CD44 Variant Research Articles

CD44 isoforms in human retinal and choroidal endothelial cells

Dear Editor, CD44 is a widely expressed type I transmembrane glycoprotein that functions as the receptor for hyaluronic acid, as well as multiple other ligands.1 In humans, the extracellular domain of “standard isoform” CD44 is encoded by 7 invariant exons (i.e., exons 1 – 5 and exons 15 – 16), but 9 additional alternatively spliced exons (i.e., exons 6 – 14) code for numerous “variant isoforms”.2, 3 Exon 17 encodes a transmembrane segment, and exons 18 or 19 encode a cytoplasmic domain. Although the function of specific variant isoforms is still a subject of investigation, it is clear that differences in CD44 structure translate to differences in function.1 Studies in experimental models have implicated retinal endothelial CD44 in leukocyte trafficking in posterior uveitis,4 and choroidal endothelial CD44 in the neovascularization that characterizes wet age-related macular degeneration (AMD).5 Human retinal and choroidal endothelial cells express CD44.6 Surprisingly, however, the CD44 isoform(s) present in these cell populations are unknown. Using standard RT-PCR and dye-terminator sequencing, and human primary ocular endothelial cell isolates, we confirmed the presence of standard CD44 and investigated the potential expression of CD44 variants in human retinal and choroidal endothelial cells. Retinal and choroidal endothelial cells were isolated from paired eyes of 5 human cadaver donors with no history of ocular pathology, according to our previously described method.6 In brief, isolation involved type II collagenase (Sigma-Aldrich, St. Louis, MO) and Dispase (GIBCO-Invitrogen, Grand Island, NY) digestion of dissected tissue, followed by endothelial purification using magnetic Dynabeads (Dynal-Invitrogen, Brown Deer, WI) conjugated to murine anti-human CD31 antibody (BD Pharmingen, San Diego, CA). Timing was as short as practical to minimize processing-related gene expression changes; isolation was commenced 14 to 19 hours after death, and cells were used in experiments at passage 2 to 5. Total RNA was prepared from confluent endothelial cultures, using the RNeasy Mini Kit (Qiagen, Valencia, CA) with optional on-column DNAse treatment, and cDNA was synthesized using the iScript cDNA Synthesis Kit (Bio-Rad, Hercules, CA). The PCR was performed on a GeneAmp PCR System 9700 Thermal Cycler (Applied Biosystems, Carlsbad, CA), using published primers designed to recognize sequence in invariant CD44 exons 4 (forward: 5’- ACATCAGTCACAGACCTGCC -3’) and 17 (reverse: 5’- GCAAACTGCAAGAATCAAAGCC-3),3 as well as GAPDH (5’-AGCTGAACGGGAAGCTCACTGG-3’ and 5-GGAGTGGGTGTCGCTGTGAAGTC-3’).6 Additional PCRs were performed using forward primers for variant CD44 exons 6 (5’- CCTGGGATTGGTTTTCATGGTT -3’), 8 (5’- AACCAGGACTGGACCCAGTGGAA -3’), 10 (5’- AGGAACAGTGGTTTGGCAAC-3’) and 12 (5’- GACAGGACCTCTTTCAATGAC -3’), designed in-house, and the reverse primer for invariant exon 17. All CD44 PCR products was purified with QIAquick Gel Extraction kit (Qiagen, Valencia, CA) and sequenced on the ABI 3130xl Genetic Analyzer (Applied Biosystems). By RT-PCR using primers located at either side of the variant exon sequence in the extracellular domain of CD44, we confirmed the expression of standard CD44 in retinal and choroidal endothelial cells from the five human donors. In addition, with forward primers located within the variant exon sequence and a reverse primer in conserved sequence, we detected 10 alternatively spliced transcripts containing one or more of the 9 variant exons, although interestingly, choroidal endothelial cells from some donors did not express all isoforms (Table 1). Table 1 Exonic sequence of the variable segment of the extracellular domain in CD44 variant isoforms. Nine alternatively spliced exons (i.e., exons 6 – 14) encode for variants. Results are for human retinal and choroidal endothelial isolates from 5 human ... Our work demonstrates that, not unexpectedly, human retinal and choroidal endothelial cells express standard CD44. However, and importantly, multiple variant CD44 isoforms are synthesized by these cell types, although not universally. We identified 10 variant isoforms in both ocular endothelial cell populations, with all variant exons represented, and we anticipate additional isoforms would be detected by other methods. CD44 has been identified as a potential therapeutic target in ocular vascular disease.5 Given that the function of CD44 may vary, depending on the isoform, our findings have implications for further studies in this area. In such work, it would be critical to identify the specific CD44 isoform(s) involved in any pathological process(es) responsible for the disease in question. The potential for donor-specific splicing events should be an additional consideration.

Pathogenesis of Liver Injury in Acute Liver Failure

Acute liver failure (ALF) represents the most severe damage an organ can sustain and can lead to shock, coagulopathy, altered mentation, cerebral edema, renal failure, infection, and, ultimately, multiorgan failure. The US Acute Liver Failure Study Group (ALFSG; available at: acuteliverfailure.org), convened a meeting on October 17 and 18, 2011, and included clinical, translational and fundamental investigators to discuss the pathogenesis of acute hepatocyte injury, how it occurs, and its downstream effects. The ALFSG has, for the past 14 years, carefully collected detailed clinical information and bio-samples from roughly 2000 patients with ALF at 24 tertiary medical centers across the United States. This meeting sought to summarize our current understanding of the pathogenetic factors that drive acute liver injury. These included consideration of (1) the contribution of innate immunity to liver injury, (2) the role of cytokine release in perpetuating liver injury and causing multiorgan failure, (3) mechanisms of apoptosis in ALF, (4) alterations in signal transduction with a focus on the role of c-Jun N-terminal kinase (JNK), (5) the contribution of infection to the pathogenesis of ALF, (6) the emerging centrality of inflammasome and sterile inflammation in the pathogenesis of ALF, (7) systems biology approaches to integrating and ordering the wide array of seemingly massively perturbed effectors in ALF, (8) host genetics and its contribution to ALF susceptibility, including a consideration of the power of next generation sequencing tools as they relate to ALF, and (9) contribution of liver regeneration to counteraction of ALF. Finally, we considered novel therapeutic strategies for ALF based on these pathogenetic concepts.

Gottron's Papules Exhibit Dermal Accumulation of CD44 Variant 7 (CD44v7) and Its Binding Partner Osteopontin: A Unique Molecular Signature

The accumulated mucin in non-Gottron’s dermatomyositis (DM) lesions is primarily chondroitin-4-sulfate (C4S), which is immunomodulatory in vitro. Gottron’s papules are a particularly resistant manifestation of DM that often persist after other lesions have resolved with therapy. We examined non-Gottron’s DM lesions and Gottron’s papule skin biopsies for C4S, CD44v7, a CS-binding isoform causally implicated in autoimmunity, and osteopontin, a CD44v7 ligand implicated in chronic inflammation. Gottron’s papule dermis contained more C4S and CD44v7 than non-Gottron’s lesions. Normal skin showed less CD44v7 over joints relative to Gottron’s lesions. All DM dermis had increased osteopontin compared to healthy skin. Mechanically stretching cultured fibroblasts for six hours induced CD44v7 mRNA and protein, while IFN-γ treatment induced OPN mRNA and protein. Osteopontin alone did not induce CD44v7, but stretching dermal fibroblasts in the presence of osteopontin increased THP-1 monocyte binding, which is blunted by anti-CD44v7 blocking antibody. C4S, CD44v7, and osteopontin are three molecules uniquely present in Gottron’s papules that contribute to inflammation individually and in association with one another. We propose that stretch-induced CD44v7 over joints, in concert with dysregulated osteopontin levels in the skin of DM patients, increases local inflammatory cell recruitment and contributes to the pathogenesis and resistance of Gottron’s papules.

The regulation of stem-like property in gastric cancer cells mediated by tumor associated macrophage.

e13553 Background: CD44 has recently been identified as one of the cell surface markers associated with cancer stem cells (CSCs) in several types of tumor. We have reported the functional role of CD44 variant isoform in the maintenance of low reactive oxygen species (ROS) levels in gastrointestinal cancer cells. Previous studies demonstrated that tumor associated macrophage promotes tumor progression, but the functional role for macrophage in the regulation of CSC marker expression is not known. Methods: We analysed the relationship of CSCs and macrophage infiltration in gastric cancer cell lines and human gastric cancer samples. Results: Here, we showed activated macrophage by LPS and IFNγ produces inflammatory cytokines and chemokines, and these macrophage express CD68 and CD163, which are known as specific markers for pan-macrophage and M2 macrophage. we found that co-culture with activated macrophage triggers the CD44 and Bmi1 expression in gastric cancer cells and promote stem-like property that possess sphere-forming ability. Furthermore, we investigated the relation between CD44 expression and infiltrated macrophage in human gastric cancer. The staining patterns of CD44, Bmi1 and macrophage specific markers (CD68 and CD163) were significantly correlated in tumorous tissues of human gastric adenocarcinoma. Conclusions: These findings establish inflammatory cytokines, which producted from activated macrophage, induce the CD44 and Bmi1 expression in gastric cancer cells. These findings revealed that a role for tumor associated macrophage in the expansion of gastric cancer stem-like cells and subsequent malignant progression.

Abstract 4436: Chronic inflammation and gastric carcinogenesis: the role of CD44 variant expression

Abstract CD44 is a marker of tumor-initiating cells in gastric cancer. Recently, we have reported that a CD44 variant (CD44v) interacts with xCT, a glutamate-cystine transporter, and manifests enhanced protection against reactive oxygen species (ROS), contributing to tumor growth and resistance to chemo- or radiotherapy. Although an inflammation related metaplasia and/or dysplasia of gastric epithelium is considered as key events in gastric carcinogenesis, the cause or process of these phenomena is not known. We investigated the relationship between CD44v expression and gastric carcinogenesis, using three lineages of gastric cancer mouse models, K19-Wnt1, K19-C2mE, and K19-Wnt1/C2mE mice. We also used CD44-/- K19-Wnt1/C2mE mice and Helicobacter. felis-infected C57BL/6 mice. Chronic inflammation triggered by Helicobactor infection played a major role in CD44v related gastric carcinogenesis. CD44v expression and nuclear factor-kappa B (NF-κB) activation were promoted by inflammatory cytokines, IL-1α and TNF-α, in gastric cancer cell lines. Thus, CD44v+ tumor cell expansion induced by inflammation via NF-κB pathway might contribute to tumor development. Finally, an xCT inhibitor sulfasalazine treatment significantly suppressed tumor growth in K19-Wnt1/C2mE mice. These findings suggest a significant role of CD44v in inflammation-mediated gastric carcinogenesis via ROS defense. Citation Format: {Authors}. {Abstract title} [abstract]. In: Proceedings of the 103rd Annual Meeting of the American Association for Cancer Research; 2012 Mar 31-Apr 4; Chicago, IL. Philadelphia (PA): AACR; Cancer Res 2012;72(8 Suppl):Abstract nr 4436. doi:1538-7445.AM2012-4436

Abstract 1527: CD44v9 involving in multiple myeloma cells adhesion to bone marrow stromal cell promotes bone erosion by augmenting the activation of HGF-receptor/cMet

Abstract The main aim of our study is to determine the significance of the stromal microenvironment in the malignant behavior of multiple myeloma cells. The stroma-derived growth factors/cytokines and hyaluronan act in autocrine/paracrine ways with their receptors, including receptor-tyrosine kinases and CD44 variants (CD44v), to potentiate and support multiple myeloma cell survival. In this study, we found that CD44s and CD44 variants were differentially expressed between fraction of CD138+ fraction and CD138- fraction. Expression levels of CD44v6, CD44v9, and CD44v10, respectively, correlated with bone erosion (p=0.029, p=0.013, p=0.032), suggesting that CD44 variant molecules are involved in multiple myeloma progression. Binding studies using CD44 isoform specific reagents showed that CD44v6 and CD44v9 were involved in binding to bone marrow stromal cells, but not to in vitro synthesized ECM. In 3D culture, CD44v6 and CD44v9-mediated plasma cell binding resulted in a significant induction of HGF secretion by bone marrow stromal cells. CD44v6 and CD44v9-mediated plasma cell binding significantly induces PI3K/Akt via activation the Src-kinase Lyn. In bone marrow serum of MM patients, the expression levels of IL-6, OPN, and hepatocyte growth factor (HGF), respectively, statistically correlated with bone erosion of MM patients (p=0.021, p=0.001, p=0.036). HGF derived from bone marrow stromal cells with multiple myeloma cells stimulates CD44 signaling via activation of HGF-receptor/cMet. Specific CD44 shRNA suppresses HGF-mediated CD44 signaling. Taken together, the role of CD44 variants in adhesion induced HGF- secretion may explain the previously observed correlation between CD44 variants expression and adverse prognosis in multiple myeloma. Citation Format: {Authors}. {Abstract title} [abstract]. In: Proceedings of the 103rd Annual Meeting of the American Association for Cancer Research; 2012 Mar 31-Apr 4; Chicago, IL. Philadelphia (PA): AACR; Cancer Res 2012;72(8 Suppl):Abstract nr 1527. doi:1538-7445.AM2012-1527

Abstract 300: Blockage of OPN induction via HGF/cMET signaling in multiple myeloma cells suppresses both MMP9 expression and RUNX2 expression of BMSCs associating with bone erosion of MM patients

Abstract Dynamic interaction between multiple myeloma cells (MM) and bone marrow stromal cells plays critical roles in progression of MM. Hepatocyte growth factor (HGF), one of these factors, as a c-Met ligand, activates mitogenic activation protein kinase (MAPK). OPN binds with integrins and CD44 variants and activates cell signaling involved in invasiveness, angiogenesis and bone remodeling. Increasing lines of evidence provide that HGF and OPN, respectively, associate with the progression of MM. However, the role of HGF in MM largely remains unknown. In bone marrow serum of MM patients, HGF expression correlated with OPN expression (p=0,0095), suggesting that HGF derived from bone marrow stromal cells stimulates OPN expression in MM cells. Firstly, we found that expression levels of OPN in HFG-treated MM cells (fraction of CD138+ cells) obtained from MM patients was higher than either HFG-treated bone marrow stromal cells or HFG-treated MM cells (fraction of CD138- cells). Also, induction of DKK1 by HGF, suggesting the inhibition of osteogenesis, was found in U266 cells and RPMI8226, Both HGF-mediated MAPK and PI3K/AKT results in activating NF-kB and increasing OPN expression and DKK1. Those expressions were effectively down-regulated in U266 cells transfected with shRNA c-MET. RUNX2 mRNA and MMP-9 mRNA was increased in bone marrow stromal cells (BMSCs) treated with OPN. In addition, combined cMET inhibitor and PI3K inhibitor effectively inhibited the RUNX2 and the MMP9 mRNA expression in both OPN alone treatment and co-treatment with OPN and HGF in BMSCs. Taken together, since Induction of OPN and DKK1 by HGF in MM cells could be one of the major factors for the progression of MM through interaction of MM cells and BMSCs, blockage of HGF/cMET signaling leading to increasing levels of OPN and DKK1 may help to prevent from progressing bone erosion of MM patients. Citation Format: {Authors}. {Abstract title} [abstract]. In: Proceedings of the 103rd Annual Meeting of the American Association for Cancer Research; 2012 Mar 31-Apr 4; Chicago, IL. Philadelphia (PA): AACR; Cancer Res 2012;72(8 Suppl):Abstract nr 300. doi:1538-7445.AM2012-300

Abstract LB-227: Pilot clinical trials of FSPG (BAY 94-9392): An 18F-labeled glutamate derivative for PET imaging of system xC- activity in tumors

Abstract Visualizing adaptations of tumor metabolism by employing positron emission tomography (PET) with a specific imaging probe has the potential to better characterize tumors with higher sensitivity and specificity. The glutamate-cystine exchanger (system xC-, a SLC7A11/SLC3A2 heterodimer) is an important transporter in tumor cells and a promising new target for imaging. This exchanger transports the amino acids L-cystine and L-glutamate, thus providing a rate-limiting precursor for glutathione biosynthesis. This contributes to redox maintenance, which is especially important in tumor cells. Recently, it was reported that a splice variant of the stem cell marker CD44 stabilizes the xCT subunit of system xC- at the cell membrane and promotes its proper function. FSPG (BAY 94-9392) is an 18F-labeled glutamate derivative that provides specific visualization of system xC- activity with PET/CT. Through this multicenter pilot trial, FSPG has successfully been translated into cancer patients and shows favorable pharmacokinetics and an absence of adverse events. A favorable biodistribution pattern previously seen in mice was also confirmed in these patients with different tumor types. A high lesion detection rate (80-100%) was found in lung cancer (n=10), hepatocellular cancer (n=5), head and neck cancer (n=5), and colorectal cancer (n=5) patients who also had positive FDG-PET/CT scans. Importantly, very low background uptake in healthy brain parenchyma enabled the detection of high-grade brain cancers as well as small brain metastases and skull base lesions (n=4) not well seen with FDG-PET. Primary breast tumors (n=4) and a low-grade brain tumor, however, showed minimal uptake of FSPG. Immunohistochemical (IHC) analyses on these subjects’ pathology samples showed significant correlation between FSPG uptake and protein expression of both the xCT subunit and CD44. In breast tumor samples specifically, IHC showed that absence of CD44 results in low signal from FSPG-PET even if xCT is present, indicating the importance of CD44 co-expression for system xC- function. Future clinical studies will further explore the potential of this compound in additional tumor types and expand upon the initial findings in a larger number of subjects. Here we present the first clinical examples demonstrating the ability of the tracer to measure system xC- activity in patients. FSPG-PET/CT may provide improved characterization and sensitivity of tumor detection in patients and further improve the understanding of the role of system xC- in cancer biology. It could be a valuable tool for improved tumor classification in patients, linking uptake of the tracer with malignancy and cancer stem cell properties of tumors. Furthermore, the ability to noninvasively probe this important pathway in humans may allow for more rational treatment planning, patient stratification and better development of new drugs. Citation Format: {Authors}. {Abstract title} [abstract]. In: Proceedings of the 103rd Annual Meeting of the American Association for Cancer Research; 2012 Mar 31-Apr 4; Chicago, IL. Philadelphia (PA): AACR; Cancer Res 2012;72(8 Suppl):Abstract nr LB-227. doi:1538-7445.AM2012-LB-227

CD44 variant isoforms are specifically expressed on peripheral blood lymphocytes from asthmatic patients

Asthma is a disease characterized by chronic airway inflammation, and Th2 cells play a critical role in initiating and sustaining asthmatic inflammation. It has been shown that CD44 expressed on CD4(+) T cells plays a critical role in the accumulation of antigen-specific Th2 cells in the development of airway hyperresponsiveness induced by antigen challenge in the airways. The aim of this study was to determine whether there are specific CD44 variant isoforms (CD44v) expressed on lymphocytes from asthmatic patients. We collected whole blood samples from 103 normal subjects, 165 subjects with asthma and 104 with pneumonia. Peripheral blood lymphocyte isolation was performed, and total RNA was extracted from the isolated lymphocytes, using nested PCR for specific CD44v amplification on lymphocytes. Demographic variables were analyzed using linear regression in order to determine whether the expression of CD44v was correlated with these demographic features. The nested PCR results revealed that CD44v5 was expressed by 55.2% of asthma patients, which was significantly higher than levels of expression in the other groups. Lower percentages of individuals in the normal subject group exhibited expression of CD44v5 and CD44v6. The data demonstrated that the percentage of individuals in the pneumonia group expressing CD44v5 was 29.0%, but a higher percentage of these patients expressed CD44v6. CD44v5 expression was positively correlated with IgE levels (p=0.032) in the asthmatic patient group, and CD44v6 was significantly positively correlated with the neutrophil count (p<0.05). CD44v5 was expressed by a higher proportion of asthmatic patients than other subjects and thus may play an important role in the pathogenesis of asthma. These findings may offer a new target for the diagnosis and treatment of asthma and may also provide insights into the mechanisms of asthma development.

Detection and Clinical Significance of Lymph Node Micrometastasis in Gastric Cardia Adenocarcinoma

Lymph node micro metastasis was investigated in gastric cardia adenocarcinoma (GCA) patients without lymph node metastasis on routine pathological examination. The relationship between micrometastasis and clinicopathological features was also evaluated. A total of 349 lymph nodes were obtained from 45 patients with GCA. Micrometastases were detected by immunohistochemical staining for the markers cytokeratin 19 (CK19) and CD44 variant 6 (CD44v6). A total of 33 lymph nodes (9.5%) from 15 patients (33.3%) were positive for CK19. Of these, 27 lymph nodes (7.7%) from 12 patients (26.7%) were also positive for CD44v6. Micrometastasis was significantly related to depth of tumour invasion and Lauren classification (intestinal or diffuse). The recurrence rate was significantly higher and 2-year survival rate significantly lower in patients with than in those without lymph node micrometastasis, showing the necessity of detecting micrometastasis in GCA patients who test negative for lymph node metastasis on routine examination. CK19 and CD44v6 were shown to be good markers for micrometastasis detection.

CD44 Expression in Oro-Pharyngeal Carcinoma Tissues and Cell Lines

Expression of CD44, a transmembrane hyaluronan-binding glycoprotein, is variably considered to have prognostic significance for different cancers, including oral squamous cell carcinoma. Although unclear at present, tissue-specific expression of particular isoforms of CD44 might underlie the different outcomes in currently available studies. We mined public transcriptomics databases for gene expression data on CD44, and analyzed normal, immortalized and tumour-derived human cell lines for splice variants of CD44 at both the transcript and protein levels. Bioinformatics readouts, from a total of more than 15,000 analyses, implied an increased CD44 expression in head and neck cancer, including increased expression levels relative to many normal and tumor tissue types. Also, meta-analysis of over 260 cell lines and over 4,000 tissue specimens of diverse origins indicated lower CD44 expression levels in cell lines compared to tissue. With minor exceptions, reverse transcribed polymerase chain reaction identified expression of the four main isoforms of CD44 in normal oral keratinocytes, transformed lines termed DT and HaCaT, and a series of paired primary and metastasis-derived cell lines from oral or pharyngeal carcinomas termed HN4/HN12, HN22/HN8 and HN30/HN31. Immunocytochemistry, Western blotting and flow cytometric assessments all confirmed the isoform expression pattern at the protein level. Overall, bioinformatic processing of large numbers of global gene expression analyses demonstrated elevated CD44 expression in head and neck cancer relative to other cancer types, and that the application of standard cell culture protocols might decrease CD44 expression. Additionally, the results show that the many variant CD44 exons are not fundamentally deregulated in a diverse range of cultured normal and transformed keratinocyte lines.

Lack of CD44 variant 6 expression in rectal cancer invasive front associates with early recurrence

To investigate the prognostic value of CD44 variant 6 (CD44v6), a membranous adhesion molecule, in rectal cancer. Altogether, 210 rectal cancer samples from 214 patients treated with short-course radiotherapy (RT, n = 90), long-course (chemo) RT (n = 53) or surgery alone (n = 71) were studied with immunohistochemistry for CD44v6. The extent and intensity of membranous and cytoplasmic CD44v6 staining, and the intratumoral membranous staining pattern, were analyzed. Membranous CD44v6 expression was seen in 84% and cytoplasmic expression in 81% of the cases. In 59% of the tumors with membranous CD44v6 expression, the staining pattern in the invasive front was determined as "front-positive" and in 41% as "front-negative". The latter pattern was associated with narrower circumferential margin (P = 0.01), infiltrative growth pattern (P < 0.001), and shorter disease-free survival in univariate survival analysis (P = 0.022) when compared to the "front-positive" tumors. The lack of membranous CD44v6 in the rectal cancer invasive front could be used as a method to identify patients at increased risk for recurrent disease.

Characteristics of CD44 alternative splice pattern in the course of human colorectal adenocarcinoma progression

BackgroundCD44 is considered as ‘a’ metastasis associated gene, despite the fact that it is an umbrella term for a group of molecules produced from a single gene by alternative splicing. However, little consideration is given to the above in the literature of colorectal carcinomas as well as other tumour types, leading to confusion and contradictory results about its possible role in tumour progression.MethodsWe compared the CD44 alternative splice pattern (ASP) of three genetically different human colorectal cancer cell lines (HT25, HT29, HCT116) using a series of PCR reactions and next- generation sequencing method, as well as identified a colorectal adenocarcinoma specific CD44 ASP. This ASP was further investigated in terms of its qualitative and quantitative stability in our experimental iso- and xenograft mouse models for colorectal cancer progression. A complex preclinical experimental set-up was established to separately test the different steps of tumour progression and the role of tumour microenvironment, respectively, focusing on the role of ‘CD44’ in this process.ResultsWe managed to present a colorectal cancer-specific CD44 ASP, which remained unchanged from cell lines throughout primary tumour formation and metastatic progression. Furthermore, we report a unique roster of all expressed CD44 variant isoforms characteristic to colorectal cancer. Finally, on quantitative assessment of the variable exons v3 and v6, higher co-expression levels were found to be characteristic to metastatically potent tumour cells.ConclusionParticular CD44 variant isoforms seem to act as “metastasis genes” via tumour microenvironment-driven shifts in v3 and v6 expressions. However, this function may just affect a minority of tumour subclones. This fact and the huge potential number of different CD44 splice variants that can contain v3 and v6 domains can explain incoherence of clinical studies regarding functional asessment of CD44 variants, as well as diminish the chances of using CD44 variants for predictive purpose.

Alternative splicing of CD44 mRNA by ESRP1 enhances lung colonization of metastatic cancer cell

In cancer metastasis, various environmental stressors attack the disseminating cells. The successful colonization of cancer cells in secondary sites therefore requires the ability of the cells to avoid the consequences of such exposure to the stressors. Here we show that orthotopic transplantation of a CD44 variant isoform-expressing (CD44v(+)) subpopulation of 4T1 breast cancer cells, but not that of a CD44v(-) subpopulation, in mice results in efficient lung metastasis accompanied by expansion of stem-like cancer cells. Such metastasis is dependent on the activity of the cystine transporter xCT, and the stability of this protein is controlled by CD44v. We find that epithelial splicing regulatory protein 1 regulates the expression of CD44v, and knockdown of epithelial splicing regulatory protein 1 in CD44v(+) cells results in an isoform switch from CD44v to CD44 standard (CD44s), leading to reduced cell surface expression of xCT and suppression of lung colonization. The epithelial splicing regulatory protein 1-CD44v-xCT axis is thus a potential therapeutic target for the prevention of metastasis.

Development of an MRI-visible nonviral vector for siRNA delivery targeting gastric cancer

An antibody-directed nonviral vector, polyethylene glycol-grafted polyethylenimine functionalized with superparamagnetic iron oxide nanoparticles and a gastric cancer-associated CD44v6 single-chain variable fragment (scFvCD44v6,-PEG-g-PEI-SPION), was constructed as a gastric cancer-targeting and magnetic resonance imaging (MRI)-visible nanocarrier for small interfering RNA (siRNA) delivery. Biophysical characterization of PEG-g-PEI-SPION and scFvCD44v6-PEG-g-PEI-SPION was carried out, including siRNA condensation capacity, cell viability, and transfection efficiency. Both the targeting and nontargeting nanocarriers were effective for transferring siRNA in vitro. The cellular uptake and distribution of nanoparticles complexed with siRNA was analyzed by fluorescence imaging and immunofluorescent staining. Moreover, the gastric cancer-targeting effect was verified in vivo by MRI and histology analysis. These results indicate that scFvCD44v6-PEG-g-PEI-SPION is a promising nonviral vector for gastric cancer gene therapy and diagnosis.

Relationship between CD44 expression or glycosylation and hepatocellular carcinoma metastasis

To explore the relationship of CD44 expression or glycosylation and hepatocellular carcinoma (HCC) metastasis. IHC, Quantum dots detection, RT-PCR, Western blot, Cellular immune fluorescence and MS-PCR were used to identify CD44 expression in HCC samples and a series of human HCC cell lines with different metastatic potentials. Lectin array was used to reveal the relationship of CD44v6 glycosylation and human HCC metastasis. Immunohistochemistry analysis showed that CD44v6 was mainly distributed on the cell membrane, while CD44S immunoreactivity was prominently in the cytoplasm, CD44v3 and CD44v4/5 were in cytoplasm on membrane. Among CD44S and those CD44 variants, only the expression of CD44v6 was higher in metastasis HCC samples as compared to that in non-metastasis group (x²=8.828, P less than 0.05). This result was also re-confirmed by the result of Quantum dots (t = 2.392, P < 0.05) and serum detection (t = 2.56, P < 0.05). We found completely methylation of CD44v6 gene in Hep3B and incomplete methylation in MHCC97H and MHCC97L cell lines with metastatic potentials. The lectin affinity assay indicated that lectin MAL, SNA and WGA showed more affinity to MHCC97H and MHCC97Lcell lines than that of the non-metastatic Hep3B cell lines. CD44v6 over-expression presents a positive correlation with HCC metastatic potential, which may be associated with DNA methylation level in promoter sequence. The increasing sialic acid modified glycan of CD44v6 might be related to HCC metastatic ability.

Cd44s and Cd44v6 Expression is Associated with Improved Survival in Malignant Fibrous Histiocytoma

The value of new prognostic markers are currently being investigated as potential adjuvant and/or palliative treatment options in the management of soft tissue sarcomas (STS). Several recent studies have shown that CD44 expression is associated with a better outcome in select cancers as bladder tumors. The aim of this study was to evaluate the expression of CD44 in STS of the adult and to determine whether CD44 expression correlates with the clinical outcome. We examined the clinical outcome of 34 adult MFH patients (19 men and 15 women, average age 62 years, median 63 years, ranged from 38 to 88 years) who underwent curative treatment for STS. The majority of patients received adjuvant radiotherapy (n = 25). No patient received initial adjuvant chemotherapy. The expressions of CD44, CD44 isoforms and the reference genes beta-actin and beta-microglobulin were analyzed by quantitative real-time PCR. For relative quantification and to normalize the amount of the CD44 product and the CD44 isoform products, the delta-CT method using the expression of the reference genes beta-actin or beta-microglobulin was used. High CD44s expression levels were positively correlated with a lower tumor-related death (p < 0.05, log-rank test 3.85). Conversely, high expression levels of hCD44 were negatively correlated with a tumor-related death and with a median survival of 43 months as compared to 61 months in patients with low expression levels. In the three analyzed variants of CD44, high expression levels of CD44v6 and CD44v8 correlated negatively with the tumor-related survival. Multivariate prognostic risk factors based on the Cox proportional-hazards regression model included three variables: CD44s (p = 0.006), CD44v6 (p = 0.003) as well as resection quality (p = 0.03) and were all identified as significant parameters of survival. Low expression levels of CD44s as well as high expression levels of CD44v6 and CD44v8 correlate with poor outcome.

Identification of Specific Chondroitin Sulfate Species in Cutaneous Autoimmune Disease

Cutaneous lupus erythematosus and dermatomyositis (DM) are chronic inflammatory diseases of the skin with accumulated dermal mucin. Earlier work has shown chondroitin sulfate (CS) accumulation within the dermis of discoid lupus erythematosus (DLE), subacute cutaneous lupus erythematosus (SCLE), and DM lesions compared with control skin. Immunohistochemistry for C4S revealed a greater density in DLE and DM lesions, whereas SCLE lesions did not differ from controls. Scleredema and scleromyxedema are attributed to increased hyaluronic acid, and lesional samples from these diseases also demonstrated accumulated dermal C4S. Interferon-γ and interleukin-1α, but not interferon-α, treatment of cultured dermal fibroblasts induced mRNA expression of CHST-11, which attaches sulfates to the 4-position of unsulfated chondroitin. These studies on possible CS core proteins revealed that serglycin, known to have C6S side chains in endothelial cells, had greater density within DM dermal endothelia but not in DLE or SCLE, following the pattern of C6S overexpression reported previously. CD44 variants expand the CS binding repertoire of the glycoprotein; CD44v7 co-localized to the distribution of C4S in DLE lesions, a finding not observed in DM, SCLE lesions, or controls. Because C4S and C6S have immunologic effects, their dysregulation in cutaneous mucinoses may contribute to the pathogenesis of these disorders.

Single-molecule binding of CD44 to fibrin versus P-selectin predicts their distinct shear-dependent interactions in cancer

P-selectin and fibrin(ogen) have pivotal roles in the hematogenous dissemination of tumor cells. CD44 variant isoforms, CD44v, have been identified as the major functional P-selectin ligands and fibrin receptors on metastatic colon carcinoma cells. The molecular recognition of CD44v by fibrin mediates firm adhesion at low shear, whereas CD44v-P-selectin binding supports transient rolling interactions at elevated shear stresses and low site densities of P-selectin. We used single-molecule force spectroscopy to provide a molecular interpretation for these two distinct adhesion events. The CD44v-P-selectin bond has a longer unstressed equilibrium lifetime, a lower reactive compliance and a higher tensile strength relative to the CD44v-fibrin bond. These intrinsic differences confer the ability to the CD44v-P-selectin pair to mediate binding at higher shear stresses. Increasing the duration of receptor-ligand contact (2-200 milliseconds) did not affect the micromechanical properties of the CD44v-P-selectin bond, but it increased the tensile strength and the depth of the free energy barrier of the CD44v-fibrin bond and decreased its reactive compliance. This bond strengthening at longer interaction times might explain why CD44v binding to immobilized fibrin occurs at low shear. Single-molecule characterization of receptor-ligand binding can predict the shear-dependent adhesive interactions between cells and substrates observed both in vitro and in vivo.

785. Targeting of Myeloid Leukemia Stem Cells through Genetic Redirection of T Cells Against CD44 Variant 6

785. Targeting of Myeloid Leukemia Stem Cells through Genetic Redirection of T Cells Against CD44 Variant 6