CCR5-Delta32 Mutation Research Articles

Knowledge From London and Berlin: Finding Threads to a Functional HIV Cure.

Despite the ability of combination antiretroviral therapy (cART) to increase the life expectancy of patients infected with human immunodeficiency virus (HIV), viral reservoirs persist during life-long treatment. Notably, two cases of functional cure for HIV have been reported and are known as the “Berlin Patient” and the “London Patient”. Both patients received allogeneic hematopoietic stem cell transplantation from donors with homozygous CCR5 delta32 mutation for an associated hematological malignancy. Therefore, there is growing interest in creating an HIV-resistant immune system through the use of gene-modified autologous hematopoietic stem cells with non-functional CCR5. Moreover, studies in CXCR4-targeted gene therapy for HIV have also shown great promise. Developing a cure for HIV infection remains a high priority. In this review, we discuss the increasing progress of coreceptor-based hematopoietic stem cell gene therapy, cART, milder conditioning regimens, and shock and kill strategies that have important implications for designing potential strategies aiming to achieve a functional cure for the majority of people with HIV.

Generation of HIV-1-infected patients' gene-edited induced pluripotent stem cells using feeder-free culture conditions.

The discovery of induced pluripotent stem cells (iPSC) has brought promise to regenerative medicine as it breaks the ethical barrier of using embryonic stem cells. Such cell culture-derived patient-specific autologous stem cells are needed for transplantation. Here we report deriving HIV-1-infected patients' iPSC lines under transgene-free methods and under feeder-free and xeno-free culture conditions to meet the requirement for clinical application. We have reprogrammed patients' peripheral blood mononuclear cells with EBNA1/OriP episomal vectors, or a defective and persistent Sendai virus vector (SeVdp) to ensure a nonintegrating iPSC generation. Both single picked and pooled iPSC lines demonstrated high pluripotency and were able to differentiate into various lineage cells in vivo. The established cell lines could be modified by genetic editing using the TALENs or CRISPR/Cas 9 technology to have a bi-allelic CCR5Δ32 mutations seamlessly. All generated iPSC lines and modified cell lines had no evidence of HIV integration and maintained normal karyotype after expansion. This study provides a reproducible simple procedure for generating therapeutic grade iPSCs from HIV-infected patients and for engineering these cells to possess a naturally occurring genotype for resistance to HIV-1 infection when differentiated into immune cells.

359. TLR7 Gene Polymorphisms Influence Development of Hepatic Fibrosis in HCV/HIV Coinfection

BackgroundHepatic fibrosis in individuals with HCV/HIV coinfection or HCV mono-infection may be modulated by a variety of host factors. In this study, we investigated the role of gene polymorphisms of putative genes that might influence fibrosis progression including MICA (rs2596542), interferon-stimulated gene OAS2 (rs1293762) and the pathogen recognition receptors TLR7 (rs179009) and TLR9 (rs187084). Effect on a cytokine panel was evaluated.MethodsLongitudinal samples were obtained from subjects enrolled in the NCI Multicenter Hemophilia Cohort Study. Within the cohort, a subset of subjects were included based upon presence or absence of the CCR5 delta-32 mutation which was previously shown to influence the rate of fibrosis progression. Hepatic fibrosis change was determined using the serum-derived Enhanced Liver Fibrosis (ELF) Index. Four putative genes with polymorphisms that have been previously associated with the development or progression of hepatic fibrosis were evaluated using Taqman SNP genotyping assays. Cytokine assays were performed using Luminex chipsets. Samples were analyzed using Statistix 10.0 using ANOVA and least square regression models.Results58 unique subjects were evaluated. The mean age was 38 years, and all were male. 74% were HIV infected and 97% were HCV infected (76.8% coinfection). Controlling for the effect of CCR5, only the TLR7 A -> G polymorphism was predictive of change in the ELF Index. There was no statistically significant predictive difference between genotypes in the other three polymorphisms. Subjects with the TLR7 A allele (n = 47) had an average increase in ELF of 0.79 units, while the G allele (n = 11) had an increase in ELF of 2.1 units (P = 0.008). A regression model identified TLR7 as a key factor in ELF change, as well as HCV/HIV coinfection. Interferon alfa-2 levels were highly associated (increased, P = 0.0007) with the TLR7 A -> G polymorphism, while RANTES levels were inversely associated (decreased, P = 0.0443) with it.ConclusionOf the gene polymorphisms investigated, only TLR7 (rs179009) is an independent predictor of development of hepatic fibrosis in HCV/HIV coinfected subjects. The mechanism may involve modulation of inflammatory response pathways.Disclosures All authors: No reported disclosures.

The efficacy of CRISPR-Cas9-mediated induction of the CCR5delta32 mutation in the human embryo

Изменение гена CCR5 путем редактирования генома CD4+-T-клеток является одним из способов предотвращения распространения ВИЧ-1-инфекции. Однако похожая стратегия защиты от ВИЧ может быть использована и для защиты плода ВИЧ-инфицированных женщин со слабым ответом на антиретровирусную терапию. Создание «естественного» аллеля CCR5delta32 на стадии зиготы может защитить плод от ВИЧ-инфекции во время внутриутробного развития и родов. Целью данного исследования была оптимизация системы CRISPR-Cas9 под создание гомозиготной 32-нуклеотидной делеции (аналогичной природному варианту CCR5delta32) в S-фазе зиготы человека. Для редактирования генома были использованы зиготы с аномальным числом пронуклеусов (более двух), непригодные для ЭКО. 16 аномальных зигот от доноров с WT CCR5 были инъецированы разработанной системой CRISPR-Cas9 в S-фазе. После инъекции зиготы помещали в культуральную среду Blastocyst (COOK) и культивировали в течение 5 дней в CO2-инкубаторе до стадии бластоцисты (приблизительно 250 клеток). Для анализа эффективности редактирования генома 8 успешно развивавшихся эмбрионов были генотипированы методом полимеразной цепной реакции (ПЦР). Из 16 зигот, инъецированных системой CRISPR-Cas9, лишь 8 достигли стадии бластоцисты. ПЦР-генотипирование показало отсутствие исходного варианта WT CCR5 в 5 из 8 бластоцист (100% гомозиготы по CCR5delta32). Два эмбриона продемонстрировали около 3% и один — около 20% мозаицизма по WT CCR5. Таким образом, эффективность разработанной CRISPR-Cas9 системы для создания аллеля CCR5delta32 в эмбрионах человека довольно высока: более половины эмбрионов оказываются полностью модифицированными.

Эффективность создания делеции CCR5Ddelta32 методом CRISPR-Cas9 в эмбрионах человека

The editing of the CCR5 gene in the CD4+ T cell genome is an effective way of preventing HIV-1 proliferation. Very similar strategies can be used to protect the fetus of an HIV-infected female showing a weak response to antiretroviral therapy. Inducing the “natural” CCR5delta32 mutation in a zygote may guard the fetus against HIV infection both in utero and at birth. In this study, we optimize the CRISPR-Cas9 system to induce a homozygous 32-nt deletion similar to the naturally occurring CCR5delta32 allele in the human zygote at the S-phase. Edits were done in the abnormal tripronuclear zygotes unsuitable for IVF. Sixteen tripronuclear zygotes in the S-phase obtained from WT CCR5 donors were injected with an original CRISPR-Cas9 system designed by the authors. Upon injection, the zygotes were transferred into the Blastocyst (COOK) embryo culture medium and cultured for 5 days in a CO2 incubator until blastocysts were formed (approximately 250 cells). Eight zygotes that successfully developed into blastocysts were PCR-genotyped to analyze the efficacy of genome editing. Of 16 zygotes injected with CRISPR-Cas9, only 8 reached the blastocyst stage. PCR genotyping revealed the absence of the initial WT CCR5 variant in 5 of 8 blastocysts (100% CCR5delta32 homozygous). Two had about 3% and one about 20% of WT CCR5 mosaicism. This leads us to conclude that the efficacy of the proposed CRISPR-Cas9 system for the induction of the CCR5delta32 mutation in human embryos is very high producing more than 50% of completely modified embryos.

Modeling and Understanding the Biology of Transplant-Mediated HIV Cure in a Non-Human Primate Model

Background : The Berlin patient is thus far the only individual considered cured of HIV. Three aspects of the Berlin Patient's treatment are thought to have contributed to his cure following allogeneic hematopoietic stem cell transplantation (HCT): 1) the myeloablative conditioning regimen, 2) transplantation with HIV-resistant cells, and 3) graft-versus-host disease (GVHD). This cure occurred in the context of HCT from an unrelated donor whose cells contained two copies of the CCR5delta32 mutation, which rendered them resistant to CCR5-tropic viruses (the vast majority of the transmitted variants). He also developed GVHD, which is thought to have contributed to his cure by inducing a graft-versus-viral-reservoir (GVVR) effect. While it is still unknown which of these factors was critical to the cure achieved in this patient, the viral rebound observed following allogeneic transplantation with wild-type cells in two Boston patients suggests that HIV-resistance factors may be key to achieving a permanent HIV cure through HCT. Our lab has previously shown that transplantation with autologous unmodified hematopoietic stem cells is not sufficient to eradicate the viral reservoir in a non-human primate (NHP) model of infection. However, the relative contributions of myeloablative conditioning, GVVR, and HIV resistant cells to the clearance of the HIV reservoir have not been rigorously determined. To dissect the impact of each of these factors on the viral reservoir, we have developed the first NHP model of allogeneic bone marrow transplantation (BMT) in Simian/Human Immunodeficiency Virus (SHIV)-infected, combined antiretroviral therapy (cART)-treated rhesus macaques.Methods : We intravenously infected 6 animals with SHIV-1157ipd3N4 and left them untreated for six months, followed by six months of cART (PMPA, FTC, Raltegravir). 3 animals served as untransplanted controls, and 3 animals received haplo-identical BMT following myeloablative total body irradiation (1020 Gy) without cART discontinuation. Donor chimerism was monitored by molecular analysis and by flow cytometry. Plasma viral RNA was measured by RT-PCR, and cell-associated DNA and RNA were quantified by qPCR in 6 tissues longitudinally, and in >20 tissues at necropsy.Results : All animals showed peak SHIV plasma viral loads (1.5e7 copies/ml) 10-11 days post-infection, subsequently reaching viral set points. 1 of 6 animal controlled viremia before cART initiation. In all other animals, plasma viral RNA became undetectable 2-3 weeks post cART initiation. We euthanized the transplant recipients at day 47, 29, and 9 post-transplant, due to infection, graft-versus host disease, and renal complications, respectively. Analysis of whole blood and gated CD4+ T cells showed acquisition of 100% donor blood chimerism at day 29, with lower T cell chimerism in 1 animal. Despite undetectable SHIV plasma viremia post-transplant, the cell-associated SHIV DNA reservoir persisted in multiple tissues, including lymphoid, hematopoietic and major organs, gut and CNS, and was even increased in certain tissues of transplanted animals compared to untransplanted controls.Conclusions : Our results indicate that the DNA reservoir persists and may even increase early after transplantion, despite control of peripheral viremia. Thus, allogeneic HCT is likely associated with an initial loss of anti-HIV immunity leading to an increase in the size of the viral reservoir. This may also explain the rebound observed in the Boston patients. Thus, we propose that reservoir eradication will require additional HIV resistance factors and/or anti-HIV strategies post-transplant to enhance 1) donor cell resistance, and 2) the targeted killing of infected cells. DisclosuresKiem:Rocket Pharmaceuticals: Consultancy, Equity Ownership, Patents & Royalties, Research Funding. Kean:Regeneron: Research Funding; Bristol Myers Squibb: Consultancy; Juno: Research Funding; Kymab Ltd: Research Funding.

The Frequency of CCR5del32 Mutation in Populations of Russians, Tatars and Bashkirs of Chelyabinsk Region, Russia.

The distribution of genetic variants associated with natural resistance to viral infections can vary among human ethnic groups due to evolutionary factors, defining the different epidemiologic background of world populations. The polymorphisms, defining the natural resistance to HIV-infection and the rate of progression up to AIDS, are very important since epidemic is still on rise. We have studied the distribution of allele and genotype frequencies of CCR5delta32 mutation in major populations inhabiting Chelyabinsk region of the Russian Federation. Genetic survey included the population of 509 potential blood marrow donors: Russians (N=300), Bashkirs (N=118) and Tatars (N=91). The genotyping assay was performed using real-time polymerase chain reaction (real-time PCR). The genotypes were defined by melting curve analysis. The CCR5delta32 allele and CCR5delta32/delta32 genotype are presented in population of Russians in Chelyabinsk region with the frequencies of F x =10.83% and P x =1.67, for the CCR5delta32 allele and its homozygosity, respectively. In populations of Bashkirs and Tatars CCR5delta32 allele and CCR5delta32/delta32 genotype are presented at lower frequencies of F x =6.36%/P x =0.85 and F x =7.14%/P x =1.10, respectively. These data are consistent with the theory of northern origin of the CCR5delta32 mutation.

Gene Therapy to Cure HIV: Where to from Here?

A variety of approaches are being tested to cure HIV, but with the exception of the Berlin patient case, none has been successful. The Berlin patient, positive for both HIV and acute myeloid leukemia (AML), received two stem cell transplants from a donor homozygous for the CCR5delta32 mutation. In the 8 years since his second transplant, he has remained free of both HIV and AML. This case provides strong proof-of-principle that a cure for HIV is possible and might be achieved through gene therapy. Several technological barriers must be resolved and are discussed here, including the safe delivery of the intervention throughout the body of the infected person, increased efficiency of gene editing, and avoidance of resistance to the therapy. Delivery of a gene therapy intervention to HIV-infected people around the world will also be a considerable challenge.

Prevalence of the CCR5 delta32 mutation in the tundra Nenets of Yamal

CCR5 delta 32 is a genetic variant of CCR5 - deletion mutation of a gene that has a specific impact on the adhesive function of T cells. It is believed that this mutation arose approximately two and a half thousand years ago and eventually spread in Europe. It has been hypothesized that this allele was favored by natural selection during the Black Death. In the heterozygotes, this mutation strongly reduces the chance of HIV infection In the homozygotes, it completely protects against HIV infection. CCR5 delta32 mutation in the heterozygous state occurs in Europe with a frequency of 5-14 %. The incidence of CCR5 delta32 outside of Europe is very low, and in many non-European ethnic groups it is completely absent. The prevalence of this mutation in the population of the Nenets has not previously investigated. It was assumed to have a lower frequency than in Europeans. We carried out an investigation with 54 blood samples of Nenets living in Yamalo-Nenets Autonomous District. DNA was extracted with was QIAamp DNA Mini Kit (QIAGEN) according to the manufacturer protocol. To identify the CCR5 delta32 deletion polymerase chain reaction was conducted using primers: CCR5-D32-F: 5`CTTCATTACACCTGCAGTC3`, CCR5-D32-R: 5`TGAAGATAAGCCTCACAGCC3` under the following conditions: 95˚-5’x1; 95˚-15” → 55˚-15” → 72˚-60”x40; 72˚-10’x1 → 4˚-∞. Products of the reaction were separated in 2 % aga-rose gel for 1.5 hours. Gel documentation was performed using a Gel Doc XR Plus (Bio-Rad, USA). The prevalence of CCR5 delta32 mutation in Nenets was found to be 9.3 %. This was a higher than expected frequency, and it corresponds to the average prevalence of CCR5 delta32 mutation in Europe. Our finding suggests possible European origin of the Nenets.

Hypothesis about the protective role of ccr5delta32 mutations in juvenile idiopathic arthritis: fiction or reality?

It is suspected that the prevalence in different ethnic groups of HLA-genotype and of mutation CCR5delta32 - factors which alter adhesion of protein CCR5 - are the causes of different prevalence of juvenile idiopathic arthritis in different ethnic populations. Prerequisites to the fact that the mutation CCR5delta32 may have importance in determining susceptibility to the disease were the observations showing that CCR5 deletion polymorphism reveals a population and geographic diversity in addition to ethnic specificity. But reports on the role of gene deletion in the CCR5 chemokine receptor susceptibility to JIA rather contradictory. 234 DNA samples of patients with systemic JIA (soJIA) were ana-lyzed. The diagnosis was made according to the ILAR criteria. DNA was isolated using QIAamp Mini Kit (QIAGEN) according to the protocol provided. Our results didn’t reveal any differences in prevalence of mutation in patients with soJIA, in patients with soJIA + macrophage activation syndrome and in total population. Our results do not support the idea of protective role of the muta-tion CCR5delta32 against soJIA, which conclusion can be explained also by probable association of soJIA with HLA-genotype or other factors of ethnicity. At the same time, it can be considered as an additional evidence of expediency of soJIA being an original disease different from the rest of JIA group of diseases.

Graft Versus HIV-1 Reservoir Effect after Allogeneic Stem Cell Transplantation

Background: The use of a stem cell source homozygous for the CCR5 delta32 mutation is of particular interest in HIV+ patients in need of an allogeneic hematopoietic stem cell transplantation (SCT) given the high natural resistance against HIV-1 acquisition. In the absence of such cell source, the impact of allogeneic SCT on human immunodeficiency virus type 1 (HIV-1) reservoirs in patients receiving combination antiretroviral therapy (cART) is unknown.Methods: Size of HIV-1 reservoirs was investigated in 3 patients with hematological malignancies receiving cART, who underwent allogeneic SCT (Table 1). Patient 1 received a myeloablative single cord blood (wild type (WT) CCR5), supported with third party HLA-mismatched CD34+ cells (haplo-cord SCT). Patients 2 and 3 underwent reduced intensity conditioning SCT of an HLA-matched sibling (heterozygous CCR5 delta32 donor and WT CCR5 donor, respectively). In-depth analysis of the HIV-1 reservoir was performed in the post-transplant period using droplet digital PCR and hemi-nested qPCR (proviral DNA copies/million PBMC). Chimerism analysis was performed by short tandem repeat PCR (STR-PCR).Results: Proviral DNA showed a decreasing dynamics after allogeneic SCT and became undetectable in all 3 patients at 9, 18 and 1 months, respectively (Table 1). In patient 1, negativity of proviral HIV-1 DNA coincided with achievement of complete chimerism while being free of immunosuppression. Patient 2 showed undetectable proviral DNA together with the development of skin chronic GvHD. Finally, undetectable proviral DNA and complete chimerism was achieved in patient 3 early after transplantation. All patients remained in complete hematological remission.Conclusion: All our patients showed a small HIV-1 reservoir after allogeneic SCT. The coincidence of achievement of negative proviral HIV-1 DNA and complete chimerism and/or development of GvHD suggests a role of Ògraft versus HIV-1 reservoir effectÓ in the control of HIV infection. [Display omitted] DisclosuresNo relevant conflicts of interest to declare.

Scientific-organizational aspects for developing an inventory of the donors of umbilical cord blood with CCR5 delta32/delta32 genotype for HIV infection treatment

Projections of the using umbilical cord blood for HIV infection cure consist in the transplantation of umbilical cord blood hematopoietic stem cells from the donors of homozygous CCR5 delta32 mutation carriers.This work presents the results of screening evaluation of umbilical cord blood samples from the donors, included in the public registry of the Pokrovsky stem cells bank, for identification of the homozygous CCR5 delta32 polymorphism carriers and their following HLA typing to see the perspectives for creating a public registry of CCR5 delta32/ CCR5 delta32 donors of the umbilical cord blood for treatment of HIV-infected patients. Total 2860 umbilical cord blood samples were examined from which 29 samples with CCR5 delta32 / CCR5 delta32 genotype were selected.High frequency of the HLA alleles most prevalent in the North-West region of the Russian Federation has been found in the donors of umbilical cord blood with wild CCR5 gene and among CCR5 delta32/delta32 donors.

A130: Is the CCR5‐delta32 Mutation Protective Against Systemic‐Onset Juvenile Idiopathic Arthritis?

The CCR5 protein is a chemokine receptor, and is known to be expressed on T cells, macrophages, dendritic and microglia cells. It is believed that different prevalence of HLA and CCR5- delta32-a 32 base pair deletion in the coding region-in various ethnic groups is associated with the severity and prevalence of chemokine-mediated autoimmune diseases, systemic-onset Juvenile Idiopathic Arthritis (soJIA) being among them (Del Rincon et al., 2003). Since the end of the last century the protective role of the CCR5-delta32 mutation against JIA is discussed (Hinks et al., 2010), though it seems the role of this mutation is less simple than was hitherto thought. The purposes of the study was to compare the prevalence of the CCR5-delta32 mutation in children with and without soJIA, to assess the association of this mutation with the severity of the disease and thus to evaluate its protective role. 234 children (193 of European origin, 25-Hispanic or Latino, 14-Afro-Americans, 3-of Asian origin) with soJIA living in the USA and in the Northwestern part of Russia were enrolled in the study. Genomic DNA was isolated from blood samples using QIAamp Mini Kit and amplified by PCR. The following oligonucleotide primers were used to detect CCR5 d32: CCR5- Δ32-F: 5'CTTCATTACACCTGCAGTC3', CCR5-Δ32-R: 5'TGAAGATAAGCCTCACAGCC3' by following condition: 95°-5'×1; 95°-15″→55°-15″→72°-60″×40; 72°-10'×3→4°-∞; the resulting PCR products were separated on 2% agarose gel by electrophoresis and visualized by Gel Doc XR Plus. Mutation was revealed only in children of European origin. Though the prevalence of the heterozygous CCR5-delta32 mutation being 16% and 21% in the USA and in Russia correspondingly didn't excel from its prevalence in populations in total (10-18% for Northwestern Russia, Kofiady, 2008; 11,8%- for white American group, Downer et al, 2002), some laboratory and clinical signs of soJIA proved to be related to the mutation (see ). Heterozygous CCR5-delta32 genotype was associated with milder so-JIA course and predominance of the articular features over systemic. [Table: see text] The results of the study may be considered rather not supporting the idea of the protective role of the CCR5-delta32 mutation against soJIA, though the revealed associations-most of them related to the signs of the Macrophage Associated Syndrome-can be the basis for a more sophisticated research.

Factors Associated with Persistence of Hepatitis B Virus Infection

Hepatitis B Virus (HBV) infection is a global health problem that is endemic in many parts of the world. 90-95% of the infected adults can clear the virus. Host genetic factors play a major role in determining the outcome of HBV infection. This study estimated the role of nonfunctional CCR5 receptor (CCRΔ32 mutation) in the recovery from hepatitis B infection among Georgian patients. Case-control study has been conducted, where study subjects with persistent HBV infection were matched to double number of individuals who had recovered from the HBV infection. The overall number of study subjects was 282 (94 cases and 188 controls). Demographic, medical and behavioral characteristics of the study participants were collected. CCR5 delta32 mutation was evaluated by PCR methodology. The overall prevalence of CCR5 receptor mutation was 13.1% (n=37). Among controls (HBsAg-) CCR5 receptor mutation was detected in 16.5% (n=31), in cases - only in 6.4% (n=6). Cases were 2.58 times less likely to have CCR5 Δ32 mutation compared to controls (OR =2.58; 95% CI 1.12, 5.98). Multivariate analysis revealed CCR5 receptor mutation and alcohol consumption as independent predictors of HBs positivity. The study gives clear evidence that genetic factors (CCR5 receptor mutation) play an important role in Hepatitis B virus persistence together with environmental/behavioral factors, such as the alcohol use.

Single Cord Blood Transplantation Combined With An HLA Mismatched Third Party Donor For High-Risk Hematological Patients With HIV Infection

BackgroundThe safety and usefulness of unrelated umbilical cord blood (CB) stem cell transplantation (SCT) in patients candidates for allogeneic SCT and HIV infection is unknown. Single CB with the co-infusion of CD34+ cells from a third party HLA-mismatched donor (TPD), or Haplo-cord SCT, has shown to reduce the period of post-transplant neutropenia and related early complications associated with single CB transplantation. This platform could potentially reduce the risk of early infections in this particular group of patients. On the other hand, the use of a cell source homozygous for the CCR5 delta32 allele mutation, which confers high resistance against HIV-1 acquisition, is of particular interest in HIV+ patients. Methods and ResultsWe report here on the first two patients with HIV infection and high-risk haematological malignancies who underwent haplo-cord SCT in two different centers: (Case 1) a 53 year-old male patient with high-risk MDS; (Case 2) a 34 year-old male with Burkitt lymphoma in CR2. Both CB transplants were performed using the haplo-cord platform with the co-infusion of mobilized and selected CD34+ cells from a TPD. Conditioning regimen were myeloablative in both cases. Case 1 had the additional potential benefit from the use of a CB unit with the homozygous CCR5delta32 mutation. Both cases achieved neutrophil and platelet engraftment similarly to previous haplo-cord SCT performed in HIV negative patients, as well as full CB chimerism. However, case 1 developed beside a severe lung infection, relapse of the underlying malignancy 2 months after SCT and died consequently. Case 2 presented one episode of bacterial sepsis with good response to antibiotics, and one episode of CMV reactivation controlled with valgancyclovir. Thirteen months after SCT, this patient is alive and in CR. Extensive analyses of viral and immunological compartments were performed showing the early viral dynamics in both patients. ConclusionsCB SCT is feasible in patients eligible for allogeneic SCT and HIV infection. The haplo-cord strategy with the co-infusion of auxiliary cells from a TPD seems to offer a fast neutrophil engraftment similarly to HIV negative patients. Therefore, this strategy should be considered in patients with HIV infection and indication for allogeneic SCT, whenever CB is the source of choice and especially if a CCR5 mutated unit is available. Disclosures:Kuball:Miltenyi: GMP product development Other.

High prevalence of CXCR4‐using viruses in vertically HIV‐1‐infected infants in Thailand

Purpose of the studyPrevious studies evaluating the frequency of CXCR4‐using strains in HIV‐1 vertically infected children restricted mainly to patients infected with subtype B or C strains. However, the coreceptor use by non‐B or non‐C subtypes remains little known, especially in infants. In this study, we determined the HIV‐1 coreceptor usage in infants with vertically‐acquired HIV‐1 infection in Thailand, where the predominant circulating HIV‐1 strains are CRF01_AE and the minority are subtype B.MethodsC2‐V3‐C3 gp120 was amplified in a triplicate nested‐PCR and sequenced. Coreceptor usage was predicted using the geno2pheno [coreceptor] algorithm and analyzed with a false positive rate (FRP) of 10%.Summary of resultsA total of 255 sequences were obtained from viral isolates of 85 HIV‐1‐infected infants (34 male and 51 female) participating in the National AIDS Program (NAP) of the National Health Security Office (NHSO) of Thailand. All children were received ARV prophylaxis according to the Thai national guidelines. The median age was 84 days (range: 33–308). Seventy‐four children (87.1%) were infected with CRF01_AE strain and 11 (12.9%) were infected with subtype B strain. Concordance in tropism prediction for the triplicates was observed in all samples. CXCR4 coreceptor‐using strains were found in 44.7% (38 of 85) and CCR5 coreceptor‐using strains were found in 55.3% (47 of 85). No significant difference in age (p=0.34) and clinical signs of AIDS (p=0.47) were observed between these populations. CCR5Delta32 and CCR5m303 mutation genotypes that may contribute to a selective pressure of viruses to alternatively use CXCR4 as a coreceptor were not found.ConclusionsA high prevalence of HIV‐1 CXCR4‐using variants was found among HIV‐1 vertically infected infants in Thailand, indicating that a direct vertical transmission of CXCR4‐using variants or a rapid switch from CCR5‐using to CXCR4‐using viruses shortly after transmission. These observations may have implications for clinical and therapeutic aspects, especially in the early stage of HIV‐1 infection in infants and may benefits for using of CCR5‐antagonists in this population.

Targeted Disruption of the CCR5 Gene in Human Hematopoietic Stem Cells Stimulated by Peptide Nucleic Acids

Peptide nucleic acids (PNAs) bind duplex DNA in a sequence-specific manner, creating triplex structures that can provoke DNA repair and produce genome modification. CCR5 encodes a chemokine receptor required for HIV-1 entry into human cells, and individuals carrying mutations in this gene are resistant to HIV-1 infection. Transfection of human cells with PNAs targeted to the CCR5 gene, plus donor DNAs designed to introduce stop codons mimicking the naturally occurring CCR5-delta32 mutation, produced 2.46% targeted gene modification. CCR5 modification was confirmed at the DNA, RNA, and protein levels and was shown to confer resistance to infection with HIV-1. Targeting of CCR5 was achieved in human CD34(+) hematopoietic stem cells (HSCs) with subsequent engraftment into mice and persistence of the gene modification more than four months posttransplantation. This work suggests a therapeutic strategy for CCR5 knockout in HSCs from HIV-1-infected individuals, rendering cells resistant to HIV-1 and preserving immune system function.

The effect of the CCR5-delta32 deletion on global gene expression considering immune response and inflammation

BackgroundThe natural function of the C-C chemokine receptor type 5 (CCR5) is poorly understood. A 32 base pair deletion in the CCR5 gene (CCR5-delta32) located on chromosome 3 results in a non-functional protein. It is supposed that this deletion causes an alteration in T-cell response to inflammation. For example, the presence of the CCR5-delta32 allele in recipients of allografts constitutes as an independent and protective factor associated with a decreased risk of graft-versus-host disease (GVHD) and graft rejection. However, the mechanism of this beneficial effect of the deletion regarding GVHD is unknown. In this survey we searched for a CCR5-delta32 associated regulation of critical genes involved in the immune response and the development of GVHD.MethodsWe examined CD34+ hematopoietic progenitor cells derived from bone marrow samples from 19 healthy volunteers for the CCR5-delta32 deletion with a genomic PCR using primers flanking the site of the deletion.Results12 individuals were found to be homozygous for CCR5 WT and 7 carried the CCR5-delta32 deletion heterozygously. Global gene expression analysis led to the identification of 11 differentially regulated genes. Six of them are connected with mechanisms of immune response and control: LRG1, CXCR2, CCRL2, CD6, CD7, WD repeat domain, and CD30L.ConclusionsOur data indicate that the CCR5-delta32 mutation may be associated with differential gene expression. Some of these genes are critical for immune response, in the case of CD30L probably protective in terms of GVHD.

Association of CCR5-59029 A/G and CCL3L1 Copy Number Polymorphism with HIV Type 1 Transmission/Progression among HIV Type 1-Seropositive and Repeatedly Sexually Exposed HIV Type 1-Seronegative North Indians

The CCR5Delta32 mutation does not account for HIV-1 resistance in the majority of persons who are repeatedly exposed to HIV-1 by high-risk activities but remain seronegative and uninfected. Therefore, we investigated the impact of CCR5 59029 A/G and CCL3L1 copy number polymorphism on HIV-1 disease susceptibility and progression among HIV-1-infected and HIV-1-exposed seronegative North Indians. HIV-1-seropositive (HSP, n = 196) patients, stratified on the basis of disease severity (Stages I, II, and III) and HIV-1-exposed seronegative (HES, n = 47) individuals were genotyped for CCR5-59029 A/G polymorphism by PCR-RFLP and CCL3L1 copy number by the real-time TaqMan PCR method. A group of ethnically matched HIV-1-seronegative (HSN, n = 315) healthy volunteers were also genotyped as controls. Statistical analysis was done by SPSS software. The CCR5-59029 AG genotype was significantly higher in the HES compared with the HSP group (57.44% vs. 37.24%, p = 0.014). The CCL3L1 mean copy number of HES was higher compared with the HSP groups (3.148 +/- 0.291 vs. 2.795 +/- 0.122, p = 0.212), but was not significant when compared with independent samples t test. Possession of CCL3L1 copies < or = 2 or >2 was not associated with enhanced or reduced risk of HIV-1 acquisition. Gene-gene interaction studies showed enrichment of the CCR5-59029AG*CCL3L1>2 genotype in the HES group when compared with the HSP group (31.91% vs. 15.81%, p = 0.021, OR = 0.401, CI = 0.194-0.826). The increased frequency of the CCR5-59029AG*CCL3L1>2 genotype among HES individuals led us to conclude that the CCR5-59029 AG genotype and CCL3L1 gene dose appeared to have synergistic or interactive effects and are expected to be involved in the host innate resistance to HIV-1 infection.

Historic, demographic, and genetic evidence for increased population frequencies of CCR5Delta32 mutation in Croatian Island isolates after lethal 15th century epidemics.

To assess the frequency of 32 base pair deletion in CCR5 (CCR5Delta32), which has been shown to confer resistance to HIV infection in a homozygous form, in 10 isolated island communities of Dalmatia, Croatia, with different histories of exposure to epidemics during and since the medieval period. In 2002, DNA analysis of 100 randomly selected individuals from each of the 10 isolated communities of 5 Croatian islands (Susak, Rab, Vis, Lastovo, and Mljet) showed high levels of 3-generational endogamy, indicating limited gene flow. Five of the communities were decimated by epidemics of unknown cause between 1449-1456, while the other 5 villages remained unaffected. Genotyping of the CCR5 gene was performed using the polymerase chain reaction method with primers flanking the region containing 32-bp deletion. The frequency of CCR5Delta32 in the 5 villages affected by the epidemic was 6.1-10.0%, and 1.0-3.8% in the 5 unaffected villages. The Delta32 mutation was found in 71 of 916 alleles among the individuals from the affected villages (7.5%), and in 24 of 968 alleles in unaffected villages (2.5%, chi(2)=27.3, P<10-6). A previous study in 303 random Croatian blood donors showed the frequency of the CCR5 Delta32 of 7.1% in the general population. The difference remained significant after correcting for population structure using both STRAT and STRUCTURE software and the genomic control test, to ensure results do not arise from the background genetic differences. Our results and historical evidence, suggest that the mid-15th century epidemic could have acted as a selection pressure for the CCR5Delta32 mutation.