cDC Subsets Research Articles

The lifespan and kinetics of human dendritic cell subsets and their precursors in health and inflammation.

Dendritic cells (DC) are specialized mononuclear phagocytes that link innate and adaptive immunity. They comprise two principal subsets: plasmacytoid DC (pDC) and conventional DC (cDC). Understanding the generation, differentiation, and migration of cDC is critical for immune homeostasis. Through human in vivo deuterium-glucose labeling, we observed the rapid appearance of AXL+ Siglec6+ DC (ASDC) in the bloodstream. ASDC circulate for ∼2.16 days, while cDC1 and DC2 circulate for ∼1.32 and ∼2.20 days, respectively, upon release from the bone marrow. Interestingly, DC3, a cDC subset that shares several similarities with monocytes, exhibits a labeling profile closely resembling that of DC2. In a human in vivo model of cutaneous inflammation, ASDC were recruited to the inflammatory site, displaying a distinctive effector signature. Taken together, these results quantify the ephemeral circulating lifespan of human cDC and propose functions of cDC and their precursors that are rapidly recruited to sites of inflammation.

Profound deficiencies in mature blood and bone marrow progenitor dendritic cells in Chronic Lymphocyticcytic Leukemia patients.

Chronic lymphocytic leukemia (CLL) patients are immunocompromised and highly vulnerable to serious recurrent infections. Conventional dendritic cells (cDCs) and plasmacytoid DCs (pDCs) are principal sensors of infection and are essential in orchestrating innate and adaptive immune responses to resolve infection. This study identified significant deficiencies in six functionally distinct DC subsets in blood of untreated CLL (UT-CLL) patients and selective normalization of pDCs in response to acalabrutinib (a Bruton tyrosine kinase inhibitor) therapy. DCs are continuously replenished from hematopoiesis in bone marrow (BM). Four BM developmental intermediates that give rise to cDCs and pDCs were examined and significant reductions of these were identified in UT-CLL patients supporting a precursor/progeny relationship. The deficiencies in blood DCs and BM DC progenitors were significantly associated with alterations in the Flt3/FL signaling pathway critical to DC development and function. Regarding clinical parameter, cDC subset deficiencies are associated with adverse prognostic indicators of disease progression, including IGHV mutation, CD49d, CD38, and ZAP-70 status. Importantly, UT-CLL patients with shared DC subset deficiencies had shorter time-to-first treatment (TTFT), uncovering a profound alteration in innate immunity with the potential to instruct therapeutic decision-making.

Classical dendritic cells contribute to hypoxia-induced pulmonary hypertension.

Pulmonary hypertension (PH) is a chronic and progressive disease with significant morbidity and mortality. It is characterized by remodeled pulmonary vessels associated with perivascular and intravascular accumulation of inflammatory cells. Although there is compelling evidence that bone marrow-derived cells, such as macrophages and T cells, cluster in the vicinity of pulmonary vascular lesions in humans and contribute to PH development in different animal models, the role of dendritic cells in PH is less clear. Dendritic cells' involvement in PH is likely since they are responsible for coordinating innate and adaptive immune responses. We hypothesized that dendritic cells drive hypoxic PH. We demonstrate that a classical dendritic cell (cDC) subset (cDC2) is increased and activated in wild-type mouse lungs after hypoxia exposure. We observe significant protection after the depletion of cDCs in ZBTB46 DTR chimera mice before hypoxia exposure and after established hypoxic PH. In addition, we find that cDC depletion is associated with a reduced number of two macrophage subsets in the lung (FolR2+ MHCII+ CCR2+ and FolR2+ MHCII+ CCR2-). We found that depleting cDC2s, but not cDC1s, was protective against hypoxic PH. Finally, proof-of-concept studies in human lungs show increased perivascular cDC2s in patients with Idiopathic Pulmonary Arterial Hypertension (IPAH). Our data points to an essential role of cDCs, particularly cDC2s, in the pathophysiology of experimental PH.

Abstract We055: Role of Classical Dendritic Cells in the Sterile Inflammatory Response Following Myocardial Infarction

Myocardial infarction and the subsequent development of chronic ischemic cardiomyopathy is the most common cause of congestive heart failure. Infarction is associated with an intense sterile inflammatory response which can lead to adverse remodeling over the long term. Dendritic cells (DCs) are antigen presenting cells that function as a bridge between innate and adaptive immunity. Precursor DCs give rise to several distinct classical DC (cDC) subsets that mediate a variety of functions. The cDC1 subset is essential for cross-presentation of antigens to CD8 + T cells, while the cDC2 lineage is a potent inducer of CD4 + T cell proliferation. The aim of the study was to characterize the profile of the cDC populations present during the various stages of the development of chronic ischemic cardiomyopathy. We hypothesized that cDCs are essential mediators of chronic LV remodeling in the period following ischemic myocardial injury. We sought to determine which specific cDC subtype (cDC1 vs cDC2) forms the predominant population in the heart and secondary lymphoid tissues following ischemic injury. Adult male C57BL/6 (WT) mice underwent non-perfused myocardial infarction by ligating the left anterior descending artery (LAD) to induce sterile injury, with sham operated mice used as controls. Left ventricular (LV) remodeling was assessed by echocardiography at 1 w and 8 w following surgery. Alterations in cDC1 (CD45+CD11c+CD103-XCR1-) and cDC2 (CD45+CD11c+CD103+XCR1+) profile were examined by flow cytometry. When compared with the sham operated mice, mice with ischemic cardiomyopathy following LAD ligation exhibited the following features. There is an initial influx of cDC2 into the myocardium 1 w after MI (mean of 3.0% vs 0.26% of CD45 + leukocytes, p=0.02). This is followed by a subsequent influx of cDC1 into the myocardium 4 weeks after MI (mean of 1.98% vs 0.16% of CD45 + leukocytes, p=0.001). This influx of cDC into the heart is accompanied by an egress of cDC from the spleen (mean of 0.37% vs 0.76% of CD45 + leukocytes, P=0.001) at 4 weeks following MI. In conclusion, the findings of our study suggest that there is an initial influx of cDC2 followed by a more sustained influx of cDC1 into the myocardium in the weeks following an infarct. Antigen presentation by cDC likely plays a critical role in driving the inflammatory response and inducing chronic LV remodeling in the period following MI.

Conventional type 1 dendritic cells are essential for the development of primary biliary cholangitis.

Primary biliary cholangitis (PBC) is a progressive-cholestatic autoimmune liver disease. Dendritic cells (DC) are professional antigen-presenting cells and their prominent presence around damaged bile ducts of PBC patients are documented. cDC1 is a rare subset of DC known for its cross-presentation abilities and interleukin 12 production. Our aim was to assess the role of cDC1 in the pathogenesis of PBC. We utilized an inducible murine model of PBC and took advantage of the DC reporter mice Zbtb46gfp and the Batf3-/- mice that specifically lack the cDC1 subset. cDC1 cells were sorted from blood of PBC patients and healthy individuals and subjected to Bulk-MARS-seq transcriptome analysis. Histopathology assessment demonstrated peri-portal inflammation in wild type (WT) mice, whereas only minor abnormalities were observed in Batf3-/- mice. Flow cytometry analysis revealed a two-fold reduction in hepatic CD8/CD4 T cells ratio in Batf3-/- mice, suggesting reduced intrahepatic CD8 T cells expansion. Histological evidence of portal fibrosis was detected only in the WT but not in Batf3-/- mice. This finding was supported by decreased expression levels of pro-fibrotic genes in the livers of Batf3-/- mice. Transcriptome analysis of human cDC1, revealed 78 differentially expressed genes between PBC patients and controls. Genes related to antigen presentation, TNF and IFN signalling and mitochondrial dysfunction were significantly increased in cDC1 isolated from PBC patients. Our data illustrated the contribution the cDC1 subset in the pathogenesis of PBC and provides a novel direction for immune based cell-specific targeted therapeutic approach in PBC.

Characterization of intestinal mononuclear phagocyte subsets in young ruminants at homeostasis and during Cryptosporidium parvum infection.

Cryptosporidiosis is a poorly controlled zoonosis caused by an intestinal parasite, Cryptosporidium parvum, with a high prevalence in livestock (cattle, sheep, and goats). Young animals are particularly susceptible to this infection due to the immaturity of their intestinal immune system. In a neonatal mouse model, we previously demonstrated the importance of the innate immunity and particularly of type 1 conventional dendritic cells (cDC1) among mononuclear phagocytes (MPs) in controlling the acute phase of C. parvum infection. These immune populations are well described in mice and humans, but their fine characterization in the intestine of young ruminants remained to be further explored. Immune cells of the small intestinal Peyer's patches and of the distal jejunum were isolated from naive lambs and calves at different ages. This was followed by their fine characterization by flow cytometry and transcriptomic analyses (q-RT-PCR and single cell RNAseq (lamb cells)). Newborn animals were infected with C. parvum, clinical signs and parasite burden were quantified, and isolated MP cells were characterized by flow cytometry in comparison with age matched control animals. Here, we identified one population of macrophages and three subsets of cDC (cDC1, cDC2, and a minor cDC subset with migratory properties) in the intestine of lamb and calf by phenotypic and targeted gene expression analyses. Unsupervised single-cell transcriptomic analysis confirmed the identification of these four intestinal MP subpopulations in lamb, while highlighting a deeper diversity of cell subsets among monocytic and dendritic cells. We demonstrated a weak proportion of cDC1 in the intestine of highly susceptible newborn lambs together with an increase of these cells within the first days of life and in response to the infection. Considering cDC1 importance for efficient parasite control in the mouse model, one may speculate that the cDC1/cDC2 ratio plays also a key role for the efficient control of C. parvum in young ruminants. In this study, we established the first fine characterization of intestinal MP subsets in young lambs and calves providing new insights for comparative immunology of the intestinal MP system across species and for future investigations on host-Cryptosporidium interactions in target species.

Constitutive Flt3 signaling impacts conventional dendritic cell function.

The development of dendritic cells (DCs) depends on signaling via the FMS-like tyrosine kinase 3 (Flt3) receptor. How Flt3 signaling impacts terminally differentiated DC function is unknown. This is important given the increasing interest in exploiting Flt3 for vaccination and tumor immunotherapy. Here, we examined DCs in mice harboring constitutively activated Flt3 (Flt3-ITD). Flt3ITD/ITD mice possessed expanded splenic DC subsets including plasmacytoid DC, conventional DC (cDC)1, cDC2, double positive (DP) cDC1 (CD11c+ CD8+ CD11b- CD103+ CD86+), noncanonical (NC) cDC1 (CD11c+ CD8+ CD11b- CD103- CD86-) and single positive (SP) cDC1 (CD11c+ CD8+ CD11b- CD103- CD86+). Outcomes of constitutive Flt3 signaling differed depending on the cDC subset examined. In comparison with wild type (WT) DCs, all Flt3ITD/ITD cDCs displayed an altered surface phenotype with changes in costimulatory molecules, major histocompatibility complex class I (MHC I) and II (MHC II). Cytokine secretion patterns, antigen uptake, antigen proteolysis and antigen presenting function differed between WT and Flt3ITD/ITD subsets, particularly cDC2. In summary, Flt3 signaling impacts the function of terminally differentiated cDCs with important consequences for antigen presentation.

Stat5b/Ezh2 axis governs high PD-L1 expressing tolerogenic dendritic cell subset in autoimmune diabetes

Dendritic cells (DCs) are specialized antigen-presenting cells that play an important role in inducing and maintaining immune tolerance. The altered distribution and/or function of DCs contributes to defective tolerance in autoimmune diseases such as type 1 diabetes (T1D). In human T1D and in NOD mouse models, DCs share some defects and are often described as less tolerogenic and excessively immunogenic. In the NOD mouse model, the autoimmune response is associated with a defect in the Stat5b signaling pathway. We have reported that expressing a constitutively active form of Stat5b in DCs of transgenic NOD mice (NOD.Stat5b-CA), re-established their tolerogenic function, restored autoimmune tolerance and conferred protection from diabetes. However, the role and molecular mechanisms of Stat5b signaling in regulating splenic conventional DCs tolerogenic signature remained unclear. In this study, we reported that, compared to immunogenic splenic DCs of NOD, splenic DCs of NOD.Stat5b-CA mice exhibited a tolerogenic profile marked by elevated PD-L1 and PD-L2 expression, reduced pro-inflammatory cytokine production, increased frequency of the cDC2 subset and decreased frequency of the cDC1 subset. This tolerogenic profile was associated with increased Ezh2 and IRF4 but decreased IRF8 expression. We also found an upregulation of PD-L1 in the cDC1 subset and high PD-L1 and PD-L2 expression in cDC2 of NOD.Stat5b-CA mice. Mechanistically, we demonstrated that Ezh2 plays an important role in the maintenance of high PD-L1 expression in cDC1 and cDC2 subsets and that Ezh2 inhibition resulted in PD-L1 but not PD-L2 downregulation which was more drastic in the cDC2 subset. Additionally, Ezh2 inhibition severely reduced the cDC2 subset and increased the cDC1 subset and Stat5b-CA.DC pro-inflammatory cytokine production. Together our data suggest that the Stat5b-Ezh2 axis is critical for the maintenance of tolerogenic high PD-L1-expressing cDC2 and autoimmune tolerance in NOD.Stat5b-CA mice.

Immunological Characteristics of Hepatic Dendritic Cells in Patients and Mouse Model with Liver Echinococcus multilocularis Infection.

The cestode Echinococcus multilocularis, which mainly dwells in the liver, leads to a serious parasitic liver disease called alveolar echinococcosis (AE). Despite the increased attention drawn to the immunosuppressive microenvironment formed by hepatic AE tissue, the immunological characteristics of hepatic dendritic cells (DCs) in the AE liver microenvironment have not been fully elucidated. Here, we profiled the immunophenotypic characteristics of hepatic DC subsets in both clinical AE patients and a mouse model. Single-cell RNA sequencing (scRNA-Seq) analysis of four AE patient specimens revealed that greater DC numbers were present within perilesional liver tissues and that the distributions of cDC and pDC subsets in the liver and periphery were different. cDCs highly expressed the costimulatory molecule CD86, the immune checkpoint molecule CD244, LAG3, CTLA4, and the checkpoint ligand CD48, while pDCs expressed these genes at low frequencies. Flow cytometric analysis of hepatic DC subsets in an E. multilocularis infection mouse model demonstrated that the number of cDCs significantly increased after parasite infection, and a tolerogenic phenotype characterized by a decrease in CD40 and CD80 expression levels was observed at an early stage, whereas an activated phenotype characterized by an increase in CD86 expression levels was observed at a late stage. Moreover, the expression profiles of major immune checkpoint molecules (CD244 and LAG3) and ligands (CD48) on hepatic DC subsets in a mouse model exhibited the same pattern as those in AE patients. Notably, the cDC and pDC subsets in the E. multilocularis infection group exhibited higher expression levels of PD-L1 and CD155 than those in the control group, suggesting the potential of these subsets to impair T cell function. These findings may provide valuable information for investigating the role of hepatic DC subsets in the AE microenvironment and guiding DC targeting treatments for AE.

Genome-wide screening identifies Trim33 as an essential regulator of dendritic cell differentiation.

The development of dendritic cells (DCs), including antigen-presenting conventional DCs (cDCs) and cytokine-producing plasmacytoid DCs (pDCs), is controlled by the growth factor Flt3 ligand (Flt3L) and its receptor Flt3. We genetically dissected Flt3L-driven DC differentiation using CRISPR-Cas9-based screening. Genome-wide screening identified multiple regulators of DC differentiation including subunits of TSC and GATOR1 complexes, which restricted progenitor growth but enabled DC differentiation by inhibiting mTOR signaling. An orthogonal screen identified the transcriptional repressor Trim33 (TIF-1γ) as a regulator of DC differentiation. Conditional targeting in vivo revealed an essential role of Trim33 in the development of all DCs, but not of monocytes or granulocytes. In particular, deletion of Trim33 caused rapid loss of DC progenitors, pDCs, and the cross-presenting cDC1 subset. Trim33-deficient Flt3+ progenitors up-regulated pro-inflammatory and macrophage-specific genes but failed to induce the DC differentiation program. Collectively, these data elucidate mechanisms that control Flt3L-driven differentiation of the entire DC lineage and identify Trim33 as its essential regulator.

Imbalance of programmed cell death patterns mediated by dendritic cell subsets in systemic lupus erythematosus and lupus nephritis.

Abnormal programmed cell death in immune cells is associated with autoimmune diseases, but the patterns of programmed cell death in systemic lupus erythematosus (SLE) and especially lupus nephritis (LN) remain unclear. This study aims to explore the association between SLE, LN, and immune cell death patterns. Bulk RNA sequencing (bulk RNA-seq) and single-cell RNA sequencing (scRNA-seq) data were downloaded from the Gene Expression Omnibus (GEO) database. Bioinformatic analysis was conducted to explore the expression levels of genes related to 3 cell death patterns in peripheral blood mononuclear cells of SLE patients. Key cell subsets involved in the imbalance of cell death patterns were identified through scRNA-seq. Immunofluorescence was used to detect the expression levels of receptor interacting serine/threonine kinase 3 (RIPK3), mixed-lineage kinase domain-like protein (MLKL), phosphorylated MLKL (pMLKL), caspase 1 (CASP1), CD1c molecule (CD1C), C-type lectin domain containing 9A (CLEC9A), and X-C motif chemokine receptor 1 (XCR1) in dendritic cells (DC). scRNA-seq was performed on kidney tissues collected from LN patients and healthy controls (HC) at the Third Xiangya Hospital of Central South University, followed by bioinformatic analysis to identify key cell subsets involved in the imbalance of cell death patterns. Pseudotime analysis and ligand-receptor analysis were used to explore the differentiation direction and cell communication of different DC subsets. Transient transfection was used to transfect RAW264.7 cells with empty plasmid, empty plasmid+dsDNA (HSV-DNA), empty plasmid+200 μmol/L tert-butyl hydroperoxide (TBHP), stimulator of interferon genes (STING) shRNA plasmid, STING shRNA plasmid+dsDNA (HSV-DNA), and STING shRNA plasmid+200 μmol/L TBHP. Annexin V-mCherry and SYTOX Green staining were used to detect cell death in each group. Western blotting was used to detect the activation of CASP1, gasdermin D (GSDMD), RIPK3, and MLKL in each group. Bioinformatic analysis showed an imbalance in 3 cell death patterns in SLE and LN patients: Pro-inflammatory pyroptosis and necroptosis were activated, while anti-inflammatory apoptosis was inhibited. The key cell subsets involved were DC subsets, particularly focusing on CLEC9A+cDC1. Immunofluorescence results showed that the expression levels of RIPK3, MLKL, and CASP1 in DCs were higher in the SLE group compared to the HC group. pMLKL and CASP1 expression levels in renal cDC1 marked by CLEC9A and XCR1 were higher in the LN group than in the HC group. Pseudotime analysis and ligand-receptor analysis suggested that the CLEC9A+cDC1 subset in LN kidney tissues originated from peripheral circulation. Annexin V-mCherry and SYTOX Green staining results showed that the number of dead cells decreased in the STING shRNA transfection group compared to the empty plasmid group in RAW264.7 cells. Western blotting results showed that the activation of CASP1, GSDMD, RIPK3, and MLKL was decreased in the STING shRNA transfection group compared to the empty plasmid group. This study provides novel insights into the role of CLEC9A+cDC1 in the imbalance of cell death patterns in SLE and LN.

Abstract 5314: Improved breast cancer tumor control with addition of CD40 agonist and Flt3 ligand to pegylated liposomal doxorubicin is only partially mediated by CD8 T cells

Abstract Background: There is a need for improved immunotherapy strategies beyond current FDA approved treatments for triple negative breast cancer. Defective antigen presentation has been shown to play a contributory role in deficient anti-tumor immunity in breast cancers. Flt3 ligand (Flt3L) is a growth factor that increases differentiation into DC1 dendritic cells. CD40 agonist (CD40a) activates all 3 classes of antigen presenting cells - DCs, B cells, and macrophages. Synergy with chemotherapy and CD40a has been seen in other cancers but not explored in breast cancers. Methods: C57BL/6 mice (aged 6-8 weeks) were injected with 150,000 E0771 breast cancer cells within the mammary fat pad. Tumors were allowed to grow to a volume of ~50 mm3 before randomization into treatment groups. Mice were treated with triplet therapy of pegylated liposomal doxorubicin (PLD) via tail vein followed by Flt3L intraperitoneal (IP) daily for 5 days and CD40a IP 1 week later as well as monotherapy and doublet therapy controls. Tumor growth and survival were monitored throughout the experiment. Tumors were harvested for single cell RNA sequencing (scRNAseq) and immunohistochemistry. To further study subset specific effects on efficacy of the immunotherapy, CD8 and CD4 T-cells were systemically depleted with anti-CD8 and anti-CD4 antibodies administered IP every 4 days starting 2 days before PLD treatment. Results: Triplet therapy led to improved tumor control compared to no treatment, monotherapy, and doublet controls (p<0.0001). Increased tumor infiltration with CD8 T cells was observed with triplet therapy via immunohistochemistry. scRNAseq showed increased cDC1 subset with Flt3L treatment. Contrastingly, CD40a decreased DC subsets likely due to activation and emigration out of the tumor, remodeled macrophage populations, and decreased T regulatory cells. CD8 depletion led to faster tumor growth whereas CD4 depletion reduced tumor growth. Triplet therapy maintained efficacy over PLD with both CD8 and CD4 depletion but showed reduced magnitude of benefit with CD8 T cell depletion suggesting a partial CD8 mediated process. CD4 T cell depletion did not hinder triplet therapy efficacy compared to PLD but depletion further enhanced tumor control in combination with triplet therapy, with 20% (2/10) of animals achieving complete regression. Conclusion: Triplet therapy with PLD, Flt3L, and CD40a improved tumor control and survival in syngeneic E0771 breast cancer mouse model. Added benefit of immunotherapy to PLD is partially CD8 T cell mediated. CD4 depletion further enhances tumor control in combination with triplet therapy. Experiments to explore the interactive effect of triplet therapy with other pertinent immune subsets are ongoing. A clinical trial with this combination in metastatic triple negative breast cancer patients is open and recruiting (NCT05029999). Citation Format: Preteesh L. Mylabathula, Shruthi Nooka, Anas Alkhani, James Zhu, Ashley Vu, Riyasat Ali, Varshini Ramasamy Balasubramanian, Isaac Chan, Sangeetha M. Reddy. Improved breast cancer tumor control with addition of CD40 agonist and Flt3 ligand to pegylated liposomal doxorubicin is only partially mediated by CD8 T cells [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 5314.

Abstract 2476: Electroporation-mediated novel albumin-fused Flt3L DNA delivery promotes cDC1-associated anticancer immunity

Abstract Introduction: Dendritic cells (DCs) constitute a distinct type of immune cell found within tumors, serving a central role in mediating tumor antigen-specific immunity against cancer cells. Frequently, DC functions are dysregulated by the immunosuppressive signals present within the tumor microenvironment (TME). Consequently, DC manipulation holds great potential to enhance the cytotoxic T cell response against cancer diseases. The Fms-like tyrosine kinase receptor 3 ligand (Flt3L) is a pluripotent growth factor that regulates the maturation and differentiation of DCs in hematopoiesis. The in vivo administration of Flt3L itself is limited by its short serum half-life. To overcome this major drawback, our group developed a novel fusion protein albumin-Flt3L (alb-Flt3L), which is the conjugation of albumin to Flt3L. Our hypothesis is that the Flt3L, which has extended bioavailability, is a feasible therapeutic strategy to overcome these treatment limitations. Method: A novel alb-Flt3L DNA, a plasmid encoding the alb-Flt3L protein, was administrated for its anti-tumor effect on TC-1 tumor-bearing C57BL/6 mice. For the generation of pcDNA3-albFlt3L, mouse Flt3 ligand was amplified by PCR using cDNA template of pcDNA3-Flt3L1 and a set of primers, 5′- TTTGAATTCGGGACACCTGACTGTTACTTC-3′ and 5′- AAACTTAAGCTACTGCCTGGGCCGAGGCTCTGG -3′. alb-Flt3L DNA (10ug), Flt3L DNA (10ug) or vehicle control was injected intratumorally followed by electroporation for a total of three times in 5-day intervals. Peripheral blood mononuclear cells and tumor-infiltrated immune cells were isolated after treatment. Flow cytometry was performed for immune cell analysis. Results: In this current study, the electroporation-mediated delivery of alb-Flt3L DNA demonstrated the ability to induce an anti-tumor immune response. This albumin fusion construct possesses more persistent bioactivity in targeted organs. Furthermore, mice receiving alb-Flt3L DNA treatment presented better tumor control and superior survival. Cellular analysis revealed that alb-Flt3L DNA administration displayed greater systemic DC population. In addition, robust cDC1 expansion, which is associated with superior antigen cross-presentation and cellular immunity against tumors, developed extensively in the tumor, lymph node, and blood. In addition, increased levels of IFN-γ-secreting CD8+ lymphocytes and tumor-infiltrated immune cells were found in correlation to greater cDC1 population. Conclusion: Our data showcases a novel DC-based immunotherapy using electroporation to administer alb-Flt3L DNA. The treatment effect is revealed by a controlled tumor response, characterized by enhanced DC mobilization and accumulation in both the lymph nodes and TME, coupled with an increase in the expansion of cDC1 subsets and a heightened level of CD8+ T cell activation. Citation Format: Ming-Hung Hu, Tzyy-Choou Wu, Chien-Fu Hung. Electroporation-mediated novel albumin-fused Flt3L DNA delivery promotes cDC1-associated anticancer immunity [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 2476.

Abstract 4210: Stromal remodeling danger signals regulate “second-touch” antigenic encounters and promote CD8+ T cell effector differentiation in the TME

Abstract Tumor immune infiltration (“hot” tumor microenvironment, TME) constitutes a powerful predictor of outcomes and immunotherapy efficacy, however underlying mechanisms remain elusive. Recent evidence shows that TME-repriming of incoming CD8+ T cells is required for full effector functionality. Reminiscent of the “second-touch” hypothesis proposed by Klaus Ley for CD4+ differentiation, tumor-draining lymph node (TDLN) priming (“first-touch”) generates antigen-specific stem-like TCF1+CD8+ T cells. These stem-like CD8+ T cells then migrate to the tumor periphery where “second-touch” antigenic encounters with non-migratory CCR7neg dendritic cells (DC) (importantly, the cross-presenting cDC1 subset) leads to effector CD8+ T cell differentiation and tumor entry. These second-touch encounters occur within specialized stromal niches that are rich in antigen-presenting cells (APC). We have hypothesized that productive APC:CD8+ interactions require stroma-derived signals that emulate provisional matrix remodeling in embryonic development and/or adult wound healing. Thus, stroma remodeling by the expanding tumor translates into a conserved “danger signal” that licenses APC to activate CD8+ T cell responses. We have focused on a prototypical pathway of provisional matrix remodeling, the regulated proteolysis of the matrix proteoglycan versican (VCAN) to generate a bioactive fragment endowed with immunostimulatory activities, versikine. Stromal VCAN proteolysis at the site releasing versikine is associated with T-cell infiltration across human solid and liquid tumors. To investigate the mechanisms by which versikine regulates first- and second-touch antigenic encounters, we dissected the immune microenvironment of versikine-replete tumors of immunocompetent models at single-cell resolution. Non-migratory Ccr7neg cDC1 in versikine-replete tumors overexpress MHC-I and MHC-II antigen presentation machinery (Tap1, Ciita), maturation (Irf7, ISGs, Tlr3) and co-stimulation markers (Cd86, 4-1BBL), while Ccr7pos DC (mregDC) markedly overexpress Cd40 compared to control mregDC. In parallel, Cd4+ Tfh-like cells (overexpressing Cd40lg, Icos and Maf) accumulate in versikine-replete tumors, mirroring the accumulation of CD4+ T-cells in the stroma of human tumors displaying intense VCAN proteolysis. Consequently, versikine-replete tumors demonstrate expansion of late effector CD8+ T cells (Gzmb+Prf1+). Versikine reverses anti-PD-1 refractoriness in the “cold” model, Lewis Lung Carcinoma (LLC). In “warm” tumor models, versikine with anti-PD-L1 suffices to eradicate tumors and establish immune memory with resistance to tumor rechallenge. Our presentation will focus on the mechanistic dissection of stromal signals regulating antigen presentation across models as well as approaches for translation into novel vaccine platforms. Citation Format: Athanasios Papadas, Duncan Hong, Alexander Cicala, Alicia Gibbons, Daniel J. Lagal, Yun Huang, Yaling Dou, Fotis Asimakopoulos. Stromal remodeling danger signals regulate “second-touch” antigenic encounters and promote CD8+ T cell effector differentiation in the TME [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 4210.

Batf3-dependent orchestration of the robust Th1 responses and fungal control during cryptococcal infection, the role of cDC1.

While type I conventional dendritic cells (cDC1s) are vital for generating adaptive immunity against intracellular pathogens and tumors, their role in defense against fungal pathogen Cryptococcus neoformans remains unclear. We investigated the role of the cDC1 subset in a fungus-restricting mouse model of cryptococcal infection. The cDC1 subset displayed a unique transcriptional signature with highly upregulated T-cell recruitment, polarization, and activation pathways compared to other DC subsets. Using Batf3-/- mice, which lack the cDC1 population, our results support that Batf3-dependent cDC1s are pivotal for the development of the effective immune response against cryptococcal infection, particularly within the lung and brain. Deficiency in Batf3 cDC1 led to diminished CD4 accumulation and decreased IFNγ production across multiple organs, supporting that cDC1s are a major driver of potent Th1 responses during cryptococcal infection. Consistently, mice lacking Batf3-cDC1 demonstrated markedly diminished fungicidal activity and weaker containment of the fungal pathogen. In conclusion, Batf3-dependent cDC1 can function as a linchpin in mounting Th1 response, ensuring effective fungal control during cryptococcal infection. Harnessing cDC1 pathways may present a promising strategy for interventions against this pathogen.IMPORTANCECryptococcus neoformans causes severe meningoencephalitis, accounting for an estimated 200,000 deaths each year. Central to mounting an effective defense against these infections is T-cell-mediated immunity, which is orchestrated by dendritic cells (DCs). The knowledge about the role of specific DC subsets in shaping anti-cryptococcal immunity is limited. Here, we demonstrate that Batf3 cDC1s are important drivers of protective Th1 CD4 T-cell responses required for clearance of cryptococcal infection. Deficiency of Batf3 cDC1 in the infected mice leads to significantly reduced Th1 response and exacerbated fungal growth to the point where depleting the remaining CD4 T cells no longer affects fungal burden. Unveiling this pivotal role of cDC1 in antifungal defense is likely to be important for the development of vaccines and therapies against life-threatening fungal pathogens.

Interplay of Zeb2a, Id2a and Batf3 regulates microglia and dendritic cell development in the zebrafish brain.

In vertebrates, the central nervous system (CNS) harbours various immune cells, including parenchymal microglia, perivascular macrophages and dendritic cells, which act in coordination to establish an immune network to regulate neurogenesis and neural function, and to maintain the homeostasis of the CNS. Recent single cell transcriptomic profiling has revealed that the adult zebrafish CNS contains microglia, plasmacytoid dendritic cells (pDCs) and two conventional dendritic cells (cDCs), ccl35+ cDCs and cnn3a+cDCs. However, how these distinct myeloid cells are established in the adult zebrafish CNS remains incompletely defined. Here, we show that the Inhibitor of DNA binding 2a (Id2a) is essential for the development of pDCs and cDCs but is dispensable for the formation of microglia, whereas the Basic leucine zipper transcription factor ATF-like 3 (Batf3) acts downstream of id2a and is required exclusively for the formation of the cnn3a+ cDC subset. In contrast, the Zinc finger E-box-binding homeobox2a (Zeb2a) promotes the expansion of microglia and inhibits the DC specification, possibly through repressing id2a expression. Our study unravels the genetic networks that govern the development of microglia and brain-associated DCs in the zebrafish CNS.

Focused ultrasound ablation of melanoma with boiling histotripsy yields abscopal tumor control and antigen-dependent dendritic cell activation.

Background: Boiling histotripsy (BH), a mechanical focused ultrasound ablation strategy, can elicit intriguing signatures of anti-tumor immunity. However, the influence of BH on dendritic cell function is unknown, compromising our ability to optimally combine BH with immunotherapies to control metastatic disease. Methods: BH was applied using a sparse scan (1 mm spacing between sonications) protocol to B16F10-ZsGreen melanoma in bilateral and unilateral settings. Ipsilateral and contralateral tumor growth was measured. Flow cytometry was used to track ZsGreen antigen and assess how BH drives dendritic cell behavior. Results: BH monotherapy elicited ipsilateral and abscopal tumor control in this highly aggressive model. Tumor antigen presence in immune cells in the tumor-draining lymph nodes (TDLNs) was ~3-fold greater at 24h after BH, but this abated by 96h. B cells, macrophages, monocytes, granulocytes, and both conventional dendritic cell subsets (i.e. cDC1s and cDC2s) acquired markedly more antigen with BH. BH drove activation of both cDC subsets, with activation being dependent upon tumor antigen acquisition. Our data also suggest that BH-liberated tumor antigen is complexed with damage-associated molecular patterns (DAMPs) and that cDCs do not traffic to the TDLN with antigen. Rather, they acquire antigen as it flows through afferent lymph vessels into the TDLN. Conclusion: When applied with a sparse scan protocol, BH monotherapy elicits abscopal melanoma control and shapes dendritic cell function through several previously unappreciated mechanisms. These results offer new insight into how to best combine BH with immunotherapies for the treatment of metastatic melanoma.

High hypoxia status in pancreatic cancer is associated with multiple hallmarks of an immunosuppressive tumor microenvironment.

Pancreatic ductal adenocarcinoma (PDAC), the most common form of pancreatic cancer, is a particularly lethal disease that is often diagnosed late and is refractory to most forms of treatment. Tumour hypoxia is a key hallmark of PDAC and is purported to contribute to multiple facets of disease progression such as treatment resistance, increased invasiveness, metabolic reprogramming, and immunosuppression. We used the Buffa gene signature as a hypoxia score to profile transcriptomics datasets from PDAC cases. We performed cell-type deconvolution and gene expression profiling approaches to compare the immunological phenotypes of cases with low and high hypoxia scores. We further supported our findings by qPCR analyses in PDAC cell lines cultured in hypoxic conditions. First, we demonstrated that this hypoxia score is associated with increased tumour grade and reduced survival suggesting that this score is correlated to disease progression. Subsequently, we compared the immune phenotypes of cases with high versus low hypoxia score expression (HypoxiaHI vs. HypoxiaLOW) to show that high hypoxia is associated with reduced levels of T cells, NK cells and dendritic cells (DC), including the crucial cDC1 subset. Concomitantly, immune-related gene expression profiling revealed that compared to HypoxiaLOW tumours, mRNA levels for multiple immunosuppressive molecules were notably elevated in HypoxiaHI cases. Using a Random Forest machine learning approach for variable selection, we identified LGALS3 (Galectin-3) as the top gene associated with high hypoxia status and confirmed its expression in hypoxic PDAC cell lines. In summary, we demonstrated novel associations between hypoxia and multiple immunosuppressive mediators in PDAC, highlighting avenues for improving PDAC immunotherapy by targeting these immune molecules in combination with hypoxia-targeted drugs.

Essential role for Batf3-dependent dendritic cells in regulating CD8 T-cell response during SARS-CoV-2 infection.

SARS-CoV-2 infection elicits robust CD8 T-cell responses, yet the identity of the mechanisms playing dominant roles in initiating the virus-specific CD8 T-cell responses are largely unknown. In the present study, we interrogate the contribution of the cDC1 subset to SARS-CoV-2-specific CD8 T-cell immunity. For this purpose, we used a novel murine line which combines the SARS-CoV-2 susceptible K18-hACE2 transgenic and the Batf3 deficient mice which lack the cDC1 subset. We demonstrate that in the absence of cDC1, viral-specific CD8 T-cell responses were severely impaired both in the draining lymph node as well as in the lungs, during the effector phase of SARS-CoV-2 infection. Furthermore, SARS-CoV-2 specific memory CD8 T-cells in the lungs and spleens were also significantly impacted, whereas humoral responses, as well as CD4 T-cells were not affected. Additionally, we demonstrate that the absence of cDC1 subset, and the consequent impaired CD8 T-cell responses, resulted in significant increase in SARS-CoV-2 viral load in the lungs. The conclusions of the study were further independently corroborated in an additional COVID-19 murine model consisting infection with a mouse-adapted SARS-CoV-2 virus. These results underscore a specific role for Batf3-dependent DC in regulating SARS-CoV-2 specific CD8 T-cell responses and may contribute to future vaccine design and immunization strategies.

Differential Activation of Splenic cDC1 and cDC2 Cell Subsets following Poxvirus Infection of BALB/c and C57BL/6 Mice.

Conventional dendritic cells (cDCs) are innate immune cells that play a pivotal role in inducing antiviral adaptive immune responses due to their extraordinary ability to prime and polarize naïve T cells into different effector T helper (Th) subsets. The two major subpopulations of cDCs, cDC1 (CD8α+ in mice and CD141+ in human) and cDC2 (CD11b+ in mice and CD1c+ in human), can preferentially polarize T cells toward a Th1 and Th2 phenotype, respectively. During infection with ectromelia virus (ECTV), an orthopoxvirus from the Poxviridae family, the timing and activation of an appropriate Th immune response contributes to the resistance (Th1) or susceptibility (Th2) of inbred mouse strains to the lethal form of mousepox. Due to the high plasticity and diverse properties of cDC subpopulations in regulating the quality of a specific immune response, in the present study we compared the ability of splenic cDC1 and cDC2 originating from different ECTV-infected mouse strains to mature, activate, and polarize the Th immune response during mousepox. Our results demonstrated that during early stages of mousepox, both cDC subsets from resistant C57BL/6 and susceptible BALB/c mice were activated upon in vivo ECTV infection. These cells exhibited elevated levels of surface MHC class I and II, and co-stimulatory molecules and showed enhanced potential to produce cytokines. However, both cDC subsets from BALB/c mice displayed a higher maturation status than that of their counterparts from C57BL/6 mice. Despite their higher activation status, cDC1 and cDC2 from susceptible mice produced low amounts of Th1-polarizing cytokines, including IL-12 and IFN-γ, and the ability of these cells to stimulate the proliferation and Th1 polarization of allogeneic CD4+ T cells was severely compromised. In contrast, both cDC subsets from resistant mice produced significant amounts of Th1-polarizing cytokines and demonstrated greater capability in differentiating allogeneic T cells into Th1 cells compared to cDCs from BALB/c mice. Collectively, our results indicate that in the early stages of mousepox, splenic cDC subpopulations from the resistant mouse strain can better elicit a Th1 cell-mediated response than the susceptible strain can, probably contributing to the induction of the protective immune responses necessary for the control of virus dissemination and for survival from ECTV challenge.