Cereblon mRNA Research Articles

The Relationship Between the Expression of CRBN in Peripheral Blood and the Severity and Prognosis of Adult Sepsis.

To investigate the correlation between the expression of cereblon (CRBN) protein in peripheral blood and the severity and prognosis of sepsis. A total of 130 patients with sepsis admitted to our hospital were selected as the observation subjects (sepsis group). The patients were divided into mild group, moderate group and severe group according to their conditions. The patients were divided into survival group and death group according to their living conditions within 28 days after admission. 130 health individuals were selected as the control group. The levels of CRBN mRNA, CRP and PCT in peripheral blood were detected. The levels of serum CRBN mRNA, CRP, and PCT in patients with sepsis were higher than those in the control group (P<0.05); As the condition worsens, the levels of CRBN mRNA, CRP, and PCT gradually increase, and there are statistically significant differences among patients with mild, moderate, and severe sepsis; Correlation analysis showed that the expression of CRBN mRNA in sepsis patients was positively correlated with CRP, PCT levels, APACHE II score and SOFA score (P<0.05); the 28-day cumulative survival rate of patients with high CRBN mRNA expression was significantly lower than that of patients with low CRBN mRNA expression (P<0.05); compared with the survival group, the levels of serum CRBN mRNA, CRP and PCT in the death group were significantly higher (P<0.05); the AUC of death in sepsis patients diagnosed by CRBN mRNA, CRP and PCT was 0.961, the combined diagnostic efficacy was higher than that of single detection (P<0.05). The expression level of CRBN in the peripheral blood of patients with sepsis is increased, which is related to the severity and prognosis of the patients. The combination of CRP and PCT has certain diagnostic value for the death of sepsis patients.

Newly Diagnosed, Untreated, Multiple Myeloma (MM) Patient Samples Already Harbor Cereblon (CRBN) Exon 10 Deletions Associated with Drug Resistance

Background: Acquisition of drug resistance, particularly immunomodulatory drugs (IMiDs) in MM is one of the most important challenges in patient treatment today. Early on in the disease, the plasma cells in the MM clone are often sensitive to chemotherapy. However, over time, after exposure to chemotherapy, the cells acquire increasing genomic complexity and mutations leading to resistance to therapy and ultimately patient death. Cereblon (CRBN) is a binding protein, which is required for the action of the widely used IMiDs such as lenalidomide and pomolidomide. CRBN is also essential to the newer CRBN E3 ligase modulator drugs and proteolysis targeting chimeras. We recently described an algorithm based on digital gene expression profiling of purified CD138(+) MM cells from patients at different clinical stages that we term the "MM-IP-7", which correlated with clinical drug resistance, poor survival, and disease progression following combination treatment containing IMIDs and/or PIs (XY Zhu et al, eHaem 2022). Given the recent description of genetic changes in the CRBN gene that are associated with IMiD resistance particularly the exon 10-spliced CRBN transcripts that increase in incidence in parallel with IMiD-refractory states (S. Gooding et al, Blood 2021), we sought to build an integrated, single-platform test to measure both gene expression levels and genetic deletions. Methods: We designed a novel CRBN splicing isoform probe with homology to both exon 9 and exon 11. This probe will thus capture CRBN mRNA sequences in which exon 10 is deleted and portions of exons 9 and 11 and juxtaposed. We also included probes to CRBN overall (Exons 5 and 6). These probes were combined with the MM-IP-7 probes to create a dual gene expression and genetic assay that was used to analyze 30 cases of newly diagnosed MM, 30 cases of end stage MM, and 3 MM cell lines (MM1.S, OPM2, XG1). To define increased exon 10 deleted allele frequency, we calculated the ratio of exon 10 deletion/total exon 10. Cases with apparent exon 10 deletion by expression profiling, were further evaluated with RT-PCR. Results: 40% MM samples in the end stage group versus 23% of samples in the newly diagnosed group were identified with more than 20% exon 10 deleted mRNA as compared to total CRBN mRNA levels. Three cases were shown to have more than 45% exon 10 deleted mRNA, including two newly diagnosed cases and one end stage case. RT-PCR confirmed exon 10 deletion in a newly diagnosed patient sample with sufficient remaining RNA that was tested (cloning and sequencing for confirmation are underway). Cell line results showed very low exon 10 splicing variant, which correlated with our mRNAseq data for these lines. Conclusions: Our findings demonstrate that inclusion of probes bridging CRBN exon 10 deletion with homology to exons 9 and 11, is feasible approach to use on the gene expression platform, which allows for combined evaluation of expression and genetic changes. CRBN exon 10 deletion is a known treatment resistance feature in MM, which may already be present at diagnosis and selected by subsequent therapy with possible therapeutic planning implications. Additional studies to confirm the results and expand the study set are underway.

Correlative Analyses of Cereblon (CRBN), cMYC, IRF4, BLIMP1, and XBP1 with Clinical Outcomes in Stratus (MM-010), a Phase 3b Study of Pomalidomide (POM) + Low-Dose Dexamethasone (LoDEX) in Patients (pts) with Relapsed/Refractory Multiple Myeloma (RRMM)

Correlative Analyses of Cereblon (CRBN), cMYC, IRF4, BLIMP1, and XBP1 with Clinical Outcomes in Stratus (MM-010), a Phase 3b Study of Pomalidomide (POM) + Low-Dose Dexamethasone (LoDEX) in Patients (pts) with Relapsed/Refractory Multiple Myeloma (RRMM)

Multiomic Analysis of Cereblon Expression and Its Prognostic Value in Kidney Renal Clear Cell Carcinoma, Lung Adenocarcinoma, and Skin Cutaneous Melanoma

Cereblon (CRBN) is a component of the E3 ubiquitin ligase complex that plays crucial roles in various cellular processes. However, no systematic studies on the expression and functions of CRBN in solid tumors have been conducted to date. Here, we analyzed CRBN expression and its clinical value using several bioinformatic databases. CRBN mRNA expression was downregulated in various cancer types compared to normal cells. Survival analysis demonstrated that overall survival was significantly positively correlated with CRBN expression in some cancer types including lung adenocarcinoma (LUAD), kidney renal clear cell carcinoma (KIRC), and skin cutaneous melanoma (SKCM). CRBN expression was downregulated regardless of clinicopathological characteristics in LUAD and KIRC. Analysis of genes that are commonly correlated with CRBN expression among KIRC, LUAD, and SKCM samples elucidated the potential CRBN-associated mechanisms of cancer progression. Overall, this study revealed the prognostic value of CRBN and its potential associated mechanisms, which may facilitate the development of anti-cancer therapeutic agents.

Mutations in CRBN and Other Cereblon Pathway Genes Are Only Associated with Acquired Resistance to Immunomodulatory Drugs in a Subset of Patients and Cell Line Models

Mutations in CRBN and Other Cereblon Pathway Genes Are Only Associated with Acquired Resistance to Immunomodulatory Drugs in a Subset of Patients and Cell Line Models

Expression, mutation, and methylation of cereblon‐pathway genes at pre‐ and post‐lenalidomide treatment in multiple myeloma

Cereblon (CRBN) is a target for immunomodulatory drugs. This study investigated the prognostic value of the expression of CRBN‐pathway genes on the clinical relevance of lenalidomide (Len) treatment and evaluated the levels of CRBN‐binding proteins and mutations in these genes after Len treatment. Forty‐eight primary multiple myeloma cells were collected prior to treatment with Len and dexamethasone (Ld) and 25 paired samples were obtained post‐Ld therapy. These tumor cells were used to determine the expression and mutated forms of the CRBN‐pathway genes. Following normalization with CRBN levels, there was a significantly reduced IKZF1/CRBN ratio in samples that responded poorly to Ld therapy. Moreover, patients with low ratios of IKZF1/CRBN showed a significantly shorter progression‐free survival (PFS) and overall survival (OS) than those with higher ratios. However, patients with high ratios of KPNA2/CRBN showed a significantly shorter PFS and OS than patients with lower ratios. Of the 25 paired samples analyzed, most samples showed a reduction in the expression of CRBN and an increase in IKZF1 gene expression. No mutations were observed in CRBN, IKZF1, or CUL4A genes in the post‐Ld samples. In conclusion, a decreased expression of IKZF1 and increased expression of KPNA2 compared to that of CRBN mRNA predicts poor outcomes of Ld therapy.

Arsenic Trioxide Upregulates Cereblon mRNA Expression and Potentiates Sensitivity of SKM-1 and MDS-L Cells to Lenalidomide

INTRODUCTION Arsenic trioxide (ATO) was approved in the United States and Europe for the treatment of acute promyelocytic leukemia (APL). ATO was also studied in multiple myeloma (MM) and myelodysplastic syndrome (MDS), where it induced growth inhibition and apoptosis. ATO produced trilineage responses in MDS by several mechanisms of action. These mechanisms included induction of cell cycle arrest, apoptosis and autophagy, generation of reactive oxygen species (ROS), release of cytochrome c and activation of caspases, induction of differentiation and anti-angiogenesis. We showed that the high level of full-length cereblon (CRBN) mRNA and CRBN protein is important for the efficacy of lenalidomide (LEN) in lower-risk MDS patients (Jonasova et al. Eur J Haematol 2015; 95: 27-34; Fuchs et al. Leuk Res 2017; 55 (S1): S132, abstr. 227). ATO potentiated CRBN expression levels in MM cell lines (Jian et al. Oncol Lett 2017; 14:3243-3248). AIMS The aim of our study was to evaluate the levels of CRBN mRNA and Nrf2 (nuclear factor, erythroid-derived 2-like 2 or NF-E2-related factor 2) mRNA in SKM-1 (leukemic cell line established from a patient with progression of MDS to myelomonocytic leukemia) and MDS-L (a human myeloblastic cell line established from the bone marrow of an MDS patient with del(5q); Matsuoka et al. Leukemia 2010; 24: 748-755) cells treated with various concentrations of ATO as a single agent or with combinations of ATO with LEN, erythropoietin (EPO) and prednisone for 24 hours. We tested our hypothesis that ATO induced the transcription factor Nrf2 mRNA levels and increased CRBN mRNA expression as a single agent and also in combinations with LEN, EPO and prednisone. METHODS Full-length CRBN mRNA and Nrf2 mRNA levels were quantified in SKM-1 and MDS-L cells incubated without (controls) or with 0.05; 0.1; 0,5 and 1.0 microM ATO as a single agent for 24 hours using the reverse transcription-quantitative TaqMan PCR assay. Total RNA was extracted from cells, reverse transcribed and TaqMan PCR assay was provided for CRBN mRNA, Nrf2 mRNA and glyceraldehyde-3- phosphate dehydrogenase (GAPDH), a housekeeping gene. The effect of ATO (0.1 microM) in combinations with LEN (10 microM), EPO (2U/ml) and prednisone (100 microM) on full-length CRBN mRNA and Nrf2 mRNA levels was also studied in SKM-1 and MDS-L cells. RESULTS The levels of full-length CRBN mRNA and Nrf2 mRNA corresponded in both cell lines, SKM-1 and MDS-L, treated with ATO as a single agent or in combinations with LEN, EPO and prednisone. The most prominent effect of ATO as a single agent on the levels of both mRNAs was gained in 0.1 microM concentration in SKM-1 cells and 0.5 microM in MDS-L cells. Positive effects of combinations of ATO and prednisone; ATO, prednisone and LEN; or ATO, prednisone, LEN and EPO in both cell lines on the levels of full-length CRBN mRNA and Nrf2 mRNA were also detected. CONCLUSIONS Our findings showed that ATO induced CRBN mRNA and Nrf2 mRNA levels in SKM-1 and MDS-L cell lines and potentiated sensitivity of these cells to LEN and to combinations of LEN with EPO and prednisone. We speculate that one of the mechanism of ATO action is a generation of reactive oxygen species (ROS) and oxidative stress responses which induce expression of transcription factor Nrf2. This transcription factor stimulates CRBN mRNA expression. LEN is an immunomodulatory drug and therefore in vitro studies are not sufficient. Further in vivo studies are required to study the effect of ATO and its combinations with LEN, EPO and prednisone. This work was supported by the research project for conceptual development of research organization (00023736; IHBT, Prague, Czech Republic) and Grant Agency of Charles University, project number 924616. Disclosures No relevant conflicts of interest to declare.

Treatment of Lymphoid and Myeloid Malignancies by Immunomodulatory Drugs.

Thalidomide and its derivatives (lenalidomide, pomalidomide, avadomide, iberdomide hydrochoride, CC-885 and CC-90009) form the family of immunomodulatory drugs (IMiDs). Lenalidomide (CC5013, Revlimid®) was approved by the US FDA and the EMA for the treatment of multiple myeloma (MM) patients, low or intermediate-1 risk transfusion-dependent myelodysplastic syndrome (MDS) with chromosome 5q deletion [del(5q)] and relapsed and/or refractory mantle cell lymphoma following bortezomib. Lenalidomide has also been studied in clinical trials and has shown promising activity in chronic lymphocytic leukemia (CLL) and non-Hodgkin lymphoma (NHL). Lenalidomide has anti-inflammatory effects and inhibits angiogenesis. Pomalidomide (CC4047, Imnovid® [EU], Pomalyst® [USA]) was approved for advanced MM insensitive to bortezomib and lenalidomide. Other IMiDs are in phases 1 and 2 of clinical trials. Cereblon (CRBN) seems to have an important role in IMiDs action in both lymphoid and myeloid hematological malignancies. Cereblon acts as the substrate receptor of a cullin-4 really interesting new gene (RING) E3 ubiquitin ligase CRL4CRBN. This E3 ubiquitin ligase in the absence of lenalidomide ubiquitinates CRBN itself and the other components of CRL4CRBN complex. Presence of lenalidomide changes specificity of CRL4CRBN which ubiquitinates two transcription factors, IKZF1 (Ikaros) and IKZF3 (Aiolos), and casein kinase 1α (CK1α) and marks them for degradation in proteasomes. Both these transcription factors (IKZF1 and IKZF3) stimulate proliferation of MM cells and inhibit T cells. Low CRBN level was connected with insensitivity of MM cells to lenalidomide. Lenalidomide decreases expression of protein argonaute-2, which binds to cereblon. Argonaute-2 seems to be an important drug target against IMiDs resistance in MM cells. Lenalidomide decreases also basigin and monocarboxylate transporter 1 in MM cells. MM cells with low expression of Ikaros, Aiolos and basigin are more sensitive to lenalidomide treatment. The CK1α gene (CSNK1A1) is located on 5q32 in commonly deleted region (CDR) in del(5q) MDS. Inhibition of CK1α sensitizes del(5q) MDS cells to lenalidomide. CK1α mediates also survival of malignant plasma cells in MM. Though, inhibition of CK1α is a potential novel therapy not only in del(5q) MDS but also in MM. High level of full length CRBN mRNA in mononuclear cells of bone marrow and of peripheral blood seems to be necessary for successful therapy of del(5q) MDS with lenalidomide. While transfusion independence (TI) after lenalidomide treatment is more than 60% in MDS patients with del(5q), only 25% TI and substantially shorter duration of response with occurrence of neutropenia and thrombocytopenia were achieved in lower risk MDS patients with normal karyotype treated with lenalidomide. Shortage of the biomarkers for lenalidomide response in these MDS patients is the main problem up to now.

Importance of Transcription Factor Nrf2 for Cereblon Expression and Clinical Response to Combination of Lenalidomide and Erythropoietin in Lower-Risk Myelodysplastic Syndromes

INTRODUCTIONNrf2 (nuclear factor, erythroid-derived 2-like 2 or NF-E2-related factor 2) is a transcription factor involved in antioxidant response by reducing oxidative stress. Erythropoietin (EPO) was described as an inducer of Nrf2 in the brain. Nrf2 binds to the promoter of gene coding for cereblon (CRBN) and stimulates CRBN expression (Lee et al. Biochem.Biphys Res Commun 2010; 399: 711-715). We showed that the high level of full length CRBN mRNA and CRBN protein is important for the efficacy of lenalidomide (LEN) in lower-risk MDS patients (Jonasova et al. Eur J Haematol 2015; 95: 27-34; Fuchs et al. Leuk Res 2017; 55 S1: S132, abstr. 227). Addition of EPO to LEN restored transfusion independence of MDS patients when their anemia relapsed during the course of LEN treatment (Jonasova et al. Leuk Res 2018; 69: 12-17). LEN inhibits E3 ubiquitin ligase RNF41 (ring finger protein 41), which polyubiquitinates EPO receptor (EPOR) and marks it for degradation in proteasomes. (Basiorka et al. Cancer Res 2016; 76: 3531-3540).AIMSThe aim of our study was to evaluate the levels of Nrf2 mRNA and CRBN mRNA in mononuclear cells obtained from peripheral blood of lower-risk MDS patients after addition of EPO to lenalidomide in MDS patients who relapsed during LEN monotherapy. The further goal was to study the effect of LEN, EPO and combination of LEN plus EPO in cell lines (SKM-1 leukemic cell line established from a patient with progression of MDS to myelomonocytic leukemia and in MDS-L cells a human myeloblastic cell line, established as a MDS92 subline from the bone marrow of an MDS patient with del(5q) (Matsuoka et al. Leukemia 2010; 24: 748-755).METHODSNrf2 mRNA and full-length CRBN mRNA levels were quantified in 9 lower-risk MDS patients with del(5q) and in 2 MDS patients with normal chromosome 5 [nondel(5q)] who were previously resistant to EPO treatment. All patients with median hemoglobin level 80 g/l were transfusion dependent before starting the therapy with LEN (5 or 10 mg/day). Recombinant human EPO (rHuEPO) in dose of 40,000 IU s.c. per week was combined with LEN in these MDS patients who relapsed during LEN monotherapy or were resistant to LEN [one non(del5q) patient]. Four lower-risk MDS patients responsive to EPO after diagnosis were also used for comparison of Nrf2 mRNA and full-length CRBN mRNA levels. Mononuclear cells were isolated by Ficoll-Paque PLUS gradient separation, then washed by phosphate buffered saline and remaining red cells were lysed. Both SKM-1 and MDS-L cells were incubated without or with LEN, EPO and combination of LEN plus EPO for 19, 24 and 43 hours. The end concentration of added Epo was 2U/ml and LEN 10 µM. The levels of Nrf2 mRNA and full length CRBN mRNA were measured using the reverse transcription-quantitative TaqMan PCR assay.RESULTSThe levels of Nrf2 mRNA and full-length CRBN mRNA in peripheral blood mononuclear cells correspond during rHuEPO monotherapy of four responsive lower-risk MDS patients. In these cases no increase of Nrf2 mRNA and CRBN mRNA levels was found. Increased Nrf2 mRNA and CRBN mRNA levels in peripheral blood mononuclear cells were found after addition of rHuEPO to lenalidomide in six MDS patients with del(5q) and one non(del5q) MDS patient who relapsed during LEN monotherapy. All these patients responded to combination of rHuEPO and lenalidomide by increased hemoglobin levels. Addition of or rHuEPO to lenalidomide was without effect on Nrf2 mRNA and CRBN mRNA levels in one non(del5q) patient who was resistant to LEN. Experiments with SKM-1 and MDS-L cells showed that rHuEPO alone did not increased Nrf2 mRNA and CRBN mRNA levels. However LEN and in a greater extent the combination of rHuEPO and LEN increased Nrf2 mRNA and CRBN mRNA levels.CONCLUSIONSOur findings indicate that transcription factor Nrf2 is involved in CRBN expression in mononuclear cells obtained from peripheral blood of lower-risk MDS patients and in SKM-1 and MDS-L cells in culture. Expression of both Nrf2 and CRBN is stimulated by lenalidomide and in a greater extent by combination of lenalidomide and rHuEPO. Measurement of CRBN mRNA level as an important factor for prediction of the efficacy of not only lenalidomide monotherapy but also of combination of LEN and rHuEPO.This work was supported by the research project for conceptual development of research organization (00023736; Institute of Hematology and Blood Transfusion, Prague) and Grant Agency of Charles University, project number 924616. DisclosuresNo relevant conflicts of interest to declare.

Cereblon modulator iberdomide induces degradation of the transcription factors Ikaros and Aiolos: immunomodulation in healthy volunteers and relevance to systemic lupus erythematosus

ObjectivesIKZF1 and IKZF3 (encoding transcription factors Ikaros and Aiolos) are susceptibility loci for systemic lupus erythematosus (SLE). The pharmacology of iberdomide (CC-220), a cereblon (CRBN) modulator targeting Ikaros and Aiolos,...

Cereblon Splicing of Exon 10 Mediates IMiDs Resistance in Multiple Myeloma: Clinical Validation in the CoMMpass Trial

Background: IMiDs neomorphe the substrates binding of CRL4_DDB1_ROC1 E3 ligase through their interaction with the adaptor protein Cereblon (CRBN) triggering the proteasomal degradation of IKZF1/IKZF3. This binding results from hydrogen bonds forming between the carbonyl residues of the IMiDs' glutarimide moiety and several amino acids within a hydrophobic pocket on the surface of CRBN. This pocket is formed by three tryptophan residues (W380, W386 and W400) mapping to CRBN c-terminus exons 10-11. Others and us, have previously shown that in vitro silencing or knock-out of CRBN is clearly associated with resistance to IMiDs, however CRBN mutations mapping to its thalidomide binding domain are rarely seen. We have previously identified through paired sequencing of the transcriptome of primary myeloma cells (pre- and post IMiDs) the expression of a CRBN mRNA splice variant (CRBN-005 or ENST00000424814) lacking exon 10. We also demonstrated that this isoform is translated into a stable protein that retains its binding to DDB1/Cul4a ligase but was no longer capable of interacting with IMiDs. Functionally, in HEK293 we have also shown that stable expression of CRBN-005 at higher levels relative to the full-length variant (CRBN-004 or ENST00000231948) abrogated IMiDs-induced degradation of Ikaros. In the current work, we validated in myeloma cell lines in vitro that the splicing of CRBN exon 10 was sufficient to reverse the cytotoxicity of lenalidomide. We also interrogated the longitudinal CoMMpass trial for the expression of CRBN-005 transcripts and its impact on survival.Methods and Results: We initially confirmed that lentiviral CRISPR mediated stable knock-out of CRBN using gRNA targeting exon 2 in the MM1S and OPM2 lenalidomide sensitive cell lines, resulted in complete resistance to IMiDs. In order to examine the role of CRBN exon 10 splicing in IMiDs resistance, we next cloned spliced CRBN-005 isoform (Δ10-CRBN) or full length CRBN (WT-CRBN) into lentiviral plasmid pLX304 and stably transduced JJN3 and KMS28BM myeloma cells. The Δ10-CRBN plasmid expressed a ~ 45 kDa proteins detectable by western blotting with CRBN65 antibody (Celgene, binds aa 65-76). Stable expression of Δ10-CRBN in JJN3 and KMS28BM cells significantly reduced Aiolos and Ikaros degradation in response to lenalidomide treatment and partially reversed (~ 30%) KMS28BM cell death (JJN3 are resistant to lenalidomide despite IKZF1 degradation). Consistent with our previous studies in HEK293 cells, high expression of Δ10-CRBN relative to endogenous WT-CRBN was required for the reversal of lenalidomide effects. Furthermore, we used the CRIPSR technology to induce splicing of endogenous CRBN exon 10 using two lentiviral gRNAs targeting intron9-exon10 (TTTATCCTTATGTGGGCCGA) and exon10-intron10 junctions (CAGAACACAGCTGGTTTCCT) in lenalidomide-sensitive MM1S and OPM2 cells stably engineered to express Cas9. Single cell clones expressing the exon 10 spliced CRBN were identified by cDNA cloning and sanger sequencing. The viability of the clones in response to lenalidomide as well as Ikaors degradation were nearly fully reversed in comparison to Cas9 only expressing MM1S and OPM2 cells. Lastly, in order to clinically validate the role of Δ10-CRBN in IMiDs resistance we interrogated the transcriptome of patients enrolled in the CoMMpass trial where in addition to genomic profiling (shallow genome long-insert sequencing, WES, RNAseq) clinical data and outcomes are captured. In the CoMMpass IA8, clinical and molecular data is available on 549 subjects, of which 486 were identified as ever receiving IMiDs-based regimen. We analyzed the survival of these patients based on the ratio of transcript levels (TPM) of spliced CRBN (ENST00000424814) to that of full-length CRBN. Using a cut-off ratio of 0.75, the survival of patients treated with IMiDs based regimen and high levels of spliced CRBN was significantly worse (Figure). Importantly, in 20 patients were RNA was available pre- and post IMiDs, we show that the levels of the CRBN spliced variants were significantly increased at the time of disease progression (Figure boxplot).Conclusions: In the current work, we have confirmed the role CRBN exon 10 splicing in IMiDs resistance using functional in vitro validation studies and demonstrated its predictive effects on IMiDs activity in the CoMMpass clinical dataset. [Display omitted] DisclosuresNeri:Celgene and Jannsen: Consultancy, Honoraria. Lonial:Celgene: Consultancy; Novartis: Consultancy; Janssen: Consultancy; Janssen: Consultancy; Celgene: Consultancy; Millenium: Consultancy; BMS: Consultancy; Novartis: Consultancy; BMS: Consultancy; Merck: Consultancy; Onyx: Consultancy; Onyx: Consultancy. Bahlis:Janssen: Consultancy, Honoraria, Other: Travel Expenses, Research Funding, Speakers Bureau; Onyx: Consultancy, Honoraria; Celgene: Consultancy, Honoraria, Other: Travel Expenses, Research Funding, Speakers Bureau; BMS: Honoraria; Amgen: Consultancy, Honoraria.

Resistance to Lenalidomide in Multiple Myeloma Is Associated with a Switch in Gene Expression Profile

Background: Cereblon (CRBN) is a substrate receptor of the Cullin 4 E3 ubiquitin ligase complex CRL4CRBN and is the molecular target of the IMiD® immunomodulatory drug lenalidomide. It has been shown that cereblon is required for the anti-proliferative activity of lenalidomide in multiple myeloma (MM) and that reduction of CRBN expression is associated with resistance to IMiD® compounds.Methods: RNA-seq analysis was performed on 12 paired MM patients samples of sorted CD138+ cells obtained prior to lenalidomide treatment initiation and after development of resistance. Transcriptome sequence data was generated on an Ion Torrent Proton sequencer with at least 70 million reads per sample. The STAR aligner was used to align raw reads to the Ensembl74 reference annotation. The HTseq and eXpress algorithms were used to quantify gene and transcript counts, respectively, and the Sailfish algorithm was used to validate eXpress transcript counts. The Deseq2 algorithm was used to determine differential expression at gene and transcript levels between paired samples.Results: Of 272 genes observed to change significantly in expression at relapse (FDR < 0.05), a majority (169) were up-regulated. Inter-pathway similarity analysis based on gene set enrichment analysis (GSEA; canonical pathways) suggested 4 distinct processes were down-regulated at relapse, including Notch Signaling, Interferon Signaling and G-coupled protein receptor signaling. Conversely, patients exhibited a single dominant up-regulated process associated with proliferation. Additional GSEA analysis on more specific gene categories revealed up-regulation of the Proliferation gene cluster described in the University of Arkansas for Medical Science (UAMS) classification for newly diagnosed MM (6 of 2599 gene sets tested; FDR<0.01), which is associated with poor prognosis. This suggests that specific gene expression profiles (GEPs) identified in newly diagnosed MM patients may be enriched in relapsed samples.Further analysis of differential gene expression was performed to assess correspondence against the 10 MM GEP subgroups identified by Broyl, et al. (Blood, 2010) from newly diagnosed multiple myeloma. The output revealed significant enrichment of the Proliferation and MMSET/FGFR3 subgroup classifications (FDR<0.01) and a corresponding decrease in the NFkB subgroup classification at relapse (FDR<0.01), indicating a switch in GEP enrichment in relapse samples. Significantly changed genes common between Proliferation-MMSET/FGFR3 and NFkB classifications and contributing to the switch in GEP included BUB1B (FDR<0.001), HMMR (FDR<0.001), TAGAP (FDR<0.001), SMC4 (FDR=0.002), RRM2 (FDR=0.005) and KLF6 (FDR=0.029).Examination of genes commonly associated with lenalidomide mechanism of action revealed that in this cohort CRBN RNA was down-regulated by more than 2-fold in one patient and an enrichment of CRBN transcript lacking exon 10 was observed in another patient. Interestingly, high levels of CRBN transcripts that retain introns 6, 7 and 8 and do not encode for protein were detected in both diagnostic and relapse samples, which might explain previously observed discordant expression between CRBN mRNA and protein. Furthermore, no significant changes in gene expression at relapse was observed for Aiolos, Ikaros, c-myc or IRF4, although there was a trend for c-myc up-regulation. Ikaros and Aiolos are known to undergo extensive splicing, however, we were unable to detect changes in Aiolos or Ikaros splicing in patients at relapse.Conclusions: Taken together, this data suggests that lenalidomide resistance in patients is associated with a switch in gene expression profile from NFkB to Proliferation and MMSET/FGFR3 subgroups identified by Broyl, et al (Blood 2012). Given these GEPs were obtained from newly diagnosed patients, this yields the hypothesis that lenalidomide treatment induces a reduction in MM cells with an NFkB gene expression profile and expansion of cells exhibiting a Proliferation and/or MMSET/FGFR3 associated GEP, which appear to be resistant to therapy. Future studies to understand how individual genes in the GEP subgroups identified contribute to lenalidomide sensitivity/resistance are on-going. DisclosuresAmatangelo:Celgene Corporation: Employment, Equity Ownership. Neri:Celgene: Research Funding. Ortiz:Celgene Corporation: Employment. Bjorklund:Celgene Corporation: Employment, Equity Ownership. Gandhi:Celgene: Employment, Equity Ownership. Klippel:Celgene Corporation: Employment, Equity Ownership. Bahlis:Amgen: Consultancy; Johnson & Johnson: Consultancy; Johnson & Johnson: Speakers Bureau; Johnson & Johnson: Research Funding; Celgene: Consultancy, Honoraria, Research Funding, Speakers Bureau. Daniel:Celgene Corporation: Employment, Equity Ownership. Chopra:Celgene Corporation: Employment, Equity Ownership. Trotter:Celgene Corporation: Employment. Thakurta:Celgene Corporation: Employment, Equity Ownership.

43 A PREDICTIVE MODEL OF RESPONSE TO ERYTHROPOIETIC STIMULATING AGENTS IN PATIENTS WITH MYELODYSPLASTIC SYNDROME

Downregulation of cereblon (CRBN) gene expression is associated with resistance to the immunomodulatory drug (IMiD) lenalidomide and poor survival outcomes in multiple myeloma patients. However, the importance of CRBN gene expression in patients with myelodysplastic syndrome (MDS) and its impact on lenalidomide therapy are not clear. In this study we are following up our earlier investigation (results were published in EJH). We are presenting data from larger sample of patients and in addition bringing the results from lower risk MDS patients without del(5q), marked as non-5q-, treated with lenalidomide. We evaluate cereblon expression in mononuclear cells isolated from peripheral blood (PB) [43 lower risk MDS with isolated 5q deletion (5q-), 53 non-5qand 32 healthy controls] and from bone marrow (BM) [27 lower risk MDS with 5q-, 38 non-5qlower risk MDS and 25 healthy controls] to gain insight into, firstly, the role of cereblon in lower risk MDS patients with or without 5q deletion, and secondly, into the mechanism of lenalidomide action. Patients with 5qlower risk MDS have the highest levels of CRBN mRNA in comparison with both lower risk MDS patients without del(5q) and healthy controls. Five non-5qanemic patients who were treated with lenalidomide showed all lower levels of CRBN mRNA. All these patients did not respond to the treatment. CRBN gene expression level was analyzed by using the reverse transcriptase quantitative “best coverage” TaqMan PCR assay with primers in exon 9 and 10 and probe on exon 9. This assay allowed the detection of the full-length CRBN transcript but not alternative splicing forms without exon 10 (binding site of IMiDs on CRBN). We found that a high level of full-length CRBN mRNA in both bone marrow and peripheral blood mononuclear cells of lower risk MDS with isolated 5q deletion corresponds to the efficacy of lenalidomide in these patients. Moreover, we found that patients who stopped responding to lenalidomide and whose disease progressed showed a sudden decrease of CRBN gene expression. Supported by the research grant NT/13836 from the IGA, Ministry of Health, Czech Republic.

Dual-Color CRBN/CD138 Immunohistochemistry Assay for Measuring Cereblon Protein in Samples from Patients with Multiple Myeloma

Background: Cereblon (CRBN) is required for the antiproliferative activity of the IMiDs® immunomodulatory drugs lenalidomide (LEN) and pomalidomide (POM) in multiple myeloma (MM), but its value as a biomarker of IMiD response remains unknown. We have shown a disconnect between CRBN mRNA and protein regulation, indicating that measurement of CRBN protein is critical. However, accurate quantification of CRBN protein levels is challenging due to scarcity of standardized and validated reagents and assays. Several publications have suggested that CRBN mRNA and/or protein levels detected with commercial reagents and assays correlate with LEN and/or POM treatment outcomes. In an effort to establish a standardized and validated approach for CRBN protein measurement in MM biopsies, we developed a dual bright-field immunohistochemistry (IHC) assay to measure CRBN levels in CD138+ MM cells.Methods: Using the highly specific CRBN65 rabbit monoclonal antibody against amino acids 65-76 of human cereblon, a CRBN/CD138 dual IHC assay scored using the H-score method was developed and validated. H-scores range from 0 to 300 and are a result of the sum of the products for the percentage of tumor cells (0%-100%) and the intensity of staining (0-3). Since CRBN is a nuclear and cytoplasmic protein, both nuclear and cytoplasmic H-scores were recorded for each sample evaluated with the assay. The dual IHC assay with CRBN65 antibody was used to evaluate the high CRBN–expressing DF15 MM cell line and the low CRBN–expressing DF15R MM cell line (made resistant to POM), as well as bone marrow core biopsies or aspirate clots from 22 patients with MM. For comparison, the same set of samples were stained using a commercially available CRBN antibody in a single IHC assay format. To evaluate interpathologist score variation, H-scores were recorded by 3 pathologists examining the samples independently. Interassay variation was evaluated by staining serial sections of biopsies from the same patient in 3 different experiments and calculating the coefficient of variation (CV) among scores produced for each patient by the same pathologist.Results: The assay was specific and able to detect high CRBN levels in DF15 cells (cytoplasmic score = 190; nuclear score = 150) and low CRBN levels in DF15R cells (cytoplasmic score = 20; nuclear score = 30). The dual IHC assay was able to detect different CRBN staining levels in biopsies and clots from patients with MM, with average cytoplasmic H-scores ranging from 67 to 240 and nuclear H-scores ranging from 17 to 250. Compared with our dual assay, the single IHC assay performed with a commercial CRBN antibody demonstrated lack of specificity, did not detect nuclear CRBN, and showed similar immunoreactivity in the DF15 and DF15R cells. In addition, the commercial CRBN antibody had a narrow range of detection for CRBN (estimated) in patients with MM (Table). Interpathologist comparison of MM biopsy H-scores from 3 pathologists demonstrated high concordance (r2 = 0.73). Assay precision was shown for both cytoplasmic and nuclear CRBN in MM bone marrow biopsies, with CV values of 2% and 5%, respectively.Conclusion: A dual CD138/CRBN IHC assay was developed to provide a reliable semiquantitative method to evaluate CRBN protein levels in both bone marrow core biopsies and clots from patients with MM that is specific, precise, and reproducible. The data highlight the requirement for standardization in the evaluation of CRBN expression. This assay will be used in future trials to assess the value of CRBN as a biomarker in MM and other hematologic malignancies.Table:Estimated CRBN detection in patients with MMSamplesCytoplasmic H-ScoreNuclear H-ScoreDual IHCSingle IHCaDual IHCSingle IHCaCell linesDF15 (CRBN high)1901201500DF15R (CRBN low)20120300Patient biopsiesMM16 (CRBN high)270200b2700MM20 (CRBN low)90100b100a Commercially available antibody for CRBN.b Values are estimated because tumor cell cannot be reliably identified. DisclosuresRen:Celgene Corp: Employment, Equity Ownership. Wang:Celgene Corp: Employment, Equity Ownership. Couta:Celgene Corp: Employment, Equity Ownership. Hansel:Celgene Corp: Consultancy. Miller:Celgene Corp: Employment, Equity Ownership. Lopez-Girona:Celgene Corp: Employment, Equity Ownership. Bjorklund:Celgene Corp: Employment, Equity Ownership. Gandhi:Celgene Corp: Employment, Equity Ownership. Thakurta:Celgene Corp: Employment, Equity Ownership. Chopra:Celgene Corp: Employment, Equity Ownership. Breider:Celgene Corp: Employment, Equity Ownership.

High level of full-length cereblon mRNA in lower risk myelodysplastic syndrome with isolated 5q deletion is implicated in the efficacy of lenalidomide.

Downregulation of cereblon (CRBN) gene expression is associated with resistance to the immunomodulatory drug lenalidomide and poor survival outcomes in multiple myeloma (MM) patients. However, the importance of CRBN gene expression in patients with myelodysplastic syndrome (MDS) and its impact on lenalidomide therapy are not clear. In this study, we evaluate cereblon expression in mononuclear cells isolated from bone marrow [23 lower risk MDS patients with isolated 5q deletion (5q-), 37 lower risk MDS patients with chromosome 5 without the deletion of long arms (non-5q-), and 24 healthy controls] and from peripheral blood (38 patients with 5q-, 52 non-5q- patients and 25 healthy controls) to gain insight into, firstly, the role of cereblon in lower risk MDS patients with or without 5q deletion and, secondly, into the mechanisms of lenalidomide action. Patients with 5q- lower risk MDS have the highest levels of CRBN mRNA in comparison with both lower risk MDS without the deletion of long arms of chromosome 5 and healthy controls. CRBN gene expression was measured using the quantitative TaqMan real-time PCR. High levels of CRBN mRNA were detected in all lenalidomide responders during the course of therapy. A significant decrease of the CRBN mRNA level during lenalidomide treatment is associated with loss of response to treatment and disease progression. These results suggest that, similar to the treatment of MM, high levels of full-length CRBN mRNA in lower risk 5q- patients are necessary for the efficacy of lenalidomide.

High Cereblon Expression In Lower Risk Myelodysplastic Syndromes With 5q Deletion Is Associated With The Efficacy Of Lenalidomide

IntroductionThe binding of immunomodulatory drugs (IMiDs), including lenalidomide, to CRBN is associated with cytotoxicity of IMiDs used in the treatment of multiple myeloma, myelodysplastic syndromes (MDS) and lymphomas. Cereblon (CRBN) is named for its putative role in cerebral development, especially in memory and learning. CRBN forms an E3 ubiquitin ligase complex with damaged DNA binding protein 1 (DDB1), cullin-4 (CUL4) and regulator of cullin 1 (ROC1). This complex regulates DNA repair, DNA replication and transcription. CRBN is a primary target of thalidomide teratogenicity (Ito et al., Science 2010; 327:1345-1350). Down-regulation of the CRBN expression is associated with the development of marked IMiDs resistance in human multiple myeloma cells (Zhu et al., Blood 2011; 118: 4771-4779; Lopez Girona et al., Leukemia 2012; 26: 2326-2335; Heintel et al., Br J Haematol 2013; 161: 695-700; Broyl et al., Blood 2013; 121: 624-627; Lodé et al., Br J Haematol 2013; Jul 17. doi: 10.1111/bjh.12478). CRBN expression is thus required for the antimyeloma activity of IMiDs. AimsTo gain insight into the role of CRBN in lower risk myelodysplastic syndromes with or without 5q deletion and into the mechanisms of lenalidomide action, we study CRBN expression in these two groups of lower risk MDS patients and in healthy controls. We further study the expression of DDB1 and IRF4 (interferon regulatory factor 4, one of target genes of CRBN). MethodsMononuclear cells were isolated both from bone marrow [23 low risk MDS patients with 5q- deletion, 37 low-risk MDS patients with normal chromosome 5 (non5q-) and 24 healthy controls] and from peripheral blood [38 patients with 5q- , 52 non 5q- patients and 25 healthy controls] by Ficoll-Paque PLUS gradient separation, and washed with phosphate-buffered saline. The rest of the red cells were lysed. Total RNA was isolated using RNA isolation solvent and complementary DNA was synthesized from total RNA using SuperScript II reverse transcriptase. Relative levels of the CRBN, DDB1 and IRF4 mRNAs were determined by TaqMan-based quantitative real-time PCR and by calculation to the level of housekeeping glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA. The experiments were performed in duplicate. Informed consent was obtained from all patients and healthy controls. Evaluation of 2-ddCt indicates the fold change in gene expression relative to the control. ResultsThe median of CRBN mRNA levels in total RNA isolated from peripheral blood mononuclear cells was the highest (3.6) in lower risk MDS with 5q deletion, lower (1.5) in non5q- MDS and lowest (1.2) in healthy controls. Similar results were obtained in bone marrow mononuclear cells (medians 3.3 in 5q- syndrome, 2.2 in non5q- MDS and 1.3 in healthy controls). The differences between the 3 groups were statistically significant (p˂0.05, Mann-Whitney test) with the exception of non5q- MDS in comparison with healthy controls in mononuclear cells of peripheral blood. Very similar results were obtained in the analysis of DDB1 and IRF4 mRNAs levels, which correlated with CRBN levels. We analyzed CRBN mRNA levels before and in the course of the lenalidomide treatment of 5q- low risk MDS (6 patients). We obtained high CRBN mRNA levels before and during the treatment by lenalidomide in all lenalidomide responders (4 patients). We found a sharp decrease of CRBN mRNA in mononuclear cells of bone marrow in two patients who stopped responding to lenalidomide therapy and subsequently progressed to higher risk MDS. A/G polymorphism located at -29 nt of the 5x UTR of CRBN does not act as a biomarker of response to treatment with lenalidomide in 5q- syndrome. Conclusions5q- low risk MDS patients have the highest levels of CRBN mRNA in comparison to lower risk myelodysplastic syndromes with normal chromosome 5 and to healthy controls. DDB1 and IRF4 mRNAs levels correlate with CRBN levels. High levels of CRBN mRNA were detected in all lenalidomide responders during the course of the therapy. Significant decrease of CRBN levels during treatment by lenalidomide is associated with loss of response to treatment and disease progression. Similarly to the treatment of multiple myeloma, these results suggest that high levels of CRBN mRNA are necessary for the efficacy of lenalidomide in low risk 5q- patients.Supported by the MH CR grant NT/13836-4/2012, PRVOUK-27/LF1/2 and by the MH CR project for development of research institute (UHKT). Disclosures:No relevant conflicts of interest to declare.

RNA-Sequencing Of Paired Pre-Treatment and Relapse Samples Reveals Differentially Expressed Genes Associated With Lenalidomide Resistance In Multiple Myeloma

BackgroundImmunomodulatory (IMiDs) drugs' cytotoxicity in MM cells is mediated through their binding to cereblon (CRBN) an adaptor protein of the Cul4a-DDB1-ROC1 ubiquitin E3 ligase complex. Loss of CRBN is clearly associated with resistance to IMiDs (Zhu et al. Blood. 2011) however this does not appear to be the sole mechanism through which MM cells may acquire resistance to this class of drugs. In addition, the acquisition of CRBN mutations within the Thalidomide binding domain (exons 10-11) have not been well studied. Similarly and while splice variants of CRBN were recently reported (Ghandi et al. Blood. 2012), no correlations has been made between the presence of these isoforms and IMiDs resistance in primary samples. Methods and ResultsIn this study, we first validated CRBN as biomarker of clinical response to lenalidomide. At the mRNA level, using qRT-PCR (n=26, amplicons with 2 sets of primers overlapping exons 8-9 and exons 10-11) low CRBN in CD138 sorted bone plasma cells was significantly associated with shorter PFS (p=0.008) and lack of response to lenalidomide. We next compared CRBN mRNA (qRT-PCR) expression in paired samples (n=17 patients - 34 pairs) collected immediately pre-treatment and at the time of disease progression post-lenalidomide. In 10/17 (58.8%), a significant reduction (2-ΔΔCT < 0.8) in the CRBN amplicon levels was observed between the paired pre- and post-treatment samples. These data suggest that in nearly half of the patients, CRBN-independent mechanisms may be mediating resistance to IMiDs. In order to elucidate these CRBN-independent mechanisms of resistance to lenalidomide and identify potential targets that may overcome it, RNA-seq analysis was performed in 12 paired patients samples obtained sequentially from the same patient prior to lenalidomide treatment initiation and after development of resistance. Transcriptome sequence data was generated by RNA-seq performed for each sample on Ion Torrent Proton sequencer with a minimum of 70 million reads per sample. Poly(A) is captured with poly(T) magnetic beads, fragmented and copied to cDNA libraries with reverse transcriptase and primers. Filtered Fastq files are processed with TopHat-Fusion alignment against hg19 as reference genome. Cufflinks and Cuffdiff algorithms were used to detect differentially expressed transcripts and spliced isoforms. A total of 830 genes were identified as differentially expressed (p value and FDR <0.05) between the pre- and post-lenalidomide paired samples. Selected differentially expressed genes were also measured by RT-PCR analysis to confirm the validity of the RNA-seq analysis. In order to gain insight into the cellular and molecular functions of this identified gene set, we compared it to the expression of 395 gene sets curated in the Molecular Signatures Database (MSigDB), using the Gene set enrichment analysis (GSEA) algorithm. Among the most enriched gene sets in this analysis were KRAS.KIDNEY_UP.V1_UP; KRAS.LUNG_UP.V1_UP; KRAS.600.LUNG.BREAST_UP.V1_UP; RAF_UP.V1_DN; MEK_UP.V1_DN; and STK33_DN suggesting a role for the RAS-RAF-MAPK pathway in the acquired resistance to IMiDs. Other gene sets of interest included AKT_UP_MTOR_DN.V1_DN, E2F3_UP.V1_UP; EIF4E_UP and RPS14_DN.V1_DN; consistent with a role for the translational machinery activity (mTOR-4EBP1-eIF4E pathway) in IMiDs resistance. Of interest variant splice isoforms of CRBN were visualized using the Integrative Genomics Viewer (IGV) tool including isoforms lacking exon 10, which contains a portion of the IMiD-binding domain. However these CRBN splice variants are unlikely to be implicated in resistance to IMiDs since they were not enriched in the relapsed paired samples. ConclusionsStudy of the transcriptome of paired pre- and post-IMIDs in myeloma primary cells confirms that acquired resistance to this class of drugs is associated with the direct loss of CRBN as well as through the modulation of other CRBN-independent pathways. Disclosures:No relevant conflicts of interest to declare.

Detection and Quantification of Cereblon Protein and mRNA in Multiple Myeloma Cell Lines and Primary CD138+multiple Myeloma Cells

Abstract 4043 Background:Cereblon (CRBN), a component of the DDB1-CUL4A-Roc1 ubiquitin ligase complex, has been identified as a target of the immunomodulatory agents thalidomide, lenalidomide, and pomalidomide (Lopez-Girona et al. Leukemia. 2012; Zhu et al. Blood. 2011; Ito et al. Science. 2010.). CRBN binding by these agents mediates their anti-proliferative effects in multiple myeloma (MM) cells (Lopez-Girona et al. Leukemia. 2012; Zhu et al. Blood. 2011). However, the role of CRBN quantification as a marker for disease responsiveness or resistance to these drugs remains to be fully defined. Furthermore, it is unclear whether measuring mRNA or protein expression is the best approach for development of a quantitative CRBN expression assay. In order to define the optimal assay approach, we have studied CRBN mRNA and protein expression in MM cell lines (n=20) and MM patient samples. Methods:CRBN isoform mapping was undertaken using a nested PCR approach and Sanger sequencing. Commercially available and newly generated rabbit anti-CRBN antibodies were characterized with recombinant human CRBN protein and MM cell line extracts via western blot analysis. Results:Our data show that in addition to the transcript for full length protein (GenBank Accession NM_016302.3), in MM cells there are at least 6 alternatively spliced isoforms of CRBN as depicted in Figure 1. Five of the 6 CRBN isoforms (CRBN-003, -004, -005, -006, and -007) contain novel splice junctions not previously described. In addition, 3 of the identified transcripts (CRBN-002, -003, and -005) contain in-frame ORFs, suggesting they encode variants of CRBN protein. Of note, exon 10, which contains a portion of the IMiD-binding domain, is not present in CRBN-002. The functional consequence of CRBN-002 remains to be elucidated, but may be a marker of drug resistance.In order to measure CRBN protein levels, we developed and characterized three rabbit monoclonal antibodies to CRBN including antibody CRBN65, which has the potential to discriminate between the different CRBN protein products, including CRBN-002 by western blot analysis. Additionally, we compared 8 commercially available CRBN antibodies. Western blot analysis of cell lines with commercial and newly developed antibodies identified full length protein at 51 kD. Most commercial antibodies also identified multiple bands of other sizes which may represent CRBN protein variants; however, many are likely non-specific bands as they are larger than full-length CRBN. Conclusion:We have identified novel splice variants of CRBN from MM cell lines and primary tumor samples. The structure of the isoforms and their potential ability to be translated into several protein variants of CRBN reflect the complex regulation of the CRBN gene. These data suggest that accurate quantification of CRBN mRNA level in clinical studies may require measurement of both full-length CRBN mRNA as well as other mRNA isoforms. Currently available primers and gene expression arrays are not capable of identifying and/or resolving the complex set of CRBN isoforms present in cells. These data also demonstrate that CRBN65 is a highly specific and sensitive antibody that could be used for detection of CRBN and its key variants. Taken together, our data emphasize the importance for developing standardized reagents and assays for both mRNA and protein level measurement of CRBN before using them as markers for clinical response or resistance. [Display omitted] Disclosures:Gandhi:Celgene Corp: Employment, Equity Ownership. Waldman:Celgene Corp: Employment, Equity Ownership. Thakurta:Celgene Corp: Employment, Equity Ownership. Aukerman:Celgene Corp: Employment, Equity Ownership. Chen:Celgene Corp: Employment, Equity Ownership. Mendy:Celgene Corp.: Employment, Equity Ownership. Rychak:Celgene Corp: Employment, Equity Ownership. Miller:Celgene Corp: Employment, Equity Ownership. Gaidarova:Celgene Corp: Employment, Equity Ownership. Gonzales:Celgene Corp: Employment, Equity Ownership. Cathers:Celgene Corp: Employment, Equity Ownership. Schafer:Celgene: Employment, Equity Ownership. Daniel:Celgene Corporation: Employment. Lopez-Girona:Celgene Corp: Employment, Equity Ownership. Chopra:Celgene Corp: Employment, Equity Ownership.

High Cereblon Protein Expression Correlates with Improved Response and Survival in Myeloma Patients Treated with Lenalidomide

AbstractAbstract 931 Background:Cereblon (CRBN), an adaptor protein of the Cul4A-DDB1-ROC1 ubiquitin E3 ligase complex was recently identified as a primary target of thalidomide teratogenicity and as essential requirement for IMiDs mediated cytotoxicity in multiple myeloma (MM) cells in vitro (Zhu YX et al, 2011). We have undertaken the current study to confirm the association between cereblon protein expression and the clinical response to lenalidomide. Methods:We constructed tissue microarrays (TMA) using bone marrow biopsies collected immediately prior to initiating therapy with lenalidomide. Fluorescence immunohistochemistry was performed using a polyclonal anti-CRBN antibody (HDA045910, Sigma-Aldrich) at a dilution of 1:4000, with 3 minutes of antigen retrieval at 121°C in a decloaking chamber in a pH=9 Tris/EDTA-based buffer (S2367, Dako). Tissue microarray slides were scanned on a HistoRx PM-2000 and digital images where analyzed with AQUA analysis software to determine the CRBN AQUA scores (protein expression = AQUA scores defined as the average CRBN pixel intensity within CD138 positive cells). CRBN AQUA scores where standardized on the Z-distribution (Z= X-μ/σ). The clinical parameters, response criteria and survival outcomes (PFS and OS) of these patients were defined according to the international uniform response criteria. The Kaplan-Meier method was used to estimate OS and PFS. Multivariate analysis was performed using the Cox regression method. Results:42 patients with newly diagnosed (71.4%) or relapsed / refractory (28.6%) MM patients treated with lenalidomide and dexamethasone (MM009, MM016 or MM020 trials) and available pre-treatment bone marrow biopsies were included in this analysis. In this cohort, median age was 68 (range 46–88), median Hb 114 g/L (range 77–145), median Calcium 2.35 mmol/L (range 1.62–2.82), median creatinine 91.5 μmoles/L (range 44–500), high LDH in 21.4%, median albumin 35.5 g/L (range 23–47), β2 microglobulin 4.66 mg/L (range 1.2–35.19), ISS I 19%, II 35.7% and III 45.3% and high-risk cytogenetics (del17p13, t(4;14) by FISH) in 26.6%. Response CR/nCR was observed in 13/42 (31 %), PR in 21/42 (50%), MR in 4/42 (9.5%) and PD in 4/42 (9.5%). With a median follow-up of 22.4 months (range 0.72–65.6), 28/42 (67%) progressed with mPFS 19.53 months (95% CI 8.57–30.496) and mOS 28.733 months (95% CI 24.061–33.406). Cereblon expression or AQUA normalized Z scores ranged from -1.419 to 3.895. Kaplan Meier log-rank survival analysis were generated based on CRBN normalized AQUA Z scores with the bottom (Q4) and top quartiles (Q1-3) defined as CRBN-low or CRBN-high groups respectively. PFS was significantly shorter in CRBN-low (5.633 months) versus CRBN-high (19.733 months; p= 0.008). Similarly, OS was also reduced in CRBN-low patients (11.4 versus 30.467 months; p=0.033). In univariate Cox regression analysis, cereblon protein expression was significantly associated with PFS (HR 0.322; 95% CI 0.133–0.780; p=0.012) and OS (HR 0.323; 95% CI 0.108–0.970; p=0.044). Cereblon expression remained an independent predictor of PFS (HR 0.161; p=0.01) but not for OS when ISS and cytogenetics were included in multivariate regression analysis. In the CRBN-high group only 5/31 patients (16.1%), compared to 54.5% (6/11) in the CRBN-low group, failed to respond (≤MR) to lenalidomide. Similar to the protein tissue array analysis, low CRBN mRNA was also significantly associated with shorter PFS (p=0.008) in a chip microarray analysis of CRBN expression (Affymetrix probe 222533_at) in a cohort of 32 MM patients treated with lenalidomide and dexamethasone. Cereblon protein expression (AQUA normalized Z score) significantly correlated with CRBN mRNA microarray values (Affymetrix probe 222533_at) in 17 patients with matching protein and mRNA samples (Spearman’s rho 0.417; p= 0.048). In contrast, and confirming the specificity of cereblon for response to IMiDs, no association between cereblon protein expression and response to therapy or survival outcomes (PFS/OS) was observed in a independent cohort of newly diagnosed MM patients (n=37) treated with bortezomib induction therapy and ASCT. Conclusion:Using an automated, observer-independent and fully quantitative approach, our studies confirm the association between cereblon protein expression and response to lenalidomide in MM. Disclosures:Neri:Johnson ans Johnson: Research Funding. Bahlis:Johnson and Johnson: Honoraria, Research Funding; Celgene: Honoraria.

Induction of CRBN(Cereblon) mRNA Expression by Baicalein

AbstractAbstract 5025The CRBN gene that encodes the cereblon protein is found on the short arm at position p26. 3 of human chromosome 3. Cereblon is a primary target of thalidomide teratogenicity and required for the anti-myeloma activity of lenalidomide and pomalidomide. CRBN depletion myeloma cells become highly resistant to both lenalidomide and pomalidomide. Baicalein, a component of Scutellaria radix from HLJDT, not only suppressed proliferation and induced apoptosis of myeloma cells by down-regulating interleukin −6(IL-6) and XIAP gene expression, but also inhibited the signaling cascades mediated by IL-6 and facilitated myeloma cell inhibition induced by dexamethasone. In clinic, we found that treatment of thlidomide- or lenalidomide-resistant myeloma patients by applying Huang-Lian-Jie-Du-Tang (HLJDT) can induce hematological remission. The precise molecular mechanism of HLJDT exerts its anti-tumor effects remains unclear. Here, by RT-PCR, we demonstrated that treatment of U266 cells and primary myeloma cells with 20μM baicalein can induce CRBN mRNA expression in time-dependent manner. As lenalidomide and thlidomide are effective drugs for maintenance therapy with the advantage of oral administration. It was particularly active in patients with higher cereblon expression. Thus, the combination of HLJDT with thlidomide or lenalidomide may be a novel strategy of maintenance therapy for myeloma patients. Disclosures:No relevant conflicts of interest to declare.