CDKN2B Research Articles

Functional analyses of coronary artery disease associated variation on chromosome 9p21 in vascular smooth muscle cells

Variation on chromosome 9p21 is associated with risk of coronary artery disease (CAD). This genomic region contains the CDKN2A and CDKN2B genes which encode the cell cycle regulators p16(INK4a), p14(ARF) and p15(INK4b) and the ANRIL gene which encodes a non-coding RNA. Vascular smooth muscle cell (VSMC) proliferation plays an important role in the pathogenesis of atherosclerosis which causes CAD. We ascertained whether 9p21 genotype had an influence on CDKN2A/CDKN2B/ANRIL expression levels in VSMCs, VSMC proliferation and VSMC content in atherosclerotic plaques. Immunohistochemical examination showed that VSMCs in atherosclerotic lesions expressed p16(INK4a), p14(ARF) and p15(INK4b). Analyses of primary cultures of VSMCs showed that the 9p21 risk genotype was associated with reduced expression of p16(INK4a), p15(INK4b) and ANRIL (P = 1.2 × 10(-5), 1.4 × 10(-2) and 3.1 × 10(-9)) and with increased VSMC proliferation (P = 1.6 × 10(-2)). Immunohistochemical analyses of atherosclerotic plaques revealed an association of the risk genotype with reduced p15(INK4b) levels in VSMCs (P = 3.7 × 10(-2)) and higher VSMC content (P = 5.6 × 10(-4)) in plaques. The results of this study indicate that the 9p21 variation has an impact on CDKN2A and CDKN2B expression in VSMCs and influences VMSC proliferation, which likely represents an important mechanism for the association between this genetic locus and susceptibility to CAD.

Several mechanisms lead to the inactivation of the CDKN2A (P16), P14ARF, or CDKN2B (P15) genes in the GCB and ABC molecular DLBCL subtypes

Diffuse large B-cell lymphoma (DLBCL) represents the most frequent type of aggressive lymphoma. Deletions of the CDKN2A locus, encoding the proteins CDKN2A (P16), P14ARF, and of the CDKN2B locus, encoding the protein CDKN2B (P15), affect one-third of DLBCL patients. Although other mechanisms that decrease gene expression have been reported, such as promoter methylation, the prognostic value of these mechanisms is still unclear. We studied the deletion and methylation status of these genes in 171 patients and correlated the genomic results with their mRNA expression level and clinical outcome. CDKN2A, P14ARF, and CDKN2B deletions were significantly correlated with decreased mRNA expression (P<0.0001, P<0.0001, and P=0.0148, respectively). P14ARF was methylated in only two patients (1.3%), whereas CDKN2A and CDKN2B were methylated in 36.7 and 31.4% of patients, respectively. Methylation levels greater than 25% were associated with decreased expression of CDKN2A (P=0.0169). CDKN2A and CDKN2B inactivation by deletion or methylation was observed in 42.7 and 37.4% of cases, respectively. Including P14ARF deletions, we identified an inactivating mechanism for at least one of these genes in 47% of patients. Although gene inactivation was not correlated with the international prognostic index, P14ARF and CDKN2B inactivation was significantly associated with shorter survival (P=0.0048 and P=0.0413, respectively), whereas CDKN2A was not (P=0.085). Low mRNA expression levels of these genes were correlated with the ABC phenotype. Furthermore, our results show that an inactivating methylation was more frequent in the GCB phenotype.

Glaucoma Risk Alleles at CDKN2B-AS1 Are Associated with Lower Intraocular Pressure, Normal-Tension Glaucoma, and Advanced Glaucoma

Genetic variation at the 9p21 locus encompassing the CDKN2B-AS1, CDKN2A, and CDKN2B genes has been associated with primary open-angle glaucoma (POAG) in several independent studies. This study aimed to dissect the association further and to determine genotype-phenotype correlations between genetic variation at this locus and a range of glaucoma-related traits in a large cohort of POAG patients. Comparative case series and case-control study. One thousand four hundred thirty-two POAG patients and 595 unaffected controls recruited from 2 population-based and 2 cross-sectional studies. Each patient was genotyped at 9 single nucleotide polymorphisms (SNPs) previously associated with POAG at the 9p21 locus. Each SNP was assessed for association with each outcome measure using linear regression under an additive genetic model. Associated traits were explored further including adjustment for relevant covariates. Highest recorded intraocular pressure (IOP) also was analyzed both with and without correction for central corneal thickness (CCT) and was dichotomized into high-tension glaucoma and normal-tension glaucoma (NTG). Intraocular pressure and vertical cup-to-disc ratio (VCDR). Glaucoma risk alleles at 9p21, particularly, rs7049105 and rs10120688, were associated with the presence of both NTG and advanced POAG. The SNP rs10120688 was associated with greater VCDR after adjustment for covariates (P = 0.003; β = 0.016; standard error, 0.006). In addition, multiple SNPs in the region were associated with reduced IOP, before and after adjustment for CCT. The SNP most significantly associated with IOP was also rs10120688 (P = 0.001; β = -2.135; standard error, 0.634) after adjustment for covariates under an additive model. In a comparison of high-tension versus low-tension glaucoma, this SNP was also the most significantly associated, particularly when IOP was corrected for CCT before classification of the type of glaucoma (P = 0.0009; odds ratio, 0.63; 95% confidence interval, 0.48-0.83). Patients with POAG carrying the glaucoma risk alleles at the 9p21 locus have larger VCDR and lower IOP than POAG patients without these alleles. Carriers of these alleles seem to be predisposed to POAG developing at lower IOP levels and exhibit stronger associations with NTG and advanced glaucoma phenotypes. This may be of relevance when setting target pressures in patients carrying these risk alleles.

Abstract 1250: Crosstalk between Notch and MAPK signaling regulates proliferation in papillary thyroid cancer

Abstract Background: RET/PTC, RAS and BRAF are present in about two thirds of papillary thyroid carcinomas (PTC), activating constitutively the mitogen activated protein kinase (MAPK) signaling pathway. There is practically no overlap between RET/PTC, RAS and BRAF mutations in PTC, the lack of concordance for these mutations provides compelling genetic evidence for the requirement of this signaling system for transformation to PTC. However, the effect of these genetic alterations in other signaling pathways remains unclear, which could, at least in part, cooperates in transformation. Recently, Notch signaling has been implicated in tumorigenesis in other cancer types. In this study, we test the hypothesis that RET/PTC and BRAFT1799A oncogenes crosstalks and regulates Notch pathway. Methods: TPC-1 and BCPAP (human PTC cells harboring RET/PTC1 rearrangement and BRAFT1799A mutation, respectively) were treated with gamma secretase inhibitor (GSI) and proliferation was analyzed by MTT assay and growth curve; cell cycle and apoptosis were analyzed by flow cytometry. PCCL3 cells harboring Doxycycline-inducible RET/PTC3 and BRAFT1799A (PC-BRAF) were used to analyze protein and gene expression by Western blotting and real-time PCR, respectively. Notch1 protein expression was analyzed in transgenic mice (Tg-BRAF) which harbor targeted expression of BRAFT1799A restricted to thyroid gland. Results: PTC cells treated with GSI decreased the percentage of viable cell in a dose-dependent manner and reduced the growth rate. Cell cycle analysis in PTC cells showed enhancement of DNA fragmentation and increased apoptotic cells. Furthermore, the GSI treatment in PTC cells modulates cell cycle related genes, increasing CDKN1A and CDKN1B gene expression and reducing CCND1, MCM6, CKS2, and MADL2 expression. Conditional activation of RET/PTC3 and BRAFT1799A in PTC3-5 and PC-BRAF cells, respectively, showed a sustained enhancement in pERK protein expression, increased Notch1 protein and gene expression and Hes1 gene expression, the target gene of Notch signaling. Furthermore, transgenic mice Tg-BRAF showed a stronger stain for Notch1 in follicular and stromal cells. Treating PTC cells with MEK inhibitors, U0126 or PD96059, reduces NOTCH1 and HES1 gene expression. The combination of GSI with MEK inhibitor enhances the growth suppression promote by MAPK signaling inhibition in PTC cell proliferation. CONCLUSION: Taken together, targeting Notch signaling resulted in anti-proliferative effect, suggesting an important role of Notch signaling in tumorigenesis of MAPK-induced PTC and our results indentify Notch signaling as a potential therapeutic target in thyroid cancer. Citation Format: {Authors}. {Abstract title} [abstract]. In: Proceedings of the 103rd Annual Meeting of the American Association for Cancer Research; 2012 Mar 31-Apr 4; Chicago, IL. Philadelphia (PA): AACR; Cancer Res 2012;72(8 Suppl):Abstract nr 1250. doi:1538-7445.AM2012-1250

Novel mutations in MEN1, CDKN1B and AIP genes in patients with multiple endocrine neoplasia type 1 syndrome in Spain

Multiple endocrine neoplasia type 1 (MEN1) is a rare autosomal dominant disorder mostly owing to a genetic defect in MEN1 gene. Not all patients with MEN1 phenotype present a defect in this gene. Thus, other genes like CDKN and AIP have been showed to be involved in MEN1-like patients. The aim of this study was to perform a genetic screening in our cohort or patients with suspected MEN1 syndrome by direct sequencing analysis of MEN1, CDKN1B and AIP, and dosage analysis of MEN1 and AIP. A total of 79 different sporadic and familial cases with the MEN1 phenotype have been studied, in which 34 of them (48%) present a mutation in MEN1 gene. In two patients without a detectable mutation in MEN1 gene, we have identified a novel missense mutation (c.163G>A/p.Ala55Thr) in CDKN1B gene and a novel frameshift mutation (c.825_845delCGCGGCCGTGTGGAATGCCCA/p. His275GlnfsX49) in AIP gene, respectively. Our data support that MEN1 gene is the main target for genetic analysis in clinical MEN1 syndrome. We confirm that in those patients without MEN1 gene mutation, other genes such as CDKN1B/p27Kip, or AIP in those including pituitary tumours should also be tested.

MENX

Multiple endocrine neoplasias (MEN) are a group of hereditary disorders characterized by tumors arising in more than one neuroendocrine tissue. There are two major forms which can occur in humans, MEN type 1 (MEN1) and MEN type 2 (MEN2). These syndromes are transmitted as autosomal dominant traits with high penetrance and have a different tumor spectrum. MEN1 and MEN2 are caused by germline mutations in the MEN1 and RET genes, respectively. Recently, a variant of the MEN syndromes was discovered in a rat colony and was named MENX since affected animals develop tumors with a spectrum that shares features with both MEN1 and MEN2 human syndromes. Extensive genetic studies identified a germline mutation in the Cdkn1b gene, encoding the p27 cell cycle inhibitor, as the causative mutation for MENX. Capitalizing on these findings, heterozygous germline mutations in the human homologue, CDKN1B, were searched for and identified in patients with multiple endocrine tumors. As a consequence of this discovery, a novel human MEN syndrome, named MEN4, was recognized which is caused by mutations in p27. Altogether these studies identified Cdkn1b/CDKN1B as a novel tumor susceptibility gene for multiple endocrine tumors in both rats and humans. Here I review the phenotypic features and the genetics of the MENX rat syndrome. I briefly address the main functions of p27 and how they are affected by the MENX-associated mutation. Finally, I present examples of how this animal model might be exploited as a translational platform for preclinical studies of pituitary adenomas.

1000 Genomes-based imputation identifies novel and refined associations for the Wellcome Trust Case Control Consortium phase 1 Data

We hypothesize that imputation based on data from the 1000 Genomes Project can identify novel association signals on a genome-wide scale due to the dense marker map and the large number of haplotypes. To test the hypothesis, the Wellcome Trust Case Control Consortium (WTCCC) Phase I genotype data were imputed using 1000 genomes as reference (20100804 EUR), and seven case/control association studies were performed using imputed dosages. We observed two 'missed' disease-associated variants that were undetectable by the original WTCCC analysis, but were reported by later studies after the 2007 WTCCC publication. One is within the IL2RA gene for association with type 1 diabetes and the other in proximity with the CDKN2B gene for association with type 2 diabetes. We also identified two refined associations. One is SNP rs11209026 in exon 9 of IL23R for association with Crohn's disease, which is predicted to be probably damaging by PolyPhen2. The other refined variant is in the CUX2 gene region for association with type 1 diabetes, where the newly identified top SNP rs1265564 has an association P-value of 1.68 × 10(-16). The new lead SNP for the two refined loci provides a more plausible explanation for the disease association. We demonstrated that 1000 Genomes-based imputation could indeed identify both novel (in our case, 'missed' because they were detected and replicated by studies after 2007) and refined signals. We anticipate the findings derived from this study to provide timely information when individual groups and consortia are beginning to engage in 1000 genomes-based imputation.

Impaired Wnt-Pathway Signalling and Reduced Expression of Senescence-Associated Markers in Bone Marrow Mesenchymal Stem Cells of Patients with Myelodysplastic Syndromes

Abstract 272The pathogenesis of Myelodysplastic Syndromes (MDS) is characterized by the acquisition of multiple consecutive alterations in an early hematopoietic stem cell, leading to a stepwise clonal cell expansion and disease evolution. An abnormal bone marrow (BM) microenvironment, however, might also contribute to the BM failure in MDS through defective support of hematopoiesis. The cellular elements of the BM microenvironment derive from a common progenitor cell, namely the mesenchymal stem cell (MSC). We and others (reviewed in Kastrinaki et al. Curr Stem Cell Res Ther. 2011) have recently reported that MDS-derived BM MSCs show defective proliferative potential, impaired clonogenic capacity and limited cellular expansion during passages. The pathogenetic basis of these abnormalities and their implication in the disease process remain unknown. The aim of this study is to probe the mechanisms underlying the impaired functional properties of BM MSCs in patients with lower risk MDS.BM MSCs were isolated from 12 patients with lower risk MDS aged 51 to 75 years (median 67.5 years) and 20 healthy volunteers aged 50 to 73 years (median 63.3 years). BM MSCs were expanded and re-seeded for a total of 10 passages (P). To investigate whether the decreased proliferative capacity of MSCs in MDS patients might be related to replicative senescence, genomic DNA was isolated from culture expanded MSCs at P2, P6 and P10 and telomere length was measured by means of real-time PCR using β-globin as control single-copy-gene. Telomere length is proportional to the relative telomere/single-copy-gene ratio (T/S): T/S=2−δCt(δCt=Cttelomere-Ctβ-globin). Furthermore, total RNA was extracted from culture-expanded P2, P6 and P10 MSCs and amplified by real-time PCR for the evaluation of the senescence associated genes CDKN1B (p15), CDKN2A (p16), CDKN1A (p21), pRB, TP53 (p53) and PARG1. Relative gene expression was calculated by the δCt method. Given that the Wnt signaling pathway plays a key role in MSC proliferation and differentiation, we next investigated whether the proliferative defect of MSC in MDS might be associated with abnormal expression of genes related to Wnt-mediated signal transduction, using a PCR array. Total RNA was thus isolated from 4 representative MDS and 6 normal MSC cultures at P2. The fold change (FC) for each gene between the group of patients and the group of controls was calculated with the δδCt method (FC=2−δδCt).The relative telomere values declined over the entire observation period (P2-P10) in both patient- and control-derived MSCs. T/S values remained constantly higher over passages in MDS MSCs compared to healthy individuals (F=4.362, P<0.05) and the highest difference was obtained in P10 (6545±904 versus 4465±403, respectively, P<0.05). A statistically significant decreased expression of CDKN1B (p15), CDKN1A (p21) and PARG1 was identified in patients compared to the controls time-course (F=6.14, P<0.001; F =4.56, P<0.05 and F=3.716, P<0.05, respectively) implying a decreased senescence rate of MDS-derived MSCs. The expression of CDKN2A (p16) was stable during passages in patients whereas an increase was obtained in healthy subjects time-course but not at statistically significant level. No statistically significant differences were observed in pRB and TP53 (p53) expression between patients and controls time-course. Regarding the Wnt-pathway signaling molecules, we observed that patient MSCs displayed an over-expression of the canonical Wnt pathway inhibitors (αES-FC=3.2, P<0.05; DVL1-FC=3.1, P=0.01; GSK3A-FC=3.9, P<0.01; SENP2-FC=4.6, P<0.01) as well as ligands of the non-canonical Wnt pathway (Wnt5A-FC=3.2, P<0.01; Wnt5B-FC=3.3, P<0.01; Wnt9A-FC=4.14, P<0.01) in comparison to the control group.MDS-derived MSCs display longer telomeres and decreased expression of senescence-associated genes compared with healthy individuals. The possibility therefore that cellular aging account for the defective proliferative potential of patient MSCs seems rather unlikely On the other hand, activation of the non-canonical Wnt pathway in association with the inhibition of the canonical one can explain, at least in part, the decreased proliferative capacity of MSCs in MDS patients. Collectively our results suggest that aberrant Wnt signaling is actively implicated in the mechanisms underlying the impaired functional properties of BM MSCs in MDS. Disclosures:No relevant conflicts of interest to declare.

A novel deletion of theMEN1gene in a large family of multiple endocrine neoplasia type 1 (MEN1) with aggressive phenotype

The MEN1 syndrome is associated with parathyroid, pancreatic and pituitary tumours and is caused by mutations in the MEN1 gene. In general, there is no genotype-phenotype correlation. To characterize a large family with MEN1 with aggressive tumour behaviour: malignant pancreatic endocrine tumours were present in five affected subjects and were the presenting features in three subjects. The coding region of MEN1 was sequenced. Gene copy number analysis was performed by multiplex ligation-dependent probe amplification (MLPA) and array comparative genomic hybridization (aCGH). Loss of heterozygosity (LOH) in tumour tissue was studied by microsatellite analysis. Insulin-like growth factor II (IGF-II) and CDKN1C/p57KIP2 expression were investigated by immunohistochemistry. Mutation screening by conventional PCR sequence analysis of patients' peripheral blood DNA did not reveal any mutation in the MEN1 or CDKN1B gene. Gene copy number analysis by MLPA and aCGH demonstrated a novel monoallelic deletion of 5 kb genomic DNA involving the MEN1 promoter and exons 1 and 2. LOH analysis indicated somatic deletion of maternal chromosome 11, including MEN1 locus (11q13) and 11p15 imprinting control regions (ICR). Methylation analysis of ICR demonstrated ICR1 hypermethylation and ICR2 hypomethylation in the tumour specimens. ICR1 and ICR2 control the expression of IGF-2 and CDKN1C/p57KIP2, respectively. Immunohistochemistry showed that expression of paternally expressed IGF-2 was up-regulated and the maternally expressed CDKN1C/p57KIP2 was lost in the pancreatic endocrine tumours. Gene copy number analysis by MLPA should be considered in patients with negative conventional mutation screening. Although large MEN1 deletion causes MEN1, disruption of imprinted CDKN1C/p57KIP2 and IGF-2 gene expression may contribute to tumour progression and aggressive phenotype.

New pyrazolo[3,4-d]pyrimidine SRC inhibitors induce apoptosis in mesothelioma cell lines through p27 nuclear stabilization

Malignant mesothelioma (MM) is a highly aggressive tumor of the serous membranes for which there is currently no effective curative modality. Recent data suggest that hyperactivation of the tyrosine kinase SRC has a key role in MM development and therefore this kinase represents an important molecular target for MM therapy. We tested new pyrazolo[3,4-d]pyrimidine SRC inhibitors on a panel of MM cell lines expressing the active form of SRC. These SRC inhibitors exerted a significant proapoptotic effect on MM cells without affecting the normal mesothelial cell line MET-5A, supporting a possible use of these SRC inhibitors for a safe treatment of MM. We also showed that SRC inhibitor-induced apoptosis occurred concomitantly with an increase in the nuclear stability of the cyclin-dependent kinase inhibitor p27. This finding is remarkable considering that loss of nuclear p27 expression is a well-established adverse prognostic factor in MM, and p27 nuclear localization is crucial for its tumor-suppressive function. Consistently, SRC inhibition seems to promote the increase in p27 nuclear level also by inactivating the AKT kinase and downregulating cyclin D1, which would otherwise delay p27 nuclear import and provoke its cytoplasmic accumulation. To determine whether p27 stabilization has a direct role in apoptosis induced by SRC inhibition, we stably silenced the CDKN1B gene, encoding p27, in MSTO-211H and REN mesothelioma cells by transduction with lentiviral vectors expressing short hairpin RNAs against the CDKN1B transcript. Strikingly, p27 silencing was able to suppress the apoptosis induced by these SRC inhibitors in both MM cell lines, suggesting that p27 has a crucial proapoptotic role in MM cells treated with SRC inhibitors. Our findings reveal a new mechanism, dependent on p27 nuclear stabilization, by which SRC inhibition can induce apoptosis in MM cells and provide a new rationale for the use of SRC inhibitors in MM therapy.

Aberrant DNA Methylation Is Associated with Disease Progression, Resistance to Imatinib and Shortened Survival in Chronic Myelogenous Leukemia

The epigenetic impact of DNA methylation in chronic myelogenous leukemia (CML) is not completely understood. To elucidate its role we analyzed 120 patients with CML for methylation of promoter-associated CpG islands of 10 genes. Five genes were identified by DNA methylation screening in the K562 cell line and 3 genes in patients with myeloproliferative neoplasms. The CDKN2B gene was selected for its frequent methylation in myeloid malignancies and ABL1 as the target of BCR-ABL translocation. Thirty patients were imatinib-naïve (mostly treated by interferon-alpha before the imatinib era), 30 were imatinib-responsive, 50 were imatinib-resistant, and 10 were imatinib-intolerant. We quantified DNA methylation by bisulfite pyrosequencing. The average number of methylated genes was 4.5 per patient in the chronic phase, increasing significantly to 6.2 in the accelerated and 6.4 in the blastic phase. Higher numbers of methylated genes were also observed in patients resistant or intolerant to imatinib. These patients also showed almost exclusive methylation of a putative transporter OSCP1. Abnormal methylation of a Src suppressor gene PDLIM4 was associated with shortened survival independently of CML stage and imatinib responsiveness. We conclude that aberrant DNA methylation is associated with CML progression and that DNA methylation could be a marker associated with imatinib resistance. Finally, DNA methylation of PDLIM4 may help identify a subset of CML patients that would benefit from treatment with Src/Abl inhibitors.

Sequence analysis of the CDKN1B gene in patients with premature ovarian failure reveals a novel mutation potentially related to the phenotype

Earlier reports demonstrated a key role of Cdkn1b during mouse ovarian development. In this study, the sequencing analysis of the complete coding region of this gene in a panel of premature ovarian failure patients and control subjects reveals a novel mutation potentially related to the phenotype.

Characterization of arsenic-induced cytogenetic alterations in acute promyelocytic leukemia cell line, NB4

Gain or loss of genes plays important roles in leukemogenesis of APL via cooperation with PML-RARA. Fluorescence in situ hybridization (FISH) was applied to investigate the DNA copy number changes of hTERT, ERG, CDKN1B (P27), CDKN2A (P16), and TP53 genes in an acute promyelocytic leukemia (APL) cell line (NB4). Five bacterial artificial chromosome probes (BAC) for 9p21.3, 17p13.1, 12p13.2, 5p15.33, 21q22.2 regions were prepared using sequence independent amplification (SIA) and were hybridized to NB4 cells treated with different doses of arsenic trioxide (As(2)O(3); ATO) at various time intervals. NB4 cells were also karyotyped by G-banded chromosome analysis 24 h after culture initiation. FISH analysis prior to treatment showed CDKN1B, CDKN2A, and TP53 gene deletion but ERG and hTERT gene amplification. After treatment with ATO, the number of the NB4 cells with deleted CDKN1B and CDKN2A as well as the counts of the cells with hTERT amplification was significantly reduced in time- and does-dependent manners. In addition, we observed expressive increase in signal patterns of CDKN1B and CDKN2A along with significant decline in hTERT signal patterns in ATO-treated cells as compared with the control group (in time- and dose-dependent manners). On the other hand, no difference in signal patterns for Erg and p53 was observed in response to ATO exposure. The results of the present study show the cytogenetic alteration in hTERT, CDKN1B, and CDKN2A in NB4 cells after treatment with ATO might introduce a new mechanism of antitumor activities of ATO in APL cell line, NB4.

Abstract 311: Loss of the tumor suppressor genes CDKN2A/ARF impairs prognosis in adult BCR-ABL1 positive acute lymphoblastic leukemia (ALL)

Abstract Rational: The tumor suppressor genes p16 INK4a /CDKN2A, p14/ARF and p15 INK4b /CDKN2B on 9p21 locus encode critical factors for the regulation of cell cycle and/or apoptosis and are often inactivated in many tumors. Aims: To explore the frequency and size of deletions affecting the 9p21 locus in adult BCR-ABL1-positive ALL, to determine the main mechanism of inactivation and to investigate their prognostic role. Patients and methods: 112 patients were analyzed: 82 (73%) de novo cases, 11 (10%) unpaired relapse cases, 19 (17%) diagnosis-relapse matched samples. The median age was 53 years (range: 18-76) and the median blast percentage was 90% (range, 18-99). Affymetrix single nucleotide polymorphism (SNP) arrays (GeneChip® Human Mapping 250K NspI and Genome-Wide Human SNP 6.0) were used to identify at a high resolution copy number changes on 9p21; PCR amplification and subsequent sequencing were performed in search of mutations; gene-expression profiling (Affymetrix Human Exon 1ST Array) was performed to draw a specific signature associated with deletions. Results: At diagnosis, CDKN2A/ARF and CDKN2B genomic alterations were identified in 29% and 24% of patients, respectively. Deletions were monoallelic in the majority of cases (72%) with a median of 1,012 kb in size (range, 2.8-31,319 kb). In some of them, 43%, the minimal overlapping region of the lost area spanned only the CDKN2A/ARF/CDKN2B gene locus, but more often (57%) the loss was considerable larger and extended sometimes over the entire short arm. Analysis of the genomic status at the relapse showed an almost significant increase in the detection rate of CDKN2A/ARF loss (47%) compared to diagnosis (p = 0.06). The mutation screening performed on each exon of ARF, CDKN2A and CDKN2B genes showed that the 9p21 locus is rarely affected by missense point mutations with only the identification of D146N in the CDKN2A exon 2. Furthermore, 2 mutations were found in the 5’UTR of CDKN2A [UTR A 21965011 (33%), UTR G/A 21965011 (47%), UTR C/T 21964875 (3%)]. Since the prognostic relevance of CDKN2A/ARF deletions is still controversial in literature, we addressed this issue in our study cohort (81 patients evaluable), finding out that deletions in this locus are significantly associated with poor outcome both in terms of disease free-survival (p=0.001) and cumulative incidence of relapse (p=0.001). Conclusions: The inactivation of CDKN2A/ARF is a frequent event in Ph+ ALL. Deletions are frequently acquired at the leukemia progression and work as a poor prognostic marker, impairing disease free-survival and cumulative incidence of relapse. Novel treatment strategies targeting the ARF-MDM2-p53 pathway may be effective in this subset of patients and in vitro studies are ongoing to confirm this hypothesis. Supported by: European LeukemiaNet, AIL, AIRC, FIRB 2006, Programma di Ricerca Regione – Università 2007 – 2009. Citation Format: {Authors}. {Abstract title} [abstract]. In: Proceedings of the 102nd Annual Meeting of the American Association for Cancer Research; 2011 Apr 2-6; Orlando, FL. Philadelphia (PA): AACR; Cancer Res 2011;71(8 Suppl):Abstract nr 311. doi:10.1158/1538-7445.AM2011-311

Abstract LB-227: New SRC inhibitors induce p27-mediated apoptosis in mesothelioma cell lines

Abstract Malignant mesothelioma (MM) is a highly aggressive tumor of the serous membranes for which there is currently no specific curative modality. Recent data suggest that hyperactivation of the tyrosine kinase SRC has a key role in MM development and therefore this kinase represents an important molecular target for MM therapy. We tested new pyrazolo-[3,4-d]-pyrimidine SRC inhibitors on a panel of MM cell lines expressing the active form of SRC. These SRC inhibitors exerted a significant proapoptotic effect on MM cells without affecting the normal mesothelial cell line MET-5A, supporting a possible use of these SRC inhibitors for a safe treatment of MM. We also showed that SRC inhibitor-induced apoptosis occurred concomitantly with an increase in the nuclear stability of the cyclin-dependent kinase inhibitor p27. This finding is remarkable considering that loss of nuclear p27 expression is a well-established adverse prognostic factor in MM and p27 nuclear localization is crucial for its tumor suppressive function. Consistently, SRC inhibition seems to promote the increase in p27 nuclear level also by inactivating the AKT kinase and downregulating cyclin D1, which would otherwise delay p27 nuclear import and provoke its cytoplasmic accumulation. To determine whether p27 stabilization has a direct role in apoptosis induced by SRC inhibition, we stably silenced the CDKN1B gene, encoding p27, in MSTO-211H and REN mesothelioma cells by transduction with lentiviral vectors expressing short hairpin RNAs against the CDKN1B transcript. Strikingly, p27 silencing was able to suppress the apoptosis induced by these SRC inhibitors in both MM cell lines, suggesting that p27 has a crucial proapoptotic role in MM cells treated with SRC inhibitors. Our findings reveal a new mechanism, dependent on p27 nuclear stabilization, by which SRC inhibition can induce apoptosis in MM cells and provide a new rationale for the use of SRC inhibitors in MM therapy. Citation Format: {Authors}. {Abstract title} [abstract]. In: Proceedings of the 102nd Annual Meeting of the American Association for Cancer Research; 2011 Apr 2-6; Orlando, FL. Philadelphia (PA): AACR; Cancer Res 2011;71(8 Suppl):Abstract nr LB-227. doi:10.1158/1538-7445.AM2011-LB-227

Association of Genetic Polymorphisms in Cell-Cycle Control Genes and Susceptibility to Endometrial Cancer Among Chinese Women

Although genetic variations in cell-cycle control genes have been previously linked to cancer risk, no study has specifically evaluated the role of these gene variants in endometrial carcinogenesis. Using data from the Shanghai Endometrial Cancer Study, a population-based case-control study with 1,199 cases and 1,212 age-matched controls (1997-2003), the authors carried out a systematic evaluation of the association of cell-cycle control genes with endometrial cancer risk. Sixty-five tagging or potentially functional single nucleotide polymorphisms in the CCNB1, CCND1, CCNE1, CDK2, CDK4, CDK6, CDKN1A, CDKN1B, and CDKN2A genes were genotyped and evaluated. Three single nucleotide polymorphisms in the CDKN1B gene (rs11055027, rs3759216, and rs34330) were related to endometrial cancer risk, although only the association with rs34330 remained statistically significant after adjustment for multiple comparisons. The odds ratios for rs34330 were 1.33 (95% confidence interval (CI): 1.06, 1.66) and 1.51 (95% CI: 1.16, 1.94) for the CT and TT genotypes, respectively, compared with the CC genotype. In vitro luciferase reporter assays showed that the minor allele (A) in rs3759216, which was associated with decreased endometrial cancer risk (odds ratio = 0.73, 95% CI: 0.56, 0.94) without adjustment for multiple comparisons, significantly increased promoter activity. These findings suggest that polymorphisms of the CDKN1B gene may play a role in endometrial carcinogenesis.

Differential expression of six obesity-related genes with different disease phases of T2DM in cynomolgus monkey

Type 2 diabetes mellitus (T2DM) is a metabolic disease with a strong genetic component that is very prevalent in the world. The aim of this study is to investigate the association of a set of six obesity-related genes with the different disease phases of T2DM in a model using middle or aged cynomogus monkeys. A total of 25 male monkeys were used and fed with high-fat diet (15% lard). The disease development and progression of T2DM were monitored through the levels of plasma glucose and lipid. The mRNA expression of 6 genes was evaluated using real-time PCR on monocyte isolated from monkey peripheral blood. The 2-hour plasma glucose levels followed oral glucose tolerance test (OGTT) were (11.06+/-6.05) mmol/L and (13.12+/-2.89) mmol/L respectively (P<0.01), and the fasting plasma glucose level was (7.58+/-1.56) mmol/L (vs controls, P<0.01), indicating that we developed successful the models of pre-diabetic and diabetic disease in the cynomolgus monkey. Of the six tested genes, CDKN2B, IGF2BP2, and FTO genes were significantly up-regulated with disease progression in T2DM. We found that the expression of IGF2BP2 and FTO increased 65.92 and 4.30 folds in the developed T2DM. We conclude that the genes of CDKN2B, IGF2BP2, and FTO can be used as early diagnostic and prognostic biomarkers in type 2 diabetes.

Somatic Mutation and Germline Sequence Abnormalities inCDKN1B, Encoding p27Kip1, in Sporadic Parathyroid Adenomas

Typical nonfamilial (sporadic) parathyroid adenomas are common endocrine tumors for which no predisposing germline DNA variants and only a few clonally altered genes that drive parathyroid tumorigenesis have been identified. CDKN1B, encoding cyclin-dependent kinase inhibitor p27(kip1), has recently been implicated in a multiple endocrine tumor phenotype in rats and, rarely, in a human familial MEN1 (multiple endocrine neoplasia type 1)-like disorder. We sought to determine whether mutation of CDKN1B might contribute to the development of common sporadic parathyroid adenomas. We sequenced the CDKN1B gene in 86 parathyroid adenomas from patients with typical, sporadic presentations of primary hyperparathyroidism. Identified alterations were categorized as somatic or germline, and their functional consequences were examined. CDKN1B sequence abnormalities were identified in four parathyroid adenomas. Acquired biallelic alteration of CDKN1B, resulting from somatic mutation plus loss of heterozygosity, was detected in one tumor. Germline origin was documented in two cases despite nonfamilial presentations. None of the observed alterations were found in 240 CDKN1B alleles from normal individuals, nor among more than 2,000 previously reported alleles. Most identified variants reduced p27(kip1) protein levels or altered in vitro stability. In typical, sporadic parathyroid adenomas, CDKN1B mutation can be somatic and clonal, indicative of a directly conferred selective advantage in parathyroid tumorigenesis. Additionally, the identification of germline CDKN1B variants in patients with sporadic presentations provides evidence for CDKN1B as a susceptibility gene in the development of typical parathyroid adenomas.

A common variant in the CDKN2B gene on chromosome 9p21 protects against coronary artery disease in Americans of African ancestry

BackgroundA 58kb region on chromosome 9p21.3 has consistently shown strong association with coronary artery disease (CAD) in multiple genome-wide association studies in populations of European and East Asian ancestry. In this study we sought to further characterize the role of genetic variants in 9p21.3 in African American individuals.Methods and ResultsApparently healthy African American siblings (n=548) of patients with documented CAD <60 years of age were genotyped and followed for incident CAD for up to 17 years. Tests of association for 86 SNPs across the 9p21.3 region in a GEE logistic framework under an additive model adjusting for traditional risk factors, family, follow-up time, and population stratification were performed. A single SNP within the CDKN2B gene met stringent criteria for statistical significance, including permutation-based evaluations. This variant, rs3217989, was common (minor allele [G] frequency 0.242), conveyed protection against CAD (OR=0.19, 95% CI: 0.07 to 0.50, p=0.0008) and was replicated in a combined analysis of two additional case/control studies of prevalent CAD/MI in African Americans (n=990, p=0.024, OR= 0.779, 95% CI: 0.626-0.968).ConclusionsThis is the first report of a CAD association signal in a population of African ancestry with a common variant within the CDKN2B gene, independent from previous findings in European and East Asian ancestry populations. The findings demonstrate a significant protective effect against incident CAD in African American siblings of persons with premature CAD, with replication in a combination of two additional African American cohorts.

Association Study of Genetic Variants in CDKN2A/CDKN2B Genes/Loci with Late‐Onset Alzheimer′s Disease

Alzheimer's disease (AD) is the most common form of dementia clinically characterized by progressive impairment of memory and other cognitive functions. Many genetic researches in AD identified one common genetic variant (ε4) in Apolipoprotein E (APOE) gene as a risk factor for the disease. Two independent genome-wide studies demonstrated a new locus on chromosome 9p21.3 implicated in Late-Onset Alzheimer's Disease (LOAD) susceptibility in Caucasians. In the present study, we investigated the role of three SNP's in the CDKN2A gene (rs15515, rs3731246, and rs3731211) and one in the CDKN2B gene (rs598664) located in 9p21.3 using an association case-control study carried out in a group of Caucasian subjects including 238 LOAD cases and 250 controls. The role of CDKN2A and CDKN2B genetic variants in AD is not confirmed in our LOAD patients, and further studies are needed to elucidate the role of these genes in the susceptibility of AD.