Carrot Mottle Research Articles

Identification of a novel recombinant polerovirus and other emergent viruses and tombusvirus-like associated RNA species associated with carrot motley dwarf disease in the United States.

Carrot motley dwarf (CMD) is a viral disease complex caused by co-infection of the polerovirus carrot red leaf virus with the umbraviruses carrot mottle virus or carrot mottle mimic virus, and/or a tombusvirus like associated RNA (tlaRNA), which depend on co-infection with a helper polerovirus to gain aphid transmissibility. In 2020 and 2021 carrot samples from Washington, United States (U.S.), and parsley and cilantro samples from California, U.S., exhibiting typical symptoms of CMD were submitted for diagnosis. Initial RT-PCR diagnostic assays identified the typical CMD viruses in the carrot samples, however only the umbraviruses and tlaRNAs were detected in the parsley and cilantro samples; as such, these samples were retested with another RT-PCR assay for generic polerovirus detection. Unexpectedly, the poleroviruses Torilis crimson leaf virus (TorCLV) and fennel motley virus were identified. Subsequent RNA sequencing analysis was conducted to confirm these results and look for other emergent viruses. In addition to confirming the diagnostic results, the recently described polerovirus Foeniculum vulgare polerovirus, the umbraviruses Pastinaca umbravirus 1 and wild carrot mottle virus, and the tlaRNA Arracacha latent virus E associated RNA were identified, making this the first report of these viruses and tlaRNA in the U.S. Using phylogenetic and pairwise identity comparisons and RDP4 recombination analyses, we also identified a putative novel polerovirus, for which we propose the name parsley polerovirus, that appears to be a recombinant between carrot polerovirus 1, sharing 92% amino acid (aa) identity with the RNA dependent RNA polymerase in the 5' gene block, and TorCLV, sharing >98% aa identity with the capsid protein in the 3 gene block. This work adds to the growing list of polerovirus species exhibiting recombination between the 5' and 3' gene blocks, and highlights the unique, variable, and dynamic associations that can occur in polerovirus, umbravirus, and tlaRNA disease complexes.

Dissecting dynamic plant virus synergism in mixed infections of poleroviruses, umbraviruses, and tombusvirus-like associated RNAs.

Mixed infections of a plant infecting polerovirus, umbravirus, and/or tombusvirus-like associated RNAs (tlaRNAs) produce unique virus disease complexes that exemplify "helper-dependence" interactions, a type of viral synergism that occurs when a "dependent" virus that lacks genes encoding for certain protein products necessary for it to complete its infection cycle can utilize complementary proteins encoded by a co-infecting "helper" virus. While much research has focused on polerovirus-umbravirus or polerovirus-tlaRNA interactions, only recently have umbravirus-tlaRNA interactions begun to be explored. To expand on the limited understanding of umbravirus-tlaRNA interactions in such disease complexes, we established various co-infection pairings of the polerovirus turnip yellows virus (TuYV), the umbravirus carrot mottle virus (CMoV), and three different tlaRNAs-carrot red leaf virus aRNAs (CRLVaRNAs) gamma and sigma, and the TuYVaRNA ST9-in the model plant Nicotiana benthamiana, then investigated the effects of these different co-infections on tlaRNA systemic movement within the host, and on virus accumulation, and aphid and mechanical transmission of each of these viruses. We found that CMoV alone could support systemic movement of each of the tlaRNAs, making this the second report to demonstrate such an interaction between an umbravirus and tlaRNAs. We also report for the first time that CMoV could also impart mechanical transmissibility to the tlaRNAs sigma and ST9, and that co-infections of either of these tlaRNAs with both TuYV and CMoV increased the efficiency with which TuYV could be mechanically co-transmitted with CMoV.

Status of virus and phytoplasma diseases in carrot growing areas of Ankara and Konya provinces, Turkey

In this study, infections that may emerge from viruses and phytoplasmas were investigated in carrot cultivation fields in the Ankara and Konya provinces, which are located in the Central Anatolia Region of Turkey and have the largest agricultural areas of the country. A total of 272 symptomatic and asymptomatic carrot plants, together with their root and leaf parts, were collected from 61 fields by performing periodic field studies during the plant vegetation periods between 2018–2019. Samples were tested against carrot virus Y (CarVY), carrot red leaf virus (CtRLV), carrot red leaf virus-associated RNA (CtRLVaRNA), carrot mottle virus (CMoV), carrot torradovirus 1 (CaTV), carrot yellow leaf virus (CYLV), carrot thin leaf virus (CTLV) and cucumber mosaic virus (CMV) agents by Reverse Transcriptase-PCR (RT-PCR). To determine phytoplasmas, samples were tested using universal primers by nested PCR. Molecular tests conducted to investigate the aforementioned viruses produced negative results, but phytoplasma infections were widely found. 16SrVI-A “Candidatus Phytoplasma trifolii” and 16SrI-B “Aster yellows” subgroups were detected by in vitro/in silico RFLP and sequencing analyses. Disease incidence caused by both phytoplasma groups was 39.34%. This study determined for the first time that 16SrVI and 16SrI groups cause severe infections in the carrot fields of Turkey.

Carrot mottle virus (motley dwarf of carrot)

Carrot mottle virus (motley dwarf of carrot)

Carrot mottle virus ORF4 movement protein targets plasmodesmata by interacting with the host cell SUMOylation system.

Plant virus movement proteins (MPs) facilitate virus spread in their plant hosts, and some of them are known to target plasmodesmata (PD). However, how the MPs target PD is still largely unknown. Carrot mottle virus (CMoV) encodes the ORF3 and ORF4 proteins, which are involved in CMoV movement. In this study, we used CMoV as a model to study the PD targeting of a plant virus MP. We showed that the CMoV ORF4 protein, but not the ORF3 protein, modified PD and led to the virus movement. We found that the CMoV ORF4 protein interacts with the host cell small ubiquitin-like modifier (SUMO) 1, 2 and the SUMO-conjugating enzyme SCE1, resulting in the ORF4 protein SUMOylation. Downregulation of mRNAs for NbSCE1 and NbSUMO impaired CMoV infection. The SUMO-interacting motifs (SIMs) LVIVF, VIWV, and a lysine residue at position 78 (K78) are required for the ORF4 protein SUMOylation. The mutation of these motifs prevented the protein to efficiently target PD, and further slowed or completely abolished CMoV systemic movement. Finally, we found that some of these motifs are highly conserved among umbraviruses. Our data suggest that the CMoV ORF4 protein targets PD by interacting with the host cell SUMOylation system.

Biological and genetic characterization of carrot red leaf virus and its associated virus/RNA isolated from carrots in Hokkaido, Japan

AbstractCarrot motley dwarf (CMD) is caused by mixed infection of carrot red leaf virus (CtRLV) with either carrot mottle virus (CMoV) or carrot mottle mimic virus, and additional infection with CtRLV‐associated RNA (CtRLVaRNA). Here, the author investigated the viruses or virus‐like RNA isolated from carrots with reddening symptoms in Hokkaido, the northern island of Japan. Three types of infections were mainly detected: single infection with CtRLV, which was most prevalent; double infection with CtRLV and CMoV; and triple infection with CtRLV, CMoV, and CtRLVaRNA. Fields with the three agents were severely affected, with diseased plants showing mottling, whereas in fields where disease incidence was low and sporadic, CtRLV was often found alone in plants with mild symptoms. Inoculation tests using carrot plants showed that CMoV enhanced disease severity, and the RNA accumulation of CtRLV. However, in the presence of CtRLVaRNA (+ CMoV), distinct symptoms such as systemic mottling and stunting developed, while the enhancement of CtRLV accumulation was abolished. These results imply that CtRLVaRNA (+ CMoV) antagonizes CtRLV despite its dependence on CtRLV for aphid transmission, and that mixed infection with CtRLVaRNA is involved in the development of the conspicuous mottling. All agents detected in Hokkaido were very similar to European and American isolates in terms of their genomic sequences and host range. This represents the first report of CMD in Japan, and provides further information on the genetic and biological properties of CMD‐associated agents, as well as the aetiology of the disease.

Virusi biljaka familije štitonoša

The Apiaceae are a large plant family consisting of approximately 250 genera and over 3,000 species grown worldwide. Its representative vegetables are carrot, parsley, parsnip and celery, as well as some wellknown spice plants such as fennel, anise, caraway, dill, and coriander. Their production is imperiled by numerous pathogens, among which viruses are of great importance. Globally more than 30 viruses are known to affect carrot and other plant species belonging to family Apiaceae. The principal viruses are: Celery mosaic virus (CeMV), Parsnip yellow fleck virus, (PYFV), Carrot red leaf virus (CtRLV) and Carrot mottle virus (CMoV). In Serbia, three viruses are present on carrot and celery: CeMV, Cucumber mosaic virus (CMV) and Tomato spotted wilt tospovirus (TSWV). The economic importance of viruses infecting umbelliferous has long been recognised due to the foliar symptoms and viral dieback of seedlings. These viruses affect carrot crops only sporadically, but when they do occur they can be devastating. Other umbelliferous viruses are known to occur worlwide, however, their effects are not clear.

Genomic characterization of pea enation mosaic virus-2 from the Pacific Northwestern USA.

Pea enation mosaic virus (PEMV) infects several legume crops, including chickpea (Cicer arietinum), faba bean (Vicia faba), lentil (Lens culinaris) and pea (Pisum sativum). The virus caused yield losses of food legumes in the Pacific Northwestern US during 1983, 1987 and 1990 [1]. Our recent surveys of pea and alfalfa fields in the states of Washington and Idaho, USA, have shown the prevalence of PEMV on pea. PEMV consists of a large (RNA-1 or PEMV-1) and a small (RNA-2 or PEMV-2) single-stranded positive-sense RNA, which are encapsidated separately into distinct isometric particles [2]. PEMV-2 is one of the seven distinct virus species in the genus Umbravirus. The other species of this genus are Carrot mottle virus (CMoV), Carrot mottle mimic virus (CMoMV), Groundnut rosette virus (GRV), Lettuce speckles mottle virus (LSMV), Tobacco mottle virus (TMoV) and Tobacco bushy top virus (TBTV) [3]. Members of this group lack the coat protein (CP) gene in their genomes and depend on a helper virus for survival [4]. PEMV-2 in association with PEMV-1 (genus Enamovirus), form a symbiotic bipartite virus complex referred to as PEMV. It has been suggested that RNA-1 and RNA-2 are essential for PEMV infection [4, 5]. The RNA-1 (5706 nucleotides) encodes five major ORFs (1-5) that have nucleotide and amino acid sequence similarities with subgroup II luteoviruses [5]. While PEMV-1 provides the necessary encapsidation and vector-transmission abilities for PEMV-2, the latter provides PEMV-1 with long-distance movement and mechanical transmission functions. As part of an ongoing project to determine the genetic diversity of PEMV, we recently characterized the genome of PEMV-1 from the Pacific Northwest [6]. So far, there are only two complete genomic sequences of PEMV-2 in GenBank (NC_003853 and AY714213). To better understand sequence diversity of PEMV-2, the genome structure and organization of two PEMV isolates, one from Idaho (PEMV-2-ID) and one from Washington (PEMV-2-WA), were determined in this study. The PEMV-2 genome (*4.2 kbp), like that of other umbraviruses, predominantly consists of four ORFs (1-4), which perform diverse functions [4, 7, 8]. RNA-2 lacks a polyadenylation signal at its 30 end and contains a large 50 genome-linked protein [9]. ORF-1, at the 50 end of the virus genome, initiates after a short, 20-nt non-coding region (NCR) and encodes a putative 33-kDa protein of unknown function. ORF-2 overlaps with ORF-1 at its 30 end and potentially encodes a protein of 65 kDa through a frameshift mechanism. ORF-2 contains sequence motifs characteristic of a viral RNA-dependent RNA-polymerase (RdRp). The presence of a polymerase cassette in RNA-2 also reveals its independent replicative capabilities. Also, due to the presence of an octanucleotide frameshift signal ‘‘GGATTTTT’’ immediately upstream of the stop codon of ORF-1, ORF-1, along with ORF-2, is expressed by a -1 frameshift mechanism as a minor translation product of 97 kDa [4]. ORFs 3 and 4 in the genome occur after a nonThe sequences described here were deposited in the GenBank database with the following accession numbers: JF713435 for PEMV2-WA and JF713436 for PEMV-2-ID.

First Report of Carrot red leaf virus and Carrot mottle virus, Causal Agents of Carrot Motley Dwarf, in Carrot in Mauritius.

Carrot motley dwarf (CMD) affects carrot and other apiaceous plants by causing leaf yellowing or reddening as well as plant stunting and leads often to serious economic losses wherever these crops are grown (2). CMD has been reported from Australia, Europe, Japan, Israel, and North America and is known to result from a mixed infection by at least two viruses, the polerovirus, Carrot red leaf virus (CtRLV), and one of the umbraviruses, Carrot mottle virus (CMoV) or Carrot mottle mimic virus (CMoMV). The viruses are transmitted in a circulative persistent manner by aphid species (Cavariella spp.). In November of 2008, symptoms typical of CMD were observed in carrot (Daucus carota) and coriander (Coriandrum sativum) plantations in the region of Henrietta in the central part of Mauritius. Carrot cultivars affected were Victoria, Sigma, and Namdhari. Incidences of up to 50% were recorded in some fields. Symptoms were observed mainly on plants near the edges of fields and were initially attributed to physiological factors. However, following RNA extraction from affected carrot plants and reverse transcription (RT)-PCR, fragments of the expected sizes (CtRLV; 377 bp: CMoV; 549 bp) were obtained. For CtRLV, a pair of degenerate primers (S2/AS3 [1]) for poleroviruses, and for the above mentioned umbraviruses, a universal primer pair (UmbraCS: CTTTGGAGTACACAACAACTCC and UmbraCAS: GCA/GTCIAGICCIACACAA/GACTGG, I = Inosin; unpublished) was used. Direct sequencing of one PCR product for each virus (Eurofins MWG Operon GmbH, Martinsried, Germany) and comparison with sequences retrieved from GenBank resulted in nucleotide and amino acid sequence identities of 93 and 90% (coat protein) to the CtRLV strain UK-1 (Accession No. AY695933) and 86 and 96% (replicase) to the German CMoV isolate (Accession No. FJ188473), respectively. Carrot samples also tested CtRLV-positive in triple-antibody sandwich-ELISA using polyclonal IgGs to CtRLV for trapping and a mixture of two CtRLV-specific monoclonal antibodies (CtRLV-2-3A9 and CtRLV 3-4B9) as detecting antibodies (all from the stock of the Julius Kuehn Institute; H. J. Vetten, Braunschweig, Germany). The presence of CMoV was confirmed by sap transmission to Nicotiana benthamiana and N. occidentalis 'P1', which resulted in vein yellowing/etching symptoms. In addition, agarose gel electrophoresis of the dsRNA extract of a primary infected carrot sample revealed major dsRNAs of approximately 4.2 and 1.4 kbp, which represent the genomic and subgenomic RNAs of an umbravirus. Thus, sequence analysis, as well as serological and biological data, demonstrates that CMD-affected carrot plants from Mauritius were infected with CtRLV and CMoV isolates closely related to those from Europe. The sequences obtained in this study for CtRLV and CMoV have been deposited in GenBank under Accession Nos. FJ969849 and FJ969848, respectively. To our knowledge, this is the first report of CMD in Mauritius and the Indian Ocean Region. Future works comprise an island wide survey across carrot-growing regions to determine the incidence of the virus complex and the natural host range of the viruses in Mauritius.

First report of Carrot red leaf virus-associated RNA co-infecting carrot with Carrot red leaf virus and Carrot mottle mimic virus to cause carrot motley dwarf disease in New Zealand

Carrot plants with severe leaf reddening and stunting symptoms caused by carrot motley dwarf disease were observed in the South Island of New Zealand. Carrot red leaf virus (CtRLV), Carrot mottle mimic virus and CtRLV-associated RNA (CtRLVaRNA) were shown to be the components of the virus complex causing the disease. CtRLVaRNA is reported for the first time in New Zealand.

Nucleotide sequence of a satellite RNA associated with carrot motley dwarf in parsley and carrot

Carrot motley dwarf (CMD) is known to result from a mixed infection by two viruses, the polerovirus Carrot red leaf virus and one of the umbraviruses Carrot mottle mimic virus or Carrot mottle virus. Some umbraviruses have been shown to be associated with small satellite (sat) RNAs, but none have been reported for the latter two. A CMD-affected parsley plant was used for sap transmission to test plants, that were used for dsRNA isolation. The presence of a 0.8-kbp dsRNA indicated the occurrence of a hitherto unrecognized satRNA associated with CMD. The satRNAs of the CMD isolate from parsley and an isolate from carrot have been sequenced and showed 94% sequence identity. Nucleotide sequences and putative translation products had no significant similarities to GenBank entries. To our knowledge, this is the first report of satRNAs associated with CMD.

Complete nucleotide sequence of a carrot isolate of Carrot mottle virus from Germany

Complete nucleotide sequence of a carrot isolate of Carrot mottle virus from Germany

Carrot mottle virus. [Distribution map

Abstract A new distribution map is provided for Carrot mottle virus. Virus: Umbravirus. Hosts: carrot ( Daucus carota ); parsley ( Petroselinum crispum ), cow parsley ( Anthriscus sylvestris ) and other wild hosts. Information is given on the geographical distribution in Europe (Belgium, Denmark, France, Germany, the Netherlands, UK, England and Wales, Scotland), Asia (Japan), Africa (Morocco), North America (Canada, British Columbia, USA, California, Pennsylvania, Washington, Wisconsin), South America (Brazil, Minas Gerais, Sao Paulo), Oceania (Australia, New South Wales, South Australia, Tasmania, Victoria, Western Australia, New Zealand).

RT-PCR using redundant primers to detect the three viruses associated with carrot motley dwarf disease

A method was developed for detecting and distinguishing the viruses associated with carrot motley dwarf (CMD) disease, i.e. Carrot mottle umbravirus (CMoV), Carrot red leaf virus (CRLV) and the virus known as carrot red leaf virus-associated RNA (CRLVaRNA). Redundant primers were made that targeted the RNA-dependent RNA polymerase (RdRp) gene in all available sequences of umbraviruses and in a subset of polerovirus genomes, and specific and redundant primers were made to target the same gene in CRLVaRNA. By using these primers in RT-PCR reactions, cDNAs were amplified from total RNA isolated from Belgian parsley with CMD disease. The cDNAs were sequenced and an analysis of this data showed that the plants contained all three viruses. RT-PCR assays were optimized for the simultaneous detection of the three viruses in infected parsley and chervil plants and in individual viruliferous aphids. This is the first report of a natural infection of CRLVaRNA in a plant other than carrot and the first report of this virus outside the USA. The study also confirmed that the umbravirus in parsley with CMD disease is CMoV, and that this virus is distinct from carrot mottle mimic umbravirus (CMoMV), which is also associated with CMD, but apparently not in Europe.

A Small RNA Resembling the Beet Western Yellows Luteovirus ST9-Associated RNA Is a Component of the California Carrot Motley Dwarf Complex

ABSTRACT Virions were purified from Anthriscus cerefolium or Coriandrum sativum plants infected with the viruses that cause California carrot motley dwarf. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of virion preparations yielded a single prominent protein species of approximately 28,000 molecular weight; however, denaturing agarose gel electrophoresis showed that virions contained three prominent single-stranded RNAs of approximately 5.6, 4.2, and 2.8 kb. Northern hybridization analyses, using transcripts generated from cloned cDNAs that corresponded to each of the virion RNAs, showed that the 5.6- and 4.2-kb RNAs were the genomic RNAs of the carrot red leaf luteovirus (CRLV) and the carrot mottle umbravirus (CMoV), respectively. Virions also contained an approximately 1.3-kb RNA related to the CMoV genomic RNA. The 2.8-kb RNA did not hybridize with CRLV or CMoV cRNA probes. Analysis of naturally infected carrot (Daucus carota) plants showed that CRLV, CMoV, and the 2.8-kb RNA were always present in carrot motley dwarf-affected plants. Greenhouse aphid- and mechanical-transmission experiments showed that the 2.8-kb RNA was consistently present in plants also infected by both CRLV and CMoV, but never in plants infected by only CMoV. Near full-length cloned cDNAs corresponding to the 2.8-kb RNA were prepared, and the complete nucleotide sequence was determined to be 2,835 nucleotides. Two large open reading frames (ORFs), 1a and 1b, were present within the sequence and were separated by an amber (UAG) stop codon. A third ORF (ORF 2), capable of encoding a protein of 4,289 molecular weight, was located near the 3' terminus. BLASTP results showed that the 2.8-kb RNA was most closely related to the beet western yellows luteovirus (BWYV) ST9-associated RNA. Based on its biological and molecular characteristics, we have named the 2.8-kb RNA the CRLV-associated RNA (CRLVaRNA).

The Genome Organization and Affinities of an Australian Isolate of Carrot Mottle Umbravirus

The genomic sequence of an Australian isolate of carrot mottle umbravirus (CMoV-A) was determined from cDNA generated from dsRNA. This provides the first data on the genome organization and phylogeny of an umbravirus. The 4201-nucleotide genome contains four major open reading frames (ORFs). Analysis suggests that ORF2 encodes an RNA-dependent RNA polymerase, that ORF4 encodes a movement protein, and that the virus has no coat protein gene. The functions of ORFs 1 and 3 remain unknown. ORF2 is probably translated following ribosomal frameshifting. ORFs 3 and 4 are probably translated from a subgenomic mRNA. Sequence comparisons showed CMoV-A to be closely related to pea enation mosaic RNA2 (PEMV-RNA2), but also to have affinities with theBromoviridae.These findings shed light on the relationships between the luteoviruses, PEMV, and the umbraviruses and on the relationships between the carmo-like viruses and theBromoviridae.

Complete nucleotide sequence and organization of the RNA genome of groundnut rosette umbravirus.

Complementary DNA clones representing the entire genome of groundnut rosette umbravirus (GRV) were obtained and sequenced. GRV RNA comprises 4019 nucleotides and contains four large open reading frames (ORFs). The second ORF from the 5' end includes sequences that encode motifs characteristic of viral RNA-dependent RNA polymerases and is probably expressed by a -1 frameshift mechanism as a fusion protein with the product of the 5'-most ORF. The other two ORFs are almost completely overlapping in different reading frames, and are probably expressed from subgenomic RNA. One of the putative products has significant sequence similarity with viral movement proteins. None of the putative proteins encoded by GRV RNA seems to be a structural protein. In genome organization and in the amino acid sequences of its potential products, the RNA of GRV is similar to that of carrot mottle mimic umbravirus, and to the umbravirus-like RNA-2 of pea enation mosaic virus.

Effect of virus infection on symplastic transport of fluorescent tracers in Nicotiana clevelandii leaf epidermis

The molecular weight exclusion limit of plasmodesmata in subveinal epidermal cells of Nicotiana clevelandii (Gray) leaves was estimated by microinjection and fluorescence microscopy using fluorescein isothiocyanate-peptide conjugates, carboxyfluorescein and Lucifer Yellow CH. The largest fluorochrome which moved symplastically between cells had a molecular weight of 749, although movement did not appear to depend purely on molecular weight parameters. Systemic infection of plants by tobacco rattle tobravirus, tomato black ring nepovirus or potato Y potyvirus did not alter the limits of plasmodesmatal conductance of the fluorochromes. However, carrot mottle umbravirus and groundnut rosette umbravirus diminished the symplastic mobility of some fluorescent tracers. These results imply that intercellular movement of these viruses does not involve a long-lasting increase in the plasmodesmatal molecular size exclusion limit.

Specificity of the effect of sap‐transmissible viruses in increasing the accumulation of luteoviruses in co‐infected plants

SummaryThe concentration of potato leafroll luteovirus (PLRV) (c. 1300 ng/g leaf) in singly infected Nicotiana clevelandii plants was increased up to 10‐fold in plants co‐infected with each of several potyviruses, or with narcissus mosaic potexvirus, carrot mottle virus or each of three tobravirus isolates. With the tobraviruses, PLRV concentration was increased equally by co‐infection with either NM‐type isolates (coat protein‐free cultures containing RNA‐1) or M‐type isolates (particle‐producing cultures containing RNA‐1 and RNA‐2). In contrast, the accumulation of PLRV was not substantially affected by co‐infection with either of two nepoviruses, cucumber mosaic cucumovirus, broad bean mottle bromovirus, alfalfa mosaic virus, pea enation mosaic virus or parsnip yellow fleck virus. The specificity of these interactions between PLRV and sap‐transmissible viruses was retained in tests made in Nicotiana benthamiana and when beet western yellows luteovirus was used instead of PLRV.

Carrot Red Leaf and Carrot Mottle Viruses: Observations on the Composition of the Particles in Single and Mixed Infections

Microbiology Society journals contain high-quality research papers and topical review articles. We are a not-for-profit publisher and we support and invest in the microbiology community, to the benefit of everyone. This supports our principal goal to develop, expand and strengthen the networks available to our members so that they can generate new knowledge about microbes and ensure that it is shared with other communities.