapsed Multiple Myeloma

Immunomodulatory drugs (IMiDs) provide the backbone for various Multiple Myeloma (MM) treatment regimens. Cereblon (CRBN) is the known key modulator of the IMiD anti-tumor effects as it is the intermediate protein within the CRL4CRBN E3 ubiquitin ligase (CRL4) complex that targets the degradation of the two transcription factors, Ikaros (IKZF1) and Aiolos (IKZF3). We hypothesize that the formation of thiscomplex (CRBN-DDB1-CUL4B-ROC1) is essential for the IMiD's action and that mutations that occur in involved genes affect its assemblage, thus induce IMiD resistance.Targeted sequencing was performed using the M3P (v2.0 or v3.0) gene selection. Average sequencing depth was 700X. We have combined data from different cohorts analyzed with the M3P for a total of 501 patients, 337 newly diagnosed and 164 pretreated. We also included data from the CoMMpas trial (804 newly diagnosed MM analyzed by WES with 100X average depth).We analyzed a total of 1.305 MM cases and identified 53 mutations in 42 patients within CRBN, IKZF1, IKZF3 and CUL4B . Mutation frequency increased significantly after treatment (Z-score: 6.9, p<0.001), with 1.9% in untreated (22/1141) and 12.2% in (20 /164) pretreated cases. Of note, this analysis does not include either DDB1, one of the binding partners of CRBN in the complex, nor ROC1, in the pretreated cohort, as it was not part of the M3P gene selection. In untreated patients, however, mutation incidence was low with 4 out of 804 (0.5%) for DDB1 and no mutation was identified in ROC1 within patients included into the CoMMpass trial.CRBN was the most commonly mutated gene within the investigated CRL4 complex genes (21 mutations /15 MM patients), followed by CUL4B (15/13). Of note, in IKZF3 (11/11) and IKZF1 (6/6) we identified two new hotspots (IKZF3 p.G159R/A and IKZF1 p.A152T, two patient each). Furthermore, five of the patients harbored mutations in IKZF1/3 within 30 amino acids previously described to be essential for IMiD sensitivity in vitro (Krönke et al., Science, 2014). 91% (20/22) of the CRBN and CUL4B mutations found in treated patients were nonsense or were located within close proximity to the binding sites of the proteins (Figure), causing loss/weakening of lenalidomide (LEN)-CRBN, CRBN-DDB1, CUL4B-DDB1 or CUL4B-ROC1 interactions. This includes a patient having progressed on Thalidomide and Pomalidomide therapy with parallel evolution of 7 subclonal mutations in CRBN, 3 located in the LEN binding and 4 in the DDB1 binding site. Response data were available for 19 out of 20 treated patients with mutations in the CLR4 complex and, strikingly, 18 (95%) of them were clinically unresponsive to IMiD treatment.In summary, CLR4 mutations are predominantly selected by therapy and correlate with IMiD resistance. In our cohort of pretreated patients the incidence of CLR4 mutations was 12%, thus we provide evidence of a significant role of single point mutations as an IMiD drug resistance mechanism in MM.Figure: Mutations in CRL4CRBN E3 ubiquitin ligase clustered in the binding sides of complex unitsA) Mutations close to the binding side of Lenalidomide. B) Mutations in the interface CRBN-DDB1 and C) DDB1-CUL4B. D) Mutations in the binding side of ROC1. The structure of the CRL4 complex was produced by the alignments LEN-CRBN-DDB1 (PDB: 4CI2) and DDB1-CUL4B-ROC1 (PDB 4A0C). CRBN CTD (LEN binding) domain is shown in gray and HBD (DDB1 binding) in plun, LEN in orange, DDB1 in sky blue, CUL4B in pink and ROC1 in yellow. [Display omitted] DisclosuresMai:Mundipharma: Other: Travel grants; Janssen: Honoraria, Other: Travel grants; Onyx: Other: Travel grants; Celgene: Other: Travel grants; Takeda: Honoraria, Membership on an entity's Board of Directors or advisory committees. Raab:Heidelberg Pharma GMBH: Research Funding. Sonneveld:Celgene Corporation, Amgen, Janssen, Karyopharm, PharmaMar, SkylineDx: Honoraria; Celgene Corporation, Amgen, Janssen, Karyopharm, SkylineDx, PharmaMar: Consultancy; Celgene, Amgen, Janssen, Karyopharm, Takeda: Consultancy, Honoraria, Research Funding. Stewart:Bristol-Myers Squibb: Consultancy; Roche: Consultancy; Celgene: Consultancy; Janssen: Consultancy; Amgen: Consultancy.

Mutations in CRBN and Other Cereblon Pathway Genes Are Only Associated with Acquired Resistance to Immunomodulatory Drugs in a Subset of Patients and Cell Line Models

Mutations in CRBN and Other Cereblon Pathway Genes Are Only Associated with Acquired Resistance to Immunomodulatory Drugs in a Subset of Patients and Cell Line Models

TRAF2 Mediates Sensitivity to Immunomodulatory Drugs in the Bone Marrow Microenvironment

The development of novel agents including immunomodulatory drugs (IMiDs) lenalidomide (Len) and pomalidomide (Pom) has improved patient outcome in multiple myeloma (MM). Previous studies have shown that IMiDs directly bind cereblon (CRBN), a substrate adaptor of Cullin4 Ring Ligase (CRL4), and activate CRL4CRBN ligase, thereby selectively targeting two B cell transcription factors IKZF1 and IKZF3 for ubiquitylation and proteasomal degradation. We have shown that IMiDs also directly bind and inhibit TP53-regulating kinase activity, resulting in MM cell growth inhibition. Importantly, IMiDs have achieved additive and synergistic anti-MM activity when combined with proteasome inhibitors and monoclonal antibodies in vitro, and are now utilized in combinations to treat newly diagnosed MM. However, development of resistance to IMiDs commonly underlies relapse of disease. To delineate mechanisms of IMiDs resistance, the majority of previous studies have focused on CRBN. Although downregulation or mutations in CRBN can be associated with IMiDs resistance, MM cells can manifest resistance without any CRBN dysfunction, indicating alternative mechanisms of IMiDs resistance. We and others have shown a critical role of the BM microenvironment in MM pathogenesis: secretion of soluble factors from cellular components activates intracellular signaling pathways that promote MM cell migration, proliferation, survival, and drug resistance. To date, however, the mechanisms whether tumor microenvironment mediates IMiDs resistance have not been fully delineated. In our genome-wide CRISPR-Cas9 knockout screening, we have validated that CSN9 signalosome complex regulates sensitivity to IMiDs by modulating CRBN expression. Our screen also identified TRAF2, a member of the TNF receptor associated factor protein family, to regulate IMiDs sensitivity. To confirm modulation of IMiDs sensitivity by TRAF2, we here individually cloned TRAF2 sgRNAs into LentiCRISPRv2 vector, and then re-introduced them into MM cells. As expected, TRAF2-KO MM cells acquired significant resistance to Pom and Len treatment. Importantly, TRAF2 KO showed no effect on CRBN expression; moreover, IMiDs treatment of TRAF2 KO MM cells still triggered IKZF1 and IKZF3 degradation associated with downregulation of IRF4, the main effector of MM cell survival. Importantly, we observed that TRAF2 KO MM cells expressed high levels of p-ERK. We and others have shown that the bone marrow (BM) microenvironment activates ERK signaling pathway and plays a crucial role in drug resistance, and here showed that co-culture of MM cells with BM stromal cells (BMSCs) or culture supernatants (SC-sup) confers resistance to IMiDs, associated with downregulation of TRAF2. These results suggest that IMiDs resistance in the BM microenvironment may be mediated by ERK signaling pathway induced by soluble factors. AZD6244 is a potent and highly selective MEK inhibitor, and we next investigated whether AZD6244 inhibits ERK1/2 activation and overcome IMiDs resistance in TRAF2 KO MM cells. Importantly, addition of AZD6244 overcame resistance to IMiDs in both TRAF2 KO MM cells and SC-sup treated TRAF2 wild-type (WT) cells. In our human MM murine xenograft model, we observed that TRAF2 WT MM cells were sensitive to Pom treatment in vivo, while TRAF2 inducible KD MM cells demonstrated resistance. Importantly, the combination of AZD6244 and Pom significantly reduced growth even of TRAF2 KD MM cells, indicating that MEK inhibitor can inhibit activation of ERK1/2 and overcome IMiDs resistance in vivo. Finally, we confirmed that the number of patient samples with activated ERK pathway was significantly enriched at relapse while on lenalidomide maintenance therapy compared to diagnosis (BIOCARTA ERK pathway analysis 67% vs 39%, respectively, FDR&amp;lt;0.05), implicating ERK activity in clinical resistance to IMiDs. In summary, we have identified and validated TRAF2 as a CRBN-IKZF1/3 axis-independent regulator of BM microenvironment-mediated sensitivity to IMiDs. These studies not only identify a novel mechanism of IMiDs resistance in the tumor microenvironment, but also provide the preclinical rationale for combining inhibitors of MEK/ERK signaling with IMiDs to overcome IMiDs resistance and improve patient outcome. Disclosures Munshi: Legend: Consultancy; Amgen: Consultancy; AbbVie: Consultancy; Karyopharm: Consultancy; Takeda: Consultancy; Adaptive: Consultancy; Janssen: Consultancy; BMS: Consultancy; OncoPep: Consultancy, Current equity holder in private company, Membership on an entity's Board of Directors or advisory committees, Patents &amp; Royalties; C4: Current equity holder in private company. Richardson:Celgene/BMS, Oncopeptides, Takeda, Karyopharm: Research Funding. Anderson:Oncopep and C4 Therapeutics.: Other: Scientific Founder of Oncopep and C4 Therapeutics.; Millenium-Takeda: Membership on an entity's Board of Directors or advisory committees; Celgene: Membership on an entity's Board of Directors or advisory committees; Gilead: Membership on an entity's Board of Directors or advisory committees; Bristol Myers Squibb: Membership on an entity's Board of Directors or advisory committees; Sanofi-Aventis: Membership on an entity's Board of Directors or advisory committees; Janssen: Membership on an entity's Board of Directors or advisory committees.

Genetic and Transcript Changesin Cereblon in IMiD-Treated Myeloma Patients

Myeloma survival has been significantly improved by novel therapies over the past two decades. Immunomodulatory agents (IMiDs, Lenalidomide (LEN) and Pomalidomide (POM)) are a backbone of current treatment strategies. But myeloma (MM) remains incurable, because patients ultimately relapse. IMiD drug resistance mechanisms are multifactorial, and can be either dependent or independent of IMiDs binding to Cereblon (CRBN) (a component of an E3 ligase) in tumor and immune cells. A small series of relapsed patients demonstrated sub-clonal mutation rates of 12% in CRBN and 10% in other CRBN pathway genes (Kortum et al, Blood 2016), but the clinical implication of this observation is unknown. In contrast, baseline gene expression of CRBN was not associated with clinical outcome to POM-DEX therapy (Qian et al, Leukemia &amp; Lymphoma 2018). An integrated assessment of the burden of different mechanisms of CRBN function loss, the selective pressure for their survival, and their effects on response to CRBN-modulating agents, is lacking. For patients that progress on IMiD-based therapies, there is a need to develop drugs that will overcome their resistance. To appropriately target the right novel agents to the right patients, resistance mechanisms must be understood. A deeper understanding of the mechanistic basis for IMiD-specific resistance mechanisms is critical for differentiating new Cereblon modulating agents (eg CELMoDs) from the IMiDs. Here, we present the largest comprehensive analysis of the burden of CRBN mutation or transcript variants in relapsed refractory myeloma (RRMM) patients. We analysed WGS and RNASeq data from 298 MM samples from 268 patients across 4 clinical trials (CC-4047-MM-010 (N=226), CC-4047-MM-013 (N=17), CC-220-MM-001 (N=45) and CC-122-ST-001MM2 (N=10), for whom outcome data were available. All patients had been exposed to LEN-based therapy and a subset (69/268) were also exposed to POM-based therapy. The overall incidence of single nucleotide variants in CRBN was 17/298 (5.7%). The incidence of at least monoalleleic deletion at the CRBN gene locus was 21/298 (5.5%). CRBN has different transcript isoforms (Gandhi et al, BJHaem 2014). As high levels of isoform ENST00000424814.5, with deletion of exon 10, was previously correlated with poorer survival (Neri et al, Blood 2016), we assessed incidence of a high ratio (&gt;2) of exon 10-deleted CRBN transcript to full length CRBN transcript. 92 samples had sufficient purity (&gt;90% tumor cells) for this analysis. 13/92 samples (14.1%) had a high exon10-deleted transcript ratio. Overall, 43/268 (16.0%) patients had genetic or transcript variants in CRBN. In contrast, 27/514 (5.2%) newly diagnosed myeloma (NDMM) patients from the Myeloma Genome Project had genetic or transcript variants in CBRN; 2/514 (0.4%) had CRBN mutations, 11/514 (2.1%) had CRBN gene deletion and 14/514 (2.7%) had a high exon10-deleted transcript ratio. Thus, there was an increase in CRBN variants from NDMM to RRMM. In patients exposed to LEN but not POM (219/268), there were 5 CRBN mutations, 14 monoallelic CRBN deletions and 13/92 patients with high exon10-deleted transcript ratio. In 69/268 patients exposed to POM (baseline from CC-220-MM-001 (N=35), CC-122-ST-001MM2 (N=10), or follow up samples from CC-4047-MM-010 (N=24)), there were 12 CRBN mutations in 8 patients (11.6%) and 7 CRBN deletions (10.1%), approximately double the incidence seen in the whole cohort. 3 CRBN deletions were homozygous, which was not observed in non-POM-exposed individuals. Sample purity was insufficient to measure transcript ratios. In summary, 16.0% of RRMM patients that received LEN or POM have genetic or transcript variants in CRBN, a higher proportion than in NDMM. The impact of these aberrations on CRBN function, especially related to binding of CRBN-modulating drugs, remains to be ascertained. Analysis of the correlation between CRBN variation and response to therapy, clinical outcomes, and the incidence and effect of mutation or copy loss of CRBN interactors (E3 Ligase members and regulators, CRBN substrates) is underway and will be presented. Disclosures Gooding: Celgene: Research Funding. Ansari-Pour:Celgene Corporation: Consultancy. Towfic:Celgene Corporation: Employment, Equity Ownership. Ortiz:Celgene Corporation: Employment, Equity Ownership. Rozelle:Celgene Corporation: Other: Contractor for Celgene. Zadorozhny:Celgene Corporation: Other: Contractor for Celgene. Amatangelo:Celgene Corporation: Employment, Equity Ownership. Flynt:Celgene Corporation: Employment, Equity Ownership. Tsai:Celgene Corporation: Employment, Equity Ownership. Neri:Celgene, Janssen: Consultancy, Honoraria, Research Funding. Bahlis:AbbVie: Consultancy, Honoraria; Takeda: Consultancy, Honoraria; Amgen: Consultancy, Honoraria; Celgene: Consultancy, Honoraria; Janssen: Consultancy, Honoraria. Vyas:Novartis: Research Funding, Speakers Bureau; Pfizer: Speakers Bureau; Daiichi Sankyo: Speakers Bureau; Astellas: Speakers Bureau; Abbvie: Speakers Bureau; Celgene: Research Funding, Speakers Bureau; Forty Seven, Inc.: Research Funding. Thakurta:Celgene: Employment, Equity Ownership.

Cell-Free DNA Genotyping Analysis in Diffuse Large B-Cell Lymphoma; The Correlation between TP53 Gene Mutation and Cereblon Gene Mutation

Introduction: Recently cell-free DNA (cfDNA) genotyping analysis has been utilized as a non-invasive procedure for detecting tumor specific genes or clarifying gene mutations instead of tumor sample biopsies. In diffuse large B-cell lymphoma (DLBCL), cfDNA analysis has been proceeding and the relationships between somatic gene mutation and the disease status have been considered. We retrospectively analyzed somatic gene mutations in DLBCL and examined the correlation between mutant genes and clinical outcomes by using serum cfDNA samples. Patients and Methods: 50 patients newly diagnosed with DLBCL (including 4 patients mixed with follicular components) in our institute between March 2016 and March 2017 were enrolled in this study. All cases were sub-divided into germinal center B-cell (GCB) or non-germinal center B-cell (NGC) through immuno-staining, as CD10, bcl-6, and MUM-1 as Hans algorithm with biopsied tumor specimen. The stage at diagnosis and evaluation of treatment effects were assessed by PET-CT scan and bone marrow aspiration. All patients were treated by R-CHOP-like regimens with or without radiation. The serum samples from the patients were obtained before treatment and the cfDNA was extracted from the serum using a Maxwell RSC cfDNA Plasma kit. Using genomic DNA derived from cfDNA, multiplex polymerase chain reaction (PCR) was performed, and a sequence library was then constructed with an Ion Custom Amplicon panel. The panel for the sequence library was designed using an Ion AmpliSeq DesignerTM. 121 targeted genes were selected. The genomes were sequenced using the Ion ProtonTM System. We compared the validation of the sequence results dependent on the characteristics and prognoses of the patients. Connections between each gene mutation and clinical features were assessed using Fisher's exact test. Mann-Whitney U test was used for evaluating factors associated with the number of gene mutations. Survivals were estimated by the Kaplan-Meier method and differences were compared using the log-rank test. This protocol was approved by the institutional review board and the Genomic Review Board of the Japanese Foundation for Cancer Research. Results: Median age was 65.4 years old (range 33-83), 27 patients were male and 23 were female. The stage of Ⅲ or Ⅳ were 17 (34%), IPI high or high intermediate were 17 (34%), and 20 (40%) had LDH&gt;ULN. 27 patients (54%) were GCB and 23 (46%) were NGC. With a median follow up was 26.6 months (range 6-35). Factors affecting both shorter overall survival (OS) and progression-free survival (PFS) were LDH&gt;ULN (P=0.037 and P&lt;0.001), NGC (P=0.012 and P=0.002), IPI≧3 (P=0.023 and P&lt;0.001) in univariate analysis. According to the cfDNA gene mutation analysis, the mutations of HDAC4 (88%), KDM3B (86%), HDAC6 (86%), KDM1A (84%), CREBBP (80%), JMJD1C (78%), and EGR1 (62%) were frequently detected in all DLBCL patients. CREBBP, PCLO, and KDM5A tended to be relatively abundant in NGC (P=0.084, 0.087, and 0.085, respectively). No other mutations had deviation in either GCB or NGC and correlated with other prognostic factors. 7 patients had TP53 mutation, 6 were TP53 p.N178H and 1 was TP53 p.P58L. All cases with TP53 p.N178H mutation were accompanied by more than 27 types of other gene mutations. This was significantly abundant compared to patients without TP53 p.N178H (mean of 38 types vs 16 types, P&lt;0.001). Patients with 15 or more types of gene mutations tended toward poor PFS (2-year PFS of 89.5% vs 77.2%, P=0.092). Additionally, 7 patients had cereblon (CRBN) p.F101S mutation and 5 of 7 were concurrent with TP53 p.N178H mutation. Discussion and Conclusion: This study showed serum cfDNA could be used as an alternative resource for analysis by tumor specimen. Our results indicated that TP53 mutation occurred in latter period undergoing multistep genetic variation and it showed the tendency that multistep mutations were related to poor prognosis. Interestingly, relative rate in TP53 mutation accompanied by CRBN mutation was high. In some reports, it was described that deletion p53 caused drug resistance including immunomodulator which targets CRBN in multiple myeloma cases. Zijun Y et al mentioned CRBN expression correlated with favorable prognosis in DLBCL with wild type TP53. Further studies are warranted to confirm the relationships between TP53 and CRBN mutations and its prognosis of DLBCL. Disclosures Mishima: Chugai-Roche Pharmaceuticals Co.,Ltd.: Consultancy. Yokoyama:Chugai-Roche Pharmaceuticals Co.,Ltd.: Consultancy. Nishimura:Celgene K.K.: Honoraria; Chugai-Roche Pharmaceuticals Co.,Ltd.: Consultancy. Hatake:Takeda Pharmaceutical Co.,Ltd.: Honoraria; Celgene K.K.: Research Funding; Janssen Pharmaceutical K.K.: Research Funding. Terui:Bristol-Myers Squibb, Celgene, Janssen, Takeda, MSD, Eisai, Ono, and Chugai-Roche Pharmaceuticals Co.,Ltd.: Honoraria; Bristol-Myers Squibb K.K.: Research Funding.

CC-92480 Is a Novel Cereblon E3 Ligase Modulator with Enhanced Tumoricidal and Immunomodulatory Activity Against Sensitive and Resistant Multiple Myeloma Cells

Lenalidomide- and pomalidomide-based therapies are effective drugs in the treatment of patients with multiple myeloma (MM), however most patients with MM eventually relapse or become resistant. CC-92480, a novel cereblon (CRBN) E3 ligase modulator (CELMoD) with multiple activities including potent immunomodulation and single-agent antiproliferative effects, is being investigated in a phase 1 clinical trial (CC-92480-MM-001; NCT03374085) for patients with relapsed/refractory MM (RRMM). The present study investigates the preclinical data and mechanism of action of CC-92480 in MM models. CELMoD agents bound to CRBN confer differentiated substrate-degradation specificity on the CRL4CRBN E3 ubiquitin ligase. CRBN-modulator agents mediate destruction of Ikaros and Aiolos, transcription factors that contribute to myeloma cell survival. CC-92480 was found to produce rapid, deep, and sustained degradation of Ikaros and Aiolos, with superior antimyeloma activity. Accordingly, in a CRBN protein competitive binding assay, CC-92480 displaced a Cy-5-labeled CELMoD analog from CRBN with a 50% inhibitory concentration (IC50) value of 0.03 μM, whereas lenalidomide competed with an IC50 value of 1.27 μM in the same assay, demonstrating a higher binding affinity of CC-92480 for CRBN. Additionally, CC-92480 promoted the recruitment of Ikaros to the CRBN E3 ligase complex more effectively than pomalidomide in 2 orthogonal CRBN/Ikaros binding assays; it also triggered a more extensive cellular ubiquitination of Ikaros, and a faster, more efficient depletion of cellular Ikaros and Aiolos than pomalidomide. In various MM cell lines, including those with acquired resistance to lenalidomide or pomalidomide and low levels of CRBN, CC-92480 produced robust degradation of Ikaros and Aiolos followed by strong reduction of 2 additional and highly critical transcription factors, c-Myc and interferon regulatory factor 4, which are linked to the induction of apoptosis as measured by cleaved caspase-3. The tumoricidal activity of CC-92480 was shown to be CRBN dependent, since the effect was prevented by complete loss of CRBN or by the stabilization of Ikaros and Aiolos. CC-92480 displayed broad and potent antiproliferative activity across a panel of 20 MM cell lines that are either sensitive, have acquired resistance, or are refractory to lenalidomide or pomalidomide; the cell lines also contained diverse chromosomal translocations and oncogenic drivers typically found in MM patients. Approximately half of the MM cell lines evaluated were highly sensitive to CC-92480, with IC50 values for antiproliferative activity ranging from 0.04 to 5 nM; only 2 cell lines had IC50 values &gt; 100 nM. CC-92480 inhibits cell proliferation and induces apoptosis in MM cell lines that are not sensitive to lenalidomide or pomalidomide. This panel of cell lines includes both refractory cell lines and resistant cell lines generated through continuous exposure to lenalidomide and pomalidomide that acquired low levels of CRBN protein or mutations in the CRBN gene. CC-92480 also induced deep destruction of Ikaros and Aiolos in cultures of peripheral blood mononuclear cells (PBMCs), which led to the activation of T cells and increased production of the cytokines interleukin-2 and interferon gamma. These responses occurred at the range of CC-92480 concentrations that show potent tumoricidal effect against MM cells. The T cell activation and enhanced cytokine production by CC-92480 led to the potent and effective immune-mediated killing of MM cells in co-cultures with PBMCs. CC-92480 is a potent antiproliferative and proapoptotic novel CELMoD with enhanced autonomous cell-killing activity in MM cells that are either sensitive, resistant, or have acquired resistance to lenalidomide and pomalidomide. CC-92480 has a unique and rapid degradation profile stemming from the enhanced efficiency to drive the formation of a protein-protein interaction between Ikaros and Aiolos and CRBN, inducing cytotoxic effects in a CRL4CRBN-dependent fashion that leads ultimately to the induction of apoptosis, even in the context of low or mutated CRBN protein. Additionally, similar to lenalidomide, CC-92480 conserves immunomodulatory activity against MM cells. These data support the clinical investigation of CC-92480 in patients with RRMM. Disclosures Lopez-Girona: Celgene Corporation: Employment. Havens:Pfizer: Employment, Equity Ownership; Celgene: Equity Ownership. Lu:Celgene Corporation: Employment, Equity Ownership. Rychak:Celgene Corporation: Employment, Equity Ownership. Mendy:Celgene Corporation: Employment. Gaffney:Celgene: Employment. Surka:Celgene: Employment, Equity Ownership. Lu:Celgene Corporation: Employment, Equity Ownership. Matyskiela:Celgene corporation: Employment. Khambatta:Celgene: Employment. Wong:Celgene Corporation: Employment, Equity Ownership. Hansen:Celgene Corporation: Employment. Pierce:Celgene Corporation: Employment, Equity Ownership. Cathers:Global Blood Therapeutics (GBT): Employment; Celgene Corporation: Equity Ownership. Carmichael:Celgene plc: Employment, Equity Ownership.

Positive selection of cereblon modified function including its E3 ubiquitin ligase activity and binding efficiency with AMPK

Cereblon (CRBN) is a substrate receptor for an E3 ubiquitin ligase that directly binds to target proteins resulting in cellular activities, such as energy metabolism, membrane potential regulation, and transcription factor degradation. Genetic mutations in human CRBN lead to intellectual disabilities. In addition, it draws pathological attention because direct binding with immunomodulatory drugs can cure multiple myeloma (MM) and lymphocytic leukemia. To further explore the function of CRBN, we focused on its molecular evolution. Since CRBN interacts directly with its substrates and is widely conserved in vertebrates, evolutionary study to identify the selective pressure on CRBN that occur during CRBN-substrate interaction is an effective approach to search for a novel active site. Using mammalian CRBN sequences, dN/dS analysis was conducted to detect positive selection. By multiple sequence alignment we found that the residue at position 366 was under positive selection. This residue is present in the substrate-binding domain of CRBN. Most mammals harbor cysteine at position 366, whereas rodents and chiroptera have serine at this site. Subsequently, we constructed a C366S human CRBN to confirm the potential of positive selection. Auto-ubiquitination activity occurs in E3 ubiquitin ligases, including CRBN, and increased in C366S CRBN, which lead to the conclusion that E3 ubiquitin ligase activity may have changed over the course of mammalian evolution. Furthermore, binding with AMP-activated protein kinase was augmented when the substitution was present, which is supported by coevolution analysis. These results suggest that the molecular evolution of CRBN occurred through codon-based positive selection, providing a new approach to investigate CRBN function.

Single Cell Analysis of Acquired Pomalidomide-Resistance in Multiple Myeloma Cell Lines Reveals Distinct Subclonal Cereblon Mutations and Gene Expression Heterogeneity

Background: Multiple myeloma (MM) is a clonally heterogeneous cancer that recurrently relapses during its clinical course, demonstrating how interplay among subclones can lead to differentially drug-tolerant populations. The determination of onset and mechanisms of drug resistance is of clinical interest, and the improved understanding of this will drive innovative therapeutic approaches.The IMiD® agents lenalidomide (Len) and pomalidomide (Pom) bind to the E3-ubiquitin ligase receptor, Cereblon (CRBN), leading to ubiquitination and subsequent proteosomal degradation of key transcription factors Ikaros (IKZF1) and Aiolos (IKZF3). As a consequence of this degradation, direct antitumor and immunostimulatory effects are observed. Previous studies have revealed potential mechanisms of resistance to Len and Pom in both MM cell lines and clinical cohorts, including mutations, transcriptional downregulation or alternative splicing of CRBN, or mutations elsewhere in the E3 ligase pathway (CUL4A, DDB1), IKZF1/3 or IRF4. In resistant cell lines and patients, activation of proliferation, cell cycle, IGF-1, MAPK and FOXM1 pathways are reported, in addition to non-activation of interferon signature genes (ISGs).We hypothesize that rare MM cells/subclones with genetic, epigenetic or proteomic architecture permitting survival against Len or Pom in vitro may exist prior to acquired resistance, but may not be detectable by bulk genomic, transcriptional or proteomic analyses. Our goal is to define such populations using a combination of single cell technologies, initially focusing on acquired Pom-resistance mechanisms and quantifying genetic and transcriptional changes in Cereblon and its mechanistic targets, and to identify features of pre-existing resistant cell populations.Methods: To investigate the mechanism and timing of onset of acquired resistance, we utilized H929 and MM1S MM cell lines made resistant to Pom by serial dose increments over time, to a final Pom concentration of 10 μM (H929/PR and MM1S/PR respectively). Samples were collected at various timepoints for analysis by genomic, bulk and single cell (10X genomics) RNASeq techniques, and single cell protein quantification of Cereblon, Ikaros and Aiolos by IHC.Results: Bulk genomic sequencing revealed the H929/PR cell line had gained two CRBN mutations, a frameshift deletion of the glutarimide-binding region present in 10.9% alleles, and a point mutation in the non-glutarimide binding region present in 71% alleles. Concurrent single-cell protein quantification showed a near complete loss of Cereblon expression in the majority of cells, with little change in Ikaros or Aiolos staining. Bulk RNASeq of the H929/PR cell line showed a significant enrichment of cell cycle, E2F and MYC target gene sets. Using single cell transcriptomics, we found high expression of the signature genes of the Pom-resistant population to co-localise with an independently derived FOXM1 target gene set to a cluster of sensitive single cells defined by a gene expression profile identifying cells at the G2M checkpoint.Sanger sequencing of CRBN in the MM1S/PR cell line showed a de novo 12 bp deletion in intron 5 which is required for spliceosome assembly, resulting in deletion of exon 6 of the mature mRNA transcript. Interestingly, CRBN exon 6 is required for interaction with DDB1, suggesting loss of a functional E3-ligase. Analysis by single cell IHC showed substrate levels similar to sensitive parental cell lines. As in the H929/PR cell line, bulk RNASeq again showed enrichment of E2F and MYC targets, and independently derived Pom-resistant and FOXM1 target gene sets co-localised to the same cluster of MM1S drug-naïve single cells, identified by a G2M checkpoint signature.Conclusions: A range of CRBN mutations, Cereblon protein loss and enrichment of cell cycle, FOXM1 target and G2M checkpoint-related signatures was found at the onset of Pom resistance. This association with altered cell cycle progression dynamics may lead to, correlate with or result from drug survival. Tracking mutation- and non mutation-associated transcription factor signatures through sequential time points from first drug exposure to full resistance may reveal mechanisms by which functional CRBN loss causes drug resistance. DisclosuresGooding:Celgene: Research Funding. Bjorklund:Celgene Corporation: Employment, Equity Ownership. Amatangelo:Celgene Corporation: Employment, Equity Ownership. Ren:Celgene Corporation: Employment, Equity Ownership. Marella:Celgene: Employment. Couto:Celgene: Employment. Towfic:Celgene Corporation: Employment, Equity Ownership. Oppermann:Bayer Pharma: Research Funding. Ramasamy:Celgene: Honoraria, Membership on an entity's Board of Directors or advisory committees, Research Funding. Pierceall:Celgene Corporation: Employment, Equity Ownership. Thakurta:Celgene Corporation: Employment, Equity Ownership.

CRL4 antagonizes SCFFbxo7-mediated turnover of cereblon and BK channel to regulate learning and memory.

Intellectual disability (ID), one of the most common human developmental disorders, can be caused by genetic mutations in Cullin 4B (Cul4B) and cereblon (CRBN). CRBN is a substrate receptor for the Cul4A/B-DDB1 ubiquitin ligase (CRL4) and can target voltage- and calcium-activated BK channel for ER retention. Here we report that ID-associated CRL4CRBN mutations abolish the interaction of the BK channel with CRL4, and redirect the BK channel to the SCFFbxo7 ubiquitin ligase for proteasomal degradation. Glioma cell lines harbouring CRBN mutations record density-dependent decrease of BK currents, which can be restored by blocking Cullin ubiquitin ligase activity. Importantly, mice with neuron-specific deletion of DDB1 or CRBN express reduced BK protein levels in the brain, and exhibit similar impairment in learning and memory, a deficit that can be partially rescued by activating the BK channel. Our results reveal a competitive targeting of the BK channel by two ubiquitin ligases to achieve exquisite control of its stability, and support changes in neuronal excitability as a common pathogenic mechanism underlying CRL4CRBN–associated ID.

Cereblon Splicing of Exon 10 Mediates IMiDs Resistance in Multiple Myeloma: Clinical Validation in the CoMMpass Trial

Background: IMiDs neomorphe the substrates binding of CRL4_DDB1_ROC1 E3 ligase through their interaction with the adaptor protein Cereblon (CRBN) triggering the proteasomal degradation of IKZF1/IKZF3. This binding results from hydrogen bonds forming between the carbonyl residues of the IMiDs' glutarimide moiety and several amino acids within a hydrophobic pocket on the surface of CRBN. This pocket is formed by three tryptophan residues (W380, W386 and W400) mapping to CRBN c-terminus exons 10-11. Others and us, have previously shown that in vitro silencing or knock-out of CRBN is clearly associated with resistance to IMiDs, however CRBN mutations mapping to its thalidomide binding domain are rarely seen. We have previously identified through paired sequencing of the transcriptome of primary myeloma cells (pre- and post IMiDs) the expression of a CRBN mRNA splice variant (CRBN-005 or ENST00000424814) lacking exon 10. We also demonstrated that this isoform is translated into a stable protein that retains its binding to DDB1/Cul4a ligase but was no longer capable of interacting with IMiDs. Functionally, in HEK293 we have also shown that stable expression of CRBN-005 at higher levels relative to the full-length variant (CRBN-004 or ENST00000231948) abrogated IMiDs-induced degradation of Ikaros. In the current work, we validated in myeloma cell lines in vitro that the splicing of CRBN exon 10 was sufficient to reverse the cytotoxicity of lenalidomide. We also interrogated the longitudinal CoMMpass trial for the expression of CRBN-005 transcripts and its impact on survival.Methods and Results: We initially confirmed that lentiviral CRISPR mediated stable knock-out of CRBN using gRNA targeting exon 2 in the MM1S and OPM2 lenalidomide sensitive cell lines, resulted in complete resistance to IMiDs. In order to examine the role of CRBN exon 10 splicing in IMiDs resistance, we next cloned spliced CRBN-005 isoform (Δ10-CRBN) or full length CRBN (WT-CRBN) into lentiviral plasmid pLX304 and stably transduced JJN3 and KMS28BM myeloma cells. The Δ10-CRBN plasmid expressed a ~ 45 kDa proteins detectable by western blotting with CRBN65 antibody (Celgene, binds aa 65-76). Stable expression of Δ10-CRBN in JJN3 and KMS28BM cells significantly reduced Aiolos and Ikaros degradation in response to lenalidomide treatment and partially reversed (~ 30%) KMS28BM cell death (JJN3 are resistant to lenalidomide despite IKZF1 degradation). Consistent with our previous studies in HEK293 cells, high expression of Δ10-CRBN relative to endogenous WT-CRBN was required for the reversal of lenalidomide effects. Furthermore, we used the CRIPSR technology to induce splicing of endogenous CRBN exon 10 using two lentiviral gRNAs targeting intron9-exon10 (TTTATCCTTATGTGGGCCGA) and exon10-intron10 junctions (CAGAACACAGCTGGTTTCCT) in lenalidomide-sensitive MM1S and OPM2 cells stably engineered to express Cas9. Single cell clones expressing the exon 10 spliced CRBN were identified by cDNA cloning and sanger sequencing. The viability of the clones in response to lenalidomide as well as Ikaors degradation were nearly fully reversed in comparison to Cas9 only expressing MM1S and OPM2 cells. Lastly, in order to clinically validate the role of Δ10-CRBN in IMiDs resistance we interrogated the transcriptome of patients enrolled in the CoMMpass trial where in addition to genomic profiling (shallow genome long-insert sequencing, WES, RNAseq) clinical data and outcomes are captured. In the CoMMpass IA8, clinical and molecular data is available on 549 subjects, of which 486 were identified as ever receiving IMiDs-based regimen. We analyzed the survival of these patients based on the ratio of transcript levels (TPM) of spliced CRBN (ENST00000424814) to that of full-length CRBN. Using a cut-off ratio of 0.75, the survival of patients treated with IMiDs based regimen and high levels of spliced CRBN was significantly worse (Figure). Importantly, in 20 patients were RNA was available pre- and post IMiDs, we show that the levels of the CRBN spliced variants were significantly increased at the time of disease progression (Figure boxplot).Conclusions: In the current work, we have confirmed the role CRBN exon 10 splicing in IMiDs resistance using functional in vitro validation studies and demonstrated its predictive effects on IMiDs activity in the CoMMpass clinical dataset. [Display omitted] DisclosuresNeri:Celgene and Jannsen: Consultancy, Honoraria. Lonial:Celgene: Consultancy; Novartis: Consultancy; Janssen: Consultancy; Janssen: Consultancy; Celgene: Consultancy; Millenium: Consultancy; BMS: Consultancy; Novartis: Consultancy; BMS: Consultancy; Merck: Consultancy; Onyx: Consultancy; Onyx: Consultancy. Bahlis:Janssen: Consultancy, Honoraria, Other: Travel Expenses, Research Funding, Speakers Bureau; Onyx: Consultancy, Honoraria; Celgene: Consultancy, Honoraria, Other: Travel Expenses, Research Funding, Speakers Bureau; BMS: Honoraria; Amgen: Consultancy, Honoraria.

Targeted Sequencing of Relapsed/Refractory Myeloma Patients Identifies an Enrichment of Mutations in Cereblon and MAPK Pathways

Introduction: We employed a customized Multiple Myeloma (MM) specific Mutation-Panel (M3 P) to screen a homogenous cohort of refractory MM (rMM) patients in a timely and cost-effective manner. rMM was defined as progressive disease (PD) during therapy or within 60 days after discontinuation of therapy. The M3 P provides a practical alternative to whole genome/exome sequencing approaches and includes 88 genes selected for being either actionable targets, potentially related to drug response or part of known key pathways in MM biology.Patients and Methods: Tumor and germline samples of 50 rMM patients were screened using M3 P. Patients received a median of five lines of treatment at the time of tumor sampling (range 2-15 lines). All patients received at least one immunomodulatory agent (IMiD) and proteasome inhibitor (PI), and 88%, 76% and 66% were refractory to either an IMiD, PI or both. All patients had received lenalidomide and bortezomib, 48% and 34% were additionally exposed to pomalidomide and thalidomide and 18% to carfilzomib at any time prior to sampling. The majority of patients had a progressive and refractory disease immediately prior to sampling (82% and 78%), with 43% of them being IMiD-refractory and 46% being PI-refractory in the most recent line of therapy. Cytogenetic data at time of sampling were available from 78% of patients. Adverse cytogenetics were detectable in 82% of patients with gain 1q21 > 2 copies (62%), deletion 17p (33%), t(4;14) (13%) and t(14;16) (8%) being the most common.Results: An average sequencing depth of 750x was obtained across the samples. Our screening revealed an increased prevalence of mutations in the MAPK pathway (72%), including 34% of KRAS, 26% of NRAS, 18% of BRAF (with one patient carrying two BRAF mutations and 8% in actionable p.V600E). Additionally, two mutations (4%) were found in RASA2, a RAS inhibitor. Other potentially actionable mutations were seen in p.R132H IDH1 and p.R248C FGFR3 (2% each).Most prominently, the CRBN pathway was found mutated in 22% of cases, including CRBN (12%, one case with concomitant CUL4B mutations), CUL4B (4%), IRF4 (4%) and IKZF1 (2%). In CRBN we found four cases with mutations leading to a truncated protein (frameshift, nonsense and splicing) and two cases with missense mutations located within the thalidomide-binding domain, suggesting a causal effect on IMiD resistance. All CRBN mutated patients and 91% of the CRBN pathway mutated patients were at least once unresponsive to IMiD based treatment. In one patient with IRF4 mutation sensitivity to IMiDs remained unknown.A majority of patients were also resistant to PI treatment (76%), however mutations in proteasome subunits (PSMD1 and PSMB8) and XBP1 wererare (4%), but only a limited number of this gene family were represented in our panel.Other recurrently mutated genes were TP53 (26%), FAM46C (12%), ATM (10%) and TRAF3 (8%). Notably, DIS3 mutations were identified in only 6% of cases. As previously reported, TP53 mutations were associated with deletion 17p (8/13 cases, 62%). A correlation between the absolute number of mutations and previous lines of treatment was not observed (r=0.05, p=0.73).Conclusion: Targeted sequencing on a homogenous cohort of heavy pretreated rMM patients gives key insights in the landscape of the rMM genome, uncovering an increasing frequency of MAPK, TP53 and CRBN mutations. Importantly, this is the first study showing recurrent mutations in CRBN in patients unresponsive to IMiD treatment, supporting a potential association with resistance to IMiD based therapies. DisclosuresMai:Onyx: Other: Travel Grant; Janssen-Cilag: Other: Travel Grant; Celgene: Other: Travel Grant; Mundipharma: Other: Travel Grant. Merz:Janssen: Other: Travel grants; Celgene: Other: Travel grants. Hillengass:Takeda: Honoraria, Other: Travel support; Novartis: Membership on an entity's Board of Directors or advisory committees, Research Funding; Sanofi: Research Funding; Janssen-Cilag: Honoraria, Other: Travel support; Celgene: Honoraria, Other: Travel support. Goldschmidt:Celgene: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Research Funding, Speakers Bureau; Janssen-Cilag: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Research Funding, Speakers Bureau; Millennium: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Speakers Bureau; Onyx: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Speakers Bureau; Novartis: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Research Funding, Speakers Bureau; Chugai: Research Funding, Speakers Bureau. Stewart:Oncospire Genomics: Research Funding.

Absence Of Mutation In Cereblon (CRBN) and DNA Damage Binding Protein 1 (DDB1) Genes In Myeloma Cells and Patients and Its Clinical Significance

BackgroundCRBN, a target of thalidomide and IMiDs® immunomodulatory agents lenalidomide (LEN) and pomalidomide (POM), is a component of the E3 ubiquitin cullin 4 ring ligase (CRL4) complex that also includes DDB1, Roc1, and Cul4. Two CRBN mutations have been reported in multiple myeloma (MM) patients: truncating mutation (Q99) and point mutation (R283K). One copy of the CRBN gene was shown to be deleted in the MM1S and MM1S.R cell lines. No DDB1 mutation has been described previously. ResultsWe investigated the incidence of CRBN and DDB1 mutations by next-generation sequencing in 20 MM cell lines and MM subjects. Of 90 MM patients, 24 were newly diagnosed and 66 were relapsed and refractory of which 36 patients were LEN resistant. Out of the cell lines tested, 1 heterozygous CRBN mutation (D249Y) was found in the LEN-resistant ANBL6R cells, which is located in the putative DDB1 binding domain, and 2 single silent mutations were identified in the KMS-12-BM (rs17027638) and OPM-2 cells. One DDB1 heterozygous mutation (E303D) was identified in ANBL6 cells. In the cohort of patients assessed, no CRBN mutation was detected; however, 5 single nucleotide variations (SNV) were identified. Three of the 5 SNVs were at position 735 (Y245Y) and 1 each at position 219 (H73H) and 939 (C313C), respectively. The first 2 SNVs (rs17027638 and rs1045309) are described but not the last. We found a single SNV (P51P; rs2230356) in DDB1 gene the patient samples. ConclusionMutations within the coding sequences of CRBN and DDB1 are rare in MM patients and cell lines. Most intrinsically LEN-resistant cells and cell lines made resistant to LEN or POM do not have CRBN or DDB1 mutations, suggesting the potential role of other sources, such as genetic or epigenetic pathways in developing resistance to IMiD drug–based therapy. Disclosures:Thakurta:Celgene: Employment, Equity Ownership. Gandhi:Celgene: Employment, Equity Ownership. Waldman:Celgene: Employment, Equity Ownership. Bjorklund:Celgene: Employment, Equity Ownership. Lentzsch:Celgene: Research Funding. Schey:Celgene: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Speakers Bureau; NAPP: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Speakers Bureau; BMS: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Speakers Bureau. Orlowski:Bristol-Myers Squibb: Honoraria, Membership on an entity's Board of Directors or advisory committees, Research Funding; Celgene: Honoraria, Membership on an entity's Board of Directors or advisory committees, Research Funding; Millennium: Honoraria, Membership on an entity's Board of Directors or advisory committees, Research Funding; Onyx: Honoraria, Membership on an entity's Board of Directors or advisory committees, Research Funding; Resverlogix: Research Funding; Array: Honoraria, Membership on an entity's Board of Directors or advisory committees; Genentech: Honoraria, Membership on an entity's Board of Directors or advisory committees; Merck: Membership on an entity's Board of Directors or advisory committees. Madan:Covance Genomics Lab: Employment. Ning:Celgene: Employment, Equity Ownership. Mendy:Celgene: Employment, Equity Ownership. Lopez-Girona:Celgene: Employment, Equity Ownership. Schafer:Celgene: Employment, Equity Ownership. Avet-Loiseau:Celgene: Research Funding. Chopra:Celgene: Employment, Equity Ownership.

Cereblon (CRBN) Splicing Could Influence Response To IMiDs : A New PCR Strategy to Easily Detect and Semi-Quantify Loss Of The IMiDs Binding Domain

Cereblon (CRBN) was recently identified as a protein binding immunomodulatory drugs (IMiDs) (Ito et al., 2010, Lopez-Girona et al., 2011) essential for the activity of thalidomide, lenalidomide and pomalidomide in patients suffering from multiple myeloma (MM) (Zhu et al., 2011 & 2012). It is known that some patients develop resistance to these drugs, raising the question of a possible role of CRBN alterations (mutations, deletions, loss of transcription...) in the development of such treatment escapes (Broyl et al., 2012, Heintel et al, 2013).Ito et al (2010) showed that loss of the C-ter fragment of CRBN or missense mutations (Y384A and W386A) in the thalidomide binding domain (TBD) indeed impair the efficacy of this drug.We investigated whether the loss of CRBN expression, particularly of full length isoforms including exons 10 and 11 encoding TBD, or missense mutations could be detected by polymerase chain reaction (PCR) followed by fragment-length analysis or Sanger bidirectional sequencing. This method was applied to a cohort of 19 patients issued from a consecutive cohort of 45 elderly patients treated with lenalidomide and dexamethasone for relapsed or refractory MM (Touzeau et al., 2012).RNA was extracted from plasma cells purified by CD138 immunomagnetic sorting (STEM CELLS® beads) at the time of diagnosis. Sanger sequencing performed on RT-PCR products revealed no missense mutations but disclosed a high frequency of alternative splicing of CRBN in samples from MM patients (Lodé et al 2013). We thus developed a new PCR strategy to detect and semi-quantify alternative spliced isoforms of CRBN involving or not a loss of CRBN specific domains, focusing on exons 10 and 11. Two PCR were performed with custom-made primers: PCR-1 was designed to encompass the whole coding sequence of CRBN and PCR-2 was specifically designed to cover TBD. Fragment-length analysis of fluorescent PCR-2 products was obtained by capillary electrophoresis on an Applied Biosystems 3130xl Genetic Analyser (Applied Biosystems, Foster City, CA) allowing for precise sizing and semi-quantification by assessing the height of peaks.This PCR strategy was highly efficient to detect both unspliced CRBN transcripts (PCR-1 and PCR-2 fragments detected at 1562 nucleotides (nt) and 568nt, respectively) and CRBN alternatively spliced variants. The sizing strategy chosen allowed to identify exon skipping. For instance, PCR-2 fragments without exon 10 were visualized as peaks of 234nt, 319nt and 436nt depending on the presence or not of exons 7, 8 and 9.Alternative CRBN splicing in TBD was seen in nearly all patients of this cohort. Examples of representative splicing patterns are shown in figure 1. Semi-quantification of CRBN spliced transcripts showed that 58% of patients had lost more than 50% of CRBN full-length isoform and that 37% had lost more than 50% of exon10. Of note, two patients with a very short duration of response to lenalidomide and dexamethasone (16 days and 58 days respectively) had lost more than 95% of full-length CRBN and more than 90% of exon 10 (see MM6179 in figure1) in initial samples in spite of proper detection of an actin fragment of 858nt. [Display omitted] The fragment-length PCR analysis presented here demonstrates that CRBN splicing profiles in MM patients are very heterogeneous. A correlation with response to treatment was not established in this rather small cohort of patients, but this could be due to the fact that diagnosis samples were collected too early in relation to the time of initiating lenalidomide treatment. Indeed, CRBN splicing could be therapy-induced.A prospective study is needed to determine whether the semi-quantification of CRBN alternatively spliced variants would indeed correlate with, or even predict, clinical response to IMiDs. Moreover, further mutation studies are needed to elucidate the heterogeneity of splicing profiles which could reflect the presence of subclonal mutations in genes encoding the splicing machinery. Disclosures:Moreau:CELGENE: Honoraria, Speakers Bureau; JANSSEN: Honoraria, Speakers Bureau.

RNA-Sequencing Of Paired Pre-Treatment and Relapse Samples Reveals Differentially Expressed Genes Associated With Lenalidomide Resistance In Multiple Myeloma

BackgroundImmunomodulatory (IMiDs) drugs' cytotoxicity in MM cells is mediated through their binding to cereblon (CRBN) an adaptor protein of the Cul4a-DDB1-ROC1 ubiquitin E3 ligase complex. Loss of CRBN is clearly associated with resistance to IMiDs (Zhu et al. Blood. 2011) however this does not appear to be the sole mechanism through which MM cells may acquire resistance to this class of drugs. In addition, the acquisition of CRBN mutations within the Thalidomide binding domain (exons 10-11) have not been well studied. Similarly and while splice variants of CRBN were recently reported (Ghandi et al. Blood. 2012), no correlations has been made between the presence of these isoforms and IMiDs resistance in primary samples. Methods and ResultsIn this study, we first validated CRBN as biomarker of clinical response to lenalidomide. At the mRNA level, using qRT-PCR (n=26, amplicons with 2 sets of primers overlapping exons 8-9 and exons 10-11) low CRBN in CD138 sorted bone plasma cells was significantly associated with shorter PFS (p=0.008) and lack of response to lenalidomide. We next compared CRBN mRNA (qRT-PCR) expression in paired samples (n=17 patients - 34 pairs) collected immediately pre-treatment and at the time of disease progression post-lenalidomide. In 10/17 (58.8%), a significant reduction (2-ΔΔCT < 0.8) in the CRBN amplicon levels was observed between the paired pre- and post-treatment samples. These data suggest that in nearly half of the patients, CRBN-independent mechanisms may be mediating resistance to IMiDs. In order to elucidate these CRBN-independent mechanisms of resistance to lenalidomide and identify potential targets that may overcome it, RNA-seq analysis was performed in 12 paired patients samples obtained sequentially from the same patient prior to lenalidomide treatment initiation and after development of resistance. Transcriptome sequence data was generated by RNA-seq performed for each sample on Ion Torrent Proton sequencer with a minimum of 70 million reads per sample. Poly(A) is captured with poly(T) magnetic beads, fragmented and copied to cDNA libraries with reverse transcriptase and primers. Filtered Fastq files are processed with TopHat-Fusion alignment against hg19 as reference genome. Cufflinks and Cuffdiff algorithms were used to detect differentially expressed transcripts and spliced isoforms. A total of 830 genes were identified as differentially expressed (p value and FDR <0.05) between the pre- and post-lenalidomide paired samples. Selected differentially expressed genes were also measured by RT-PCR analysis to confirm the validity of the RNA-seq analysis. In order to gain insight into the cellular and molecular functions of this identified gene set, we compared it to the expression of 395 gene sets curated in the Molecular Signatures Database (MSigDB), using the Gene set enrichment analysis (GSEA) algorithm. Among the most enriched gene sets in this analysis were KRAS.KIDNEY_UP.V1_UP; KRAS.LUNG_UP.V1_UP; KRAS.600.LUNG.BREAST_UP.V1_UP; RAF_UP.V1_DN; MEK_UP.V1_DN; and STK33_DN suggesting a role for the RAS-RAF-MAPK pathway in the acquired resistance to IMiDs. Other gene sets of interest included AKT_UP_MTOR_DN.V1_DN, E2F3_UP.V1_UP; EIF4E_UP and RPS14_DN.V1_DN; consistent with a role for the translational machinery activity (mTOR-4EBP1-eIF4E pathway) in IMiDs resistance. Of interest variant splice isoforms of CRBN were visualized using the Integrative Genomics Viewer (IGV) tool including isoforms lacking exon 10, which contains a portion of the IMiD-binding domain. However these CRBN splice variants are unlikely to be implicated in resistance to IMiDs since they were not enriched in the relapsed paired samples. ConclusionsStudy of the transcriptome of paired pre- and post-IMIDs in myeloma primary cells confirms that acquired resistance to this class of drugs is associated with the direct loss of CRBN as well as through the modulation of other CRBN-independent pathways. Disclosures:No relevant conflicts of interest to declare.

Cereblon expression in multiple myeloma: not ready for prime time – Response to Lodé et al

We have read with interest the comments provided by Lodé et al (2013) regarding our findings of a correlation of cereblon (CRBN) expression and response in multiple myeloma (MM) patients treated with lenalidomide and dexamethasone (Heintel et al, 2013). We agree that the prime time has not yet arrived for the routine use of CRBN expression as treatment guidance. Lodé et al (2013) raise three important issues that should be evaluated before drawing final conclusions and we wish to add the following: In relation to the first point raised, we suggest that CRBN should be analysed in both the CD138+ and CD138− fraction of MM bone marrow samples in future studies. It is well recognized that at least some of the effect of immunomodulatory drugs (IMiDs) is mediated through the microenvironment by induction of proliferation of T-cells and other effector cells, of expression of co-stimulatory molecules and modification of cytokine signalling (Görgün et al, 2010), resulting in an anti-myeloma immune response. Lopez-Girona et al (2012) showed that CRBN not only mediates the anti-proliferative effects of lenalidomide and pomalidomide in myeloma cells, but also lenalidomide- and pomalidomide -induced cytokine production in T-cells. In our paper we provided data showing that, although median CRBN expression is lower in the CD138− than CD138+ fraction, expression levels of CRBN vary in the MM bone marrow environment and can be considerably higher than in normal bone marrow (Heintel et al, 2013). Thus we speculate that variable levels of CRBN in immune cells in the bone marrow might have contributed to the association with response in our study. We fully agree with the second point raised, that CRBN physiology needs to be studied in detail and the function of the different isoforms elucidated. Lenalidomide treatment was shown to induce 2-fold expression changes in approximately 1200 genes, and the vast majority of these changes seem to be mediated via CRBN (Zhu et al, 2011). Lodé et al (2013) provide important data showing the frequent occurrence of alternative transcripts, accounting in some patients for >50% of total CRBN in some patients. It has been reported that CRBN downregulation mediates resistance to IMiD-based treatment (Zhu et al, 2011; Heintel et al, 2013). As preferential expression of transcripts lacking a functional IMiD binding domain would be anticipated to have a similar effect, we propose studying the expression of alternative transcripts of CRBN with regard to primary resistance and acquisition of resistance to IMiD based treatment. Gandhi et al (2012) reported on an antibody (CRBN65) capable of discriminating the different isoforms by Western blot, and such a tool should be helpful in these studies. In contrast, truncating mutations in CRBN seem to be a rare mechanism of acquisition of resistance (Egan et al, 2013). Once the correlation between CRBN expression and clinical response can be corroborated, antibodies binding to CRBN or its isoforms might provide the basis for developing a reliable routine test for CRBN expression. Developing a flow cytometric technique for detection might provide further insight into intra-tumour heterogeneity of CRBN expression. It should be noted that three other groups have already reported a correlation between CRBN expression and outcome under IMiD therapy, one using tissue microarrays and fluorescence immunohistochemistry to quantify CRBN expression (Klimowicz et al, 2012), the two other groups using gene expression profiling (Broyl et al, 2013; Schuster et al, 2012). The in-silico analysis performed by Lodé et al (2013) provides important insights with regard to CRBN expression in the different molecular MM subgroups. While median CRBN expression is higher in the hyperdiploid subgroup, there seems to be great variability of expression within all subgroups. In our preliminary analysis we could not find a correlation between CRBN expression and fluorescent in situ hybridization-defined high-risk or standard risk disease. We did not study chromosome 3 trisomy in our series of patients but agree that cytogenetic data should be evaluated in relation to CRBN expression. We think that the outcome defined by response is less biased by a possible overweight of hyperdiploid disease, as the main impact of the molecular signature is on survival parameters, not initial response to therapy. A very rapid and deep response to therapy, with regard to serum free-light chain levels, might even identify a subgroup of patients with inferior survival. It should be noted that the groups who have reported a correlation between CRBN expression and outcome with IMiD-based treatment defined by survival have included a bortezomib-treated control group, where this association was lacking (Broyl et al, 2013; Klimowicz et al, 2012), thus making a bias related to a possible prognostic significance of CRBN expression itself less likely.

English

&nbsp; Three-dimensional (3D) protein structures provide helpful insights into the molecularassociation of a gene, its purpose also allow efficient drug designing experiments, such as the structure-based design of specific inhibitors. Recently, it has been shown that protein (cereblon) is involved in various tissues and brain and is revealed to be related with mental retardation. After this first report of cereblon (CRBN) involvement, it was necessary to further study this protein. Therefore a 3D structure of cereblon was developed using comparative modeling approach. By comparing the templates-target sequence, a model was created using&nbsp;MODELLER, a program for homology modeling. The accuracy of the predicted structure was checked&nbsp;using Ramachandran plot which showed that the residue falling in the favoured region was 88.4%. Thepredicted cereblon model can be used to understand the pathogenesis of mutations in cereblon that&nbsp;causes&nbsp;adenosine-5&#39;-triphosphate&nbsp;(ATP)-dependent degradation of proteins in memory and learning. &nbsp; Key words:&nbsp;CRBN, 3D structure, 1M4Y, MODELLER, comparative homology modeling. &nbsp

Functional modulation of AMP-activated protein kinase by cereblon

Mutations in cereblon (CRBN), a substrate binding component of the E3 ubiquitin ligase complex, cause a form of mental retardation in humans. However, the cellular proteins that interact with CRBN remain largely unknown. Here, we report that CRBN directly interacts with the α1 subunit of AMP-activated protein kinase (AMPK α1) and inhibits the activation of AMPK activation. The ectopic expression of CRBN reduces phosphorylation of AMPK α1 and, thus, inhibits the enzyme in a nutrient-independent manner. Moreover, AMPK α1 can be potently activated by suppressing endogenous CRBN using CRBN-specific small hairpin RNAs. Thus, CRBN may act as a negative modulator of the AMPK signaling pathway in vivo.