Cereal Yellow Dwarf virus-RPV Research Articles

First report of barley yellow dwarf virus PAS (Luteovirus pashordei) in oat in Australia.

Luteoviruses (family Tombusviridae) and poleroviruses (family Solemoviridae) are economically important pathogens of cereals such as wheat (Triticum aestivum), barley (Hordeum vulgare) and oat (Avena sativa). In Australia, the luteoviruses barley yellow dwarf virus PAV (BYDV PAV) and barley yellow dwarf virus MAV (BYDV MAV), along with the poleroviruses cereal yellow dwarf virus RPV (CYDV RPV) and maize yellow dwarf virus RMV (MYDV RMV), were distinguished from each other and reported in the 1980s (Sward and Lister 1988; Waterhouse and Helms 1985). The poleroviruses barley virus G (BVG) and cereal yellow dwarf virus RPS (CYDV RPS) were reported in Australia more recently (Nancarrow et al. 2019; Nancarrow et al. 2023), while the luteovirus barley yellow dwarf virus PAS (BYDV PAS) has not previously been reported in Australia. During 2010, an oat plant exhibiting yellow/ red leaf discoloration and stunted growth was collected from a roadside in Horsham, Victoria, Australia. The plant tested positive for BYDV PAV and negative for BYDV MAV, CYDV RPV and MYDV RMV by tissue blot immunoassay (TBIA) as described by Trębicki et al (2017). The virus isolate has since been continuously maintained in a glasshouse in live wheat plants using aphids (Rhopalosiphum padi). In 2021, total RNA extracted from a wheat plant infected with this isolate (Nancarrow et al. 2023) tested positive for BYDV PAV by RT-PCR using the primers BYDV-1/BYDV-2 (Rastgou et al. 2005), but negative for BYDV PAV, CYDV RPV and MYDV RMV using other published primers (Deb and Anderson 2008). A high-throughput sequencing (HTS) library was prepared from the total RNA with the NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB) without ribosomal RNA depletion and sequenced on a NovaSeq 6000 (Illumina). Raw reads were trimmed and filtered using fastp v0.20.0 (Chen et al. 2018) while de novo assembly of all of the resulting 5,049,052 reads was done using SPAdes v3.15.3 (Nurk et al. 2017). BLASTn analysis of the resulting 4,067 contigs (128- 12,457 bp in length) revealed only one large virus-like contig (5,649 bp) which was most similar to BYDV PAS isolates on NCBI GenBank, sharing 87% nucleotide (nt) identity with BYDV PAS isolate OH2 (MN128939), 86% nt identity with the BYDV PAS reference sequence (NC_002160) and 82% nt identity with the BYDV PAV reference sequence (NC_004750). Additionally, 4,008 HTS reads were mapped to the assembled genome sequence with Bowtie2 v2.4.5. (Langmead and Salzberg 2012) with 100% genome coverage and an average coverage depth of 101X. Primers were designed to the assembled genome sequence to generate overlapping amplicons across the genome, and the resulting amplicons were Sanger sequenced. This confirmed the genome sequence of BYDV PAS isolate PT from Australia (5649 bp, GC content 47.9%), which was deposited in GenBank (LC782749). Ten additional plant samples collected from western Victoria, Australia, all tested positive for BYDV PAS by RT-PCR using the primers PASF and PASR (Laney et al. 2018). The additional samples consisted of one oat sample collected in 2005, one barley sample collected in 2007, three wheat samples collected in 2016 and one barley, one brome grass (Bromus sp.) and three wheat samples collected in 2020. BYDV PAS is also efficiently transmitted by R. padi but is often more prevalent and severe than BYDV PAV; it can also overcome some sources of virus resistance that are effective against BYDV PAV (Chay et al. 1996, Robertson and French 2007). To our knowledge, this is the first report of BYDV PAS in Australia. Further work is needed to determine the extent of its distribution, incidence, impacts and epidemiology in Australia, along with its relationship to other BYDV PAS isolates.

Genome sequence of a polerovirus isolated from wild oat in Australia.

We present the genome sequence of a polerovirus (family Solemoviridae) isolated from wild oat (Avena fatua) in Australia. The genome sequence consists of 5,631 nucleotides and shares 87% nucleotide identity with its closest relative, cereal yellow dwarf virus RPV isolate 010 (GenBank accession number EF521830).

First report of cereal yellow dwarf virus RPS infecting wheat in Australia.

Yellow dwarf viruses (YDVs) reduce grain yield in a wide range of cereal hosts worldwide. Cereal yellow dwarf virus RPV (CYDV RPV) and cereal yellow dwarf virus RPS (CYDV RPS) are members of the Polerovirus genus within the Solemoviridae family (Scheets et al. 2020; Sõmera et al. 2021). Along with barley yellow dwarf virus PAV (BYDV PAV) and barley yellow dwarf virus MAV (BYDV MAV) (genus Luteovirus, family Tombusviridae), CYDV RPV is found worldwide and has mostly been identified as being present in Australia based on serological detection (Waterhouse and Helms 1985; Sward and Lister 1988). However, CYDV RPS has not previously been reported in Australia. In October 2020, a plant sample (226W) was collected from a volunteer wheat (Triticum aestivum) plant located near Douglas, Victoria, Australia that displayed yellow-reddish leaf symptoms typical of YDV infection. The sample tested positive for CYDV RPV and negative for BYDV PAV and BYDV MAV by tissue blot immunoassay (TBIA) (Trębicki et al. 2017). Given that CYDV RPV and CYDV RPS can both be detected using serological tests for CYDV RPV (Miller et al. 2002), total RNA was extracted from stored leaf tissue of plant sample 226W for further testing using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) with modified lysis buffer (Constable et al. 2007; MacKenzie et al. 1997). The sample was then tested by RT-PCR using three sets of primers that were designed to detect CYDV RPS, targeting three distinct overlapping regions (each approximately 750 bp in length) of the 5' end of the genome where CYDV RPV and CYDV RPS differ most (Miller et al. 2002). The primers CYDV RPS1L (GAGGAATCCAGATTCGCAGCTT)/ CYDV RPS1R (GCGTACCAAAAGTCCACCTCAA) targeted the P0 gene, while CYDV RPS2L (TTCGAACTGCGCGTATTGTTTG)/ CYDV RPS2R (TACTTGGGAGAGGTTAGTCCGG) and CYDV RPS3L (GGTAAGACTCTGCTTGGCGTAC)/ CYDV RPS3R (TGAGGGGAGAGTTTTCCAACCT) targeted two different regions of the RdRp gene. Sample 226W tested positive using all three sets of primers and the amplicons were directly sequenced. NCBI BLASTn and BLASTx analyses showed that the CYDV RPS1 amplicon (Accession No. OQ417707) shared 97% nucleotide (nt) identity and 98% amino acid (aa) identity similarity with the CYDV RPS isolate SW (Accession No. LC589964) from South Korea, while the CYDV RPS2 amplicon (Accession No. OQ417708) shared 96% nt identity and 98% aa identity similarity with the same CYDV RPS isolate SW. The CYDV RPS3 amplicon (Accession No. OQ417709) shared 96% nt identity and 97% aa identity similarity with the CYDV RPS isolate Olustvere1-O (Accession No. MK012664) from Estonia, confirming that isolate 226W is CYDV RPS. In addition, total RNA extracted from 13 plant samples that had previously tested positive for CYDV RPV by TBIA were tested for CYDV RPS using the primers CYDV RPS1 L/R and CYDV RPS3 L/R. The additional samples, consisting of wheat (n=8), wild oat (Avena fatua, n=3) and brome grass (Bromus sp., n=2), were collected at the same time as sample 226W from seven fields within the same region. Five of the wheat samples were collected from the same field as sample 226W, one of which tested positive for CYDV RPS while the remaining 12 samples were negative. To the best of our knowledge, this is the first report of CYDV RPS in Australia. It is not known if CYDV RPS is a recent introduction to Australia, and its incidence and distribution in cereals and grasses in Australia, while currently unknown, is being investigated.

First report of barley virus G infecting winter barley (Hordeum vulgare L.) in France.

As part of a cereals virome project high throughput sequencing (HTS)-based viral indexing was performed on plants with symptoms of barley yellow dwarf disease collected in June (2017-2020) in the main French cereals production areas. Total RNAs from 32 individual plants were purified (RNeasy Plant Mini Kit, Qiagen, Courtaboeuf, France) and Illumina sequenced (2x150 nt) following ribodepletion (Genewiz-Azenta, Leipzig, Germany). Following quality trimming, reads for each sample were de novo assembled (CLC Genomics Workbench 21, Qiagen) [1] and contigs annotated by BlastX analysis. In four winter barley samples collected in 2018 (18-58, 18-325 and 18-326) and 2019 (19-30A), besides contigs representing diverse viruses such as barley yellow dwarf viruses-PAV and PAS, Hordeum vulgare endornavirus, cereal yellow dwarf virus-RPV (18-326), wheat dwarf virus (18-325 and 18-326) and a novel Polerovirus (18-58 and 18-326), large contigs with high identity to barley virus G (BVG) were identified. BVG, a tentative Polerovirus, was initially reported in barley in South Korea in 2016 [2] and has so far been identified in a few other hosts including wheat, oat, maize, proso and foxtail millets as well as switchgrass. It has been reported from the USA and Australia [3] and, in Europe, from the Netherlands, Germany, Hungary and Greece [4]. Large BVG scaffolds representing near complete genomes could be reconstructed for each sample, integrating a total of 128.339, 7.188, 8.078 and 20.073 reads, for samples 19-30A, 18-58, 18325 and 18-326 respectively. Given that between 17.2 and 20.5 million reads had been obtained per sample, these values translate into between 0.04% (18-58 and 18-325) and 0.6% (19-30A) of total reads, and to average coverages of between 158x (18-58) and 2866x (19-30A) for the genomic scaffolds. The four assembled sequences (5584-5610 nt) have been deposited in GenBank (ON419453-ON419456). They are nearly identical (98.4 to 99.5% nt identity) and share between 97.7% and 98.5% nt identity with a barley reference isolate from the South Korea (NC_029906). To confirm the presence of BVG, a primer pair was designed based on available BVG sequences. Primers BVG-F(5'-CTAGCCCAACGAGTTGCGGG-3') and BVG-R(5'-GGTACAGAAGCTCTACGGTTC-3') amplifying a 394 nt were used in a two-step RT-PCR on new RNA extracts obtained from the 18-325 and 18-326 infected plants. The amplicons were directly sequenced and showed respectively 99.2% (ON419457, 18-325) and 100% (18-326) nt identity with the corresponding de novo scaffolds. The four analyzed samples have been collected respectively in 2018 (18-58, 18-325, 18-326) and 2019 (19-30A) in three different regions of France (Auvergne-Rhône-Alpes, Occitanie and Centre-Val de Loire), indicating a wide distribution and a persistence over time of BVG in France. To our knowledge, this represents the first report of a natural infection of BVG in cultivated winter barley in France. Presence of BVG may have been overlooked in a range of situation, as indicated by its retrospective discovery in a 34 years old Australian sample [3], possibly explaining its broad distribution in France. While the mixed infection status of the analyzed plants precludes any conclusion on its pathogenicity in French cereals, BVG has been reported to be associated with a range of symptoms in various hosts so that further studies to evaluate its prevalence and impact in France and to begin to understand its epidemiology are clearly warranted by the present results.

Identification of two novel putative satellite RNAs with hammerhead structures in the virome of French and Spanish carrot samples.

Carrot virome analysis using high-throughput sequencing revealed the presence of two RNA molecules with properties of satellite RNAs that are homologous to the satellite RNA of cereal yellow dwarf virus-RPV (CYDV-RPV). Satellite 1 is 298nt long, while satellite 2 is 368nt long. Their positive and negative genome strands contain hammerhead ribozymes similar to those found in other self-cleaving satellite RNAs. While both satellites were detected in Spanish carrot populations, only satellite 2 was found in French carrot populations. The most likely helper virus for these two satellites is carrot red leaf virus (CtRLV), which, like CYDV-RPV, is a polerovirus.

Complete genome sequence of a novel wheat-infecting polerovirus associated with yellowing dwarf disease in China.

A novel wheat-infecting polerovirus, tentatively named "wheat yellow dwarf virus" (WYDV), was identified from winter wheat in China using transcriptome sequencing (RNA-seq) combined with RT-PCR and RACE amplification. WYDV has a single-stranded RNA genome of 5,650 nucleotides (nt) and contains seven putative open reading frames (ORFs). WYDV was found to share the highest sequence identity with cereal yellow dwarf virus RPV (CYDV-RPV, genus Polerovirus), 71.1% for the nucleotide sequence of the whole genome, and 77.3% and 70.0% for the amino acid sequences of the coat protein (CP) and RNA-dependent RNA polymerase protein (RdRp), respectively. Phylogenetic analysis based on the complete genome and CP and RdRp amino acid sequences showed that WYDV is most closely related to the cereal-infecting poleroviruses CYDV-RPV, CYDV-RPS, and barley yellow dwarf virus-GPV. These data suggest that WYDV, which is associated with a newly emerging yellow dwarf disease in wheat fields in central China, should be classified as a new member of the genus Polerovirus.

Cereal yellow dwarf virus-RPV

This datasheet on Cereal yellow dwarf virus-RPV covers Identity, Hosts/Species Affected, Further Information.

First Report of Barley virus G in the United States and California.

Barley (Hordeum vulgare) is a valuable annual cereal crop grown widely throughout the United States and the world. The majority of barley grown commercially in California and throughout the U.S. is used for livestock feed, with the remainder being used by the malting industry and, to a lesser extent, direct food consumption; it is also often employed as a cover crop (Lazicki et al. 2016). Yellow dwarf viruses (YDVs), in the family Luteoviridae, that infect barley and other cereal crops are common and widely distributed throughout California and the U.S. (Griesbach et al. 1989; Seabloom et al. 2009). In April 2018, five barley samples exhibiting typical symptoms of YDV infection (primarily yellowing of leaf margins and tips) collected from fields in Yolo county planted with cultivar Butta 12 , were tested for viruses. Total RNA was extracted from leaf tissue using Trizol reagent, according to the manufacturer's protocol. RNA was used as template in a multiplexed RT-PCR assay designed for the generic detection of barley and cereal infecting YDVs, using the protocol established by Malmstrom and Shu (2004). A 372 basepair amplicon indicative of Polerovirus infection was amplified from two of the samples and sequenced (Quintara Biosciences), and the resulting data analyzed via a BLASTn search. No further testing or work was done with the three samples that tested negative. Not unexpectedly, the top result returned for one of the positive samples was Cereal yellow dwarf virus-RPV (CYDV-RPV; 98% identity), a virus common to cereals in California and the U.S.. Unexpectedly, however, the top result returned for the other sample was Barley virus G (BVG), sharing 98.43% identity with the Uiseong BVG isolate (GenBank accession LC259081). To further confirm the presence of BVG in the sample, the full-length viral genome was amplified using two-step RT-PCR with primers targeting the extreme 5' and 3' ends of the viral genome, using the PrimeScript RT and PrimeSTAR GXL DNA Polymerase kits (Takara Bio), cloned into the binary vector pJL89 and a BLAST search of the resulting 5621 nucleotide full-length sequence (100% query coverage) once again returned results showing the YDV to be BVG. The full-length sequence was deposited into GenBank (MW853785). Nucleotide sequence comparisons showed that the CA BVG isolate shares 96.62%, 96.57%, and 96.02% identity with the sequences of the BVG-Gimje (KT962089), BVG-Uiseong (LC259081), and BVG-Aus8 (LC500836) isolates, respectively. To our knowledge, this is the first report of barley virus G in California and in the United states. Currently the prevalence, host range and mode and timing of introduction of BVG in California and the U.S. are unknown; its impact on cereal production and yield in any location in which it has been identified thus far is also unknown and may warrant further investigation.

Reservoirs of plant virus disease: Occurrence of wheat dwarf virus and barley/cereal yellow dwarf viruses in Sweden

AbstractNon‐crop plants such as grasses and volunteer plants are an inseparable part of the flora of crop fields and can influence virus incidence in crop plants. The presence of grasses as virus reservoirs can lead to a higher probability of virus incidence in crop plants. However, the role of reservoirs as an inoculum source in agricultural fields has not been well studied for many viral diseases of crops. Grasses have been found to constitute potential reservoirs for cereal‐infecting viruses in different parts of the world. This study revealed that cereal‐infecting viruses such as wheat dwarf virus (WDV), barley yellow dwarf viruses (BYDVs), and cereal yellow dwarf virus‐RPV (CYDV‐RPV) can be found among ryegrass growing in or around winter wheat fields. Phylogenetic analysis showed that a WDV isolate from ryegrass was a typical WDV‐E isolate that infects wheat. Similarly, a ryegrass isolate of barley yellow dwarf virus‐PAV (BYDV‐PAV) grouped in a clade together with other BYDV‐PAV isolates. Inoculation experiments under greenhouse conditions confirmed that annual ryegrass of various genotypes can be infected with WDV to a very low titre. Moreover, leafhoppers were able to acquire WDV from infected ryegrass plants, despite the low titre, and transmit the virus to wheat, resulting in symptoms. Information from the grass reservoir may contribute to improving strategies for controlling plant virus outbreaks in the field. Knowledge of the likely levels of virus in potential reservoir plants can be used to inform decisions on insect vector control strategies and may help to prevent virus disease outbreaks in the future.

Molecular Characterization of Cereal Yellow Dwarf Virus-RPV in Grasses in European Part of Turkey

Abstract Yellow dwarf viruses (YDVs) are economically destructive viral diseases of cereal crops, which cause the reduction of yield and quality of grains. Cereal yellow dwarf virus-RPV (CYDV-RPV) is one of the most serious virus species of YDVs. These virus diseases cause epidemics in cereal fields in some periods of the year in Turkey depending on potential reservoir natural hosts that play a significant role in epidemiology. This study was conducted to investigate the presence and prevalence of CYDV-RPV in grasses and volunteer cereal host plants including 33 species from Poaceae, Asteraceae, Juncaceae, Geraniaceae, Cyperaceae, and Rubiaceae families in the Trakya region of Turkey. A total of 584 symptomatic grass and volunteer cereal leaf samples exhibiting yellowing, reddening, irregular necrotic patches and dwarfing symptoms were collected from Trakya and tested by ELISA and RT-PCR methods. The screening tests showed that 55 out of 584 grass samples were infected with CYDV-RPV in grasses from the Poaceae family, while none of the other families had no infection. The incidence of CYDV-RPV was detected at a rate of 9.42%. Transmission experiments using the aphid species Rhopalosiphum padi L. showed that CYDV-RPV was transmitted persistently from symptomatic intact grasses such as Avena sterilis, Lolium perenne and Phleum exratum to barley cv. Barbaros seedlings. PCR products of five Turkish RPV grass isolates were sequenced and compared with eleven known CYDV-RPV isolates in the GenBank⁄ EMBL databases. Compared nucleotide and amino acid sequences of CYDV-RPV isolates showed that the identities ranged from 40.38 − 95.86 % to 14.04 − 93.38%, respectively. In this study, 19 grass species from the Poaceae family and two volunteer cereal host plants were determined as natural reservoir hosts of CYDV-RPV in the cereal growing areas of Turkey.

Occurrence and molecular characterization of wheat streak mosaic virus in wheat in Serbia

The wheat streak mosaic virus (WSMV), vectored by the wheat curl mite, is globally distributed and threatens wheat production worldwide. Since its first occurrence in Serbia in the 1960s, WSMV presence has not been monitored. In 2019, a total of 62 samples of fi ve wheat cultivars from eight locations in Serbia were collected and tested for the presence of nine common wheat viruses: WSMV, barley yellow dwarf virus-PAV, -MAV, -SGV, and -RMV, cereal yellow dwarf virus-RPV, wheat spindle streak virus, brome mosaic virus, and soil-borne wheat mosaic virus, using individual or multiplex RT-PCR. WSMV was detected in 58.1% of the tested samples in seven wheat crops at five different locations. Species-specific primers failed to detect the presence of the other eight tested viruses. For further confirmation of WSMV, RT-PCR with the WS8166F/WS8909R primers covering the coat protein (CP) gene was carried out for both amplification and sequencing. The amplified product of the correct predicted size (750 bp) derived from four selected isolates, 98-19, 99-19, 102-19 and 120-19, was sequenced and deposited in GenBank (MT461299, MT461300, MT461301 and MT461302, respectively). Serbian WSMV isolates showed very high nucleotide identity (98.16-99.02%) and shared a deletion of triplet codon GCA at nucleotide position 8412- 8414 resulting in deletion of glycine amino acid (Gly2761). Phylogenetic analysis conducted on CP gene sequences revealed the existence of four clades, named A, B, C and D, and one recently introduced clade B1. All Serbian wheat WSMV isolates grouped into clade B together with other European isolates and one isolate from Iran. The results of this study provide the first insight into molecular characterisation of Serbian WSMV isolates, indicating their close relationship with other European isolates and existence of a single genotype in the country. Phylogenetic analysis also confirms the dispersal of WSMV isolates throughout Europe from a single locus.

Identification of Barley Yellow Dwarf Viruses in Poland

Barley yellow dwarf (BYD) is the most important and widespread viral disease of cereal crops, and is caused by a group of related spherical viruses belonging to the family Luteoviridae. In the spring of 2015, BYD symptoms were observed on several winter barley (Hordeum vulgare L.), triticale (Triticosecale Wittm. ex A. Camus), rye (Secale cereale L.), and wheat (Triticum aestivum L.) plants throughout Poland. Infections were confirmed with an enzyme-linked immunosorbent assay involving polyclonal antibodies raised against Barley yellow dwarf virus (BYDV)-MAV and BYDV-PAV. Reverse transcription polymerase chain reaction diagnostic assays were conducted on a subset of 35 samples collected from 11 provinces of Poland. The primer sets targeted the open reading frame-3 fragments of BYDV-GAV, -MAV, -PAV, -PAS, -RMV, and -SGV as well as Cereal yellow dwarf virusRPV species. The specificity of obtained products were verified by sequencing. Molecular analyses revealed the predominance of co-infections with BYDV-MAV and BYDV-PAV, and the presence of other viral species that induced BYD symptoms. A comparative analysis of coat protein gene sequences indicated that some Polish isolates were highly similar (i.e., 99% identity) to Chinese BYDV-GAV, Czech BYDV-PAS, and Jordanian and Turkish BYDV-SGV isolates, thus confirming that these isolates are BYDV-GAV, -PAS, or -SGV species. To the best of my knowledge, this is the first report describing BYDV-GAV, BYDVPAS, and BYDV-SGV infections in Poland.

Coordination of Diagnostic Efforts in the Great Plains: Wheat Virus Survey and Modeling of Disease Onset.

Following the discovery of two new wheat virus diseases in the United States, the Great Plains region (Colorado, Kansas, Montana, Nebraska, North Dakota, Oklahoma, South Dakota, Texas, and Wyoming) of the National Plant Diagnostic Network (NPDN) initiated a project to measure the prevalence of five wheat diseases using indirect ELISA. Wheat streak mosaic virus (WSMV), Wheat mosaic virus (WMoV), and Triticum mosaic virus (TriMV) were found in all nine states. WSMV was the most prevalent, averaging 23 to 47% of samples each year. TriMV and WMoV were detected with WSMV (in up to 76% of the samples). All three mite-transmitted viruses were present in 26% or fewer of the samples. Aphid-transmitted viruses in the barley yellow dwarf complex Barley yellow dwarf virus, and Cereal yellow dwarf virus-RPV were less frequent (fewer than 65% of the samples). This paper presents the first case-control methodology paper using plant diagnostic laboratory data and the first signed diagnostic data-sharing agreement between the NPDN and its regulatory stakeholders. Samples collected when <700 cumulative degree-days base 0°C, were twice as likely to be virus negative. This proof-of-concept effort highlights the potential of the NPDN and its National Data Repository to develop knowledge about emerging diseases.

Occurrence of Viruses and Associated Grain Yields of Paired Symptomatic and Nonsymptomatic Tillers in Kansas Winter Wheat Fields.

Vector-borne virus diseases of wheat are recurrent in nature and pose significant threats to crop production worldwide. In the spring of 2011 and 2012, a state-wide sampling survey of multiple commercial field sites and university-managed Kansas Agricultural Experiment Station variety performance trial locations spanning all nine crop-reporting regions of the state was conducted to determine the occurrence of Barley yellow dwarf virus-PAV (BYDV-PAV), Cereal yellow dwarf virus-RPV, Wheat streak mosaic virus (WSMV), High plains virus, Soilborne wheat mosaic virus, and Wheat spindle streak mosaic virus using enzyme-linked immunosorbent assays (ELISA). As a means of directly coupling tiller infection status with tiller grain yield, multiple pairs of symptomatic and nonsymptomatic plants were selected and individual tillers were tagged for virus species and grain yield determination at the variety performance trial locations. BYDV-PAV and WSMV were the two most prevalent species across the state, often co-occurring within location. Of those BYDV-PAV- or WSMV-positive tillers, 22% and 19%, respectively, were nonsymptomatic, a finding that underscores the importance of sampling criteria to more accurately assess virus occurrence in winter wheat fields. Symptomatic tillers that tested positive for BYDV-PAV produced significantly lower grain yields compared with ELISA-negative tillers in both seasons, as did WSMV-positive tillers in 2012. Nonsymptomatic tillers that tested positive for either of the two viruses in 2011 produced significantly lower grain yields than tillers from nonsymptomatic, ELISA-negative plants, an indication that these tillers were physiologically compromised in the absence of virus-associated symptoms. Overall, the virus survey and tagged paired-tiller sampling strategy revealed effects of virus infection on grain yield of individual tillers of plants grown under field conditions and may provide a complementary approach toward future estimates of the impact of virus incidence on crop health in Kansas.

Differential Impacts of Virus Diversity on Biomass Production of a Native and an Exotic Grass Host.

Pathogens are common and diverse in natural communities and have been implicated in the success of host invasions. Yet few studies have experimentally measured how pathogens impact native versus exotic hosts, particularly when individual hosts are simultaneously coinfected by diverse pathogens. To estimate effects of interactions among multiple pathogens within host individuals on both transmission of pathogens and fitness consequences for hosts, we conducted a greenhouse experiment using California grassland species: the native perennial grass Nassella (Stipa) pulchra, the exotic annual grass Bromus hordeaceus, and three virus species, Barley yellow dwarf virus-PAV, Barley yellow dwarf virus-MAV, and Cereal yellow dwarf virus-RPV. In terms of virus transmission, the native host was less susceptible than the exotic host to MAV. Coinfection of PAV and MAV did not occur in any of the 157 co-inoculated native host plants. In the exotic host, PAV infection most strongly reduced root and shoot biomass, and coinfections that included PAV severely reduced biomass. Infection with single or multiple viruses did not affect biomass in the native host. However, in this species the most potentially pathogenic coinfections (PAV + MAV and PAV + MAV + RPV) did not occur. Together, these results suggest that interactions among multiple pathogens can have important consequences for host health, which may not be predictable from interactions between hosts and individual pathogens. This work addresses a key empirical gap in understanding the impact of multiple generalist pathogens on competing host species, with potential implications for population and community dynamics of native and exotic species. It also demonstrates how pathogens with relatively mild impacts independently can more substantially reduce host performance in coinfection.

Mild and severe cereal yellow dwarf viruses differ in silencing suppressor efficiency of the P0 protein

Viral pathogenicity has often been correlated to the expression of the viral encoded-RNA silencing suppressor protein (SSP). The silencing suppressor activity of the P0 protein encoded by cereal yellow dwarf virus-RPV (CYDV-RPV) and -RPS (CYDV-RPS), two poleroviruses differing in their symptomatology was investigated. CYDV-RPV displays milder symptoms in oat and wheat whereas CYDV-RPS is responsible for more severe disease. We showed that both P0 proteins (P0CY-RPV and P0CY-RPS) were able to suppress local RNA silencing induced by either sense or inverted repeat transgenes in an Agrobacterium tumefaciens-mediated expression assay in Nicotiana benthamiana. P0CY-RPS displayed slightly higher activity. Systemic spread of the silencing signal was not impaired. Analysis of short-interfering RNA (siRNA) abundance revealed that accumulation of primary siRNA was not affected, but secondary siRNA levels were reduced by both CYDV P0 proteins, suggesting that they act downstream of siRNA production. Correlated with this finding we showed that both P0 proteins partially destabilized ARGONAUTE1. Finally both P0CY-RPV and P0CY-RPS interacted in yeast cells with ASK2, a component of an E3-ubiquitin ligase, with distinct affinities.

Environmental nutrient supply alters prevalence and weakens competitive interactions among coinfecting viruses.

The rates and ratios of environmental nutrient supplies can determine plant community composition. However, the effect of nutrient supplies on within-host microbial interactions is poorly understood. Resource competition is a promising theory for understanding microbial interactions, because microparasites require nitrogen (N) and phosphorus (P) for synthesis of macromolecules such as nucleic acids and proteins. To better understand the effects of nutrient supplies to hosts on pathogen interactions, we singly inoculated and coinoculated Avena sativa with two virus species, barley yellow dwarf virus-PAV (BYDV-PAV) and cereal yellow dwarf virus-RPV (CYDV-RPV). Host plants were grown across a factorial combination of N and P supply rates that created a gradient of N:P supply ratios, one being replicated at low and high nutrient supply. Nutrient supply affected prevalence and the interaction strength among viruses. P addition lowered CYDV-RPV prevalence. The two viruses had a distinct competitive hierarchy: the coinoculation of BYDV-PAV lowered CYDV-RPV infection rate, but the reverse was not true. This antagonistic interaction occurred at low nutrient supply rates and disappeared at high N supply rate. Given the global scale of human alterations of N and P cycles, these results suggest that elevated nutrient supply will increase risks of virus coinfection with likely effects on virus epidemiology, virulence and evolution.

Evidence for lysine acetylation in the coat protein of a polerovirus.

Virions of the RPV strain of Cereal yellow dwarf virus-RPV were purified from infected oat tissue and analysed by MS. Two conserved residues, K147 and K181, in the virus coat protein, were confidently identified to contain epsilon-N-acetyl groups. While no functional data are available for K147, K181 lies within an interfacial region critical for virion assembly and stability. The signature immonium ion at m/z 126.0919 demonstrated the presence of N-acetyllysine, and the sequence fragment ions enabled an unambiguous assignment of the epsilon-N-acetyl modification on K181. We hypothesize that selection favours acetylation of K181 in a fraction of coat protein monomers to stabilize the capsid by promoting intermonomer salt bridge formation.

Modification of Non-Vector Aphid Feeding Behavior on Virus-Infected Host Plant

Virus-infected host plants can have positive, neutral or negative effects on vector aphids. Even though the proportion of non-vector aphids associated with a plant far exceeds that of vector species, little is known about the effect of virus-infected plants on non-vector aphids. In the present study, the English grain aphid Sitobion avenae (Fabricius) (Hemiptera: Aphididae), a non-vector of Wheat dwarf virus (WDV) and Cereal yellow dwarf virus-RPV (CYDV-RPV), was monitored on, virus-infected, virus-free and leafhopper/aphid-infested, and virus- and insect-free (control) barley, Hordeum vulgare L. (Poales: Poaceae), plants. Electrical penetration graph recordings were performed. Compared with the control plants, S. avenae on infected plants exhibited reduced non-probing and pathway phase, and increased phloem sap ingestion phase, and more aphids reached sustained phloem ingestion. However, the electrical penetration graph parameters described above showed no significant differences in aphid feeding behavior on virus-free and vector pre-infested plants and the control barley plants during S. avenae feeding. The results suggest that WDV/CYDV-RPV-infected host plants positively affected the feeding behavior of the non-vector aphid S. avenae. Based on these results, the reasons and trends among the virus-infected host plants' effects on the feeding behavior of non-vector aphids are discussed.

Species Composition of Aphid Vectors (Hemiptera: Aphididae) of Barley Yellow Dwarf Virus and Cereal Yellow Dwarf Virus in Alabama and Western Florida

Yellow dwarf is a major disease problem of wheat, Triticum aestivum L., in Alabama and is estimated to cause yield loss of 21-42 bu/acre. The disease is caused by a complex of viruses comprising several virus species, including Barley yellow dwarf virus-PAV and Cereal yellow dwarf virus-RPV. Several other strains have not yet been classified into a specific species. The viruses are transmitted exclusively by aphids (Hemiptera:Aphididae). Between the 2005 and 2008 winter wheat seasons, aphids were surveyed in the beginning of each planting season in several wheat plots in Alabama and western Florida Collected aphids were identified and bioassayed for their yellow dwarf virus infectivity. This survey program was designed to identify the aphid species that serve as fall vectors of yellow dwarf virus into winter wheat plantings. From 2005 to 2008, bird cherry-oat aphid, Rhopalosiphum padi (L.); rice root aphid, Rhopalosiphum rufiabdominale (Sasaki); and greenbug, Schizaphis graminum (Rondani), were found consistently between October and December. The species of aphids and their timing of appearance in wheat plots were consistent with flight data collected in North Alabama between 1996 and 1999. Both R. padi and R. rufiabdominale were found to carry and transmit Barley yellow dwarf virus-PAV and Cereal yellow dwarf virus-RPV. The number of collected aphids and proportion of viruliferous aphids were low. Although this study has shown that both aphids are involved with introduction of yellow dwarf virus to winter wheat in Alabama and western Florida, no conclusions can be made as to which species may be the most important vector of yellow dwarf virus in the region.