Carrot Mottle Virus Research Articles

Dissecting dynamic plant virus synergism in mixed infections of poleroviruses, umbraviruses, and tombusvirus-like associated RNAs.

Mixed infections of a plant infecting polerovirus, umbravirus, and/or tombusvirus-like associated RNAs (tlaRNAs) produce unique virus disease complexes that exemplify "helper-dependence" interactions, a type of viral synergism that occurs when a "dependent" virus that lacks genes encoding for certain protein products necessary for it to complete its infection cycle can utilize complementary proteins encoded by a co-infecting "helper" virus. While much research has focused on polerovirus-umbravirus or polerovirus-tlaRNA interactions, only recently have umbravirus-tlaRNA interactions begun to be explored. To expand on the limited understanding of umbravirus-tlaRNA interactions in such disease complexes, we established various co-infection pairings of the polerovirus turnip yellows virus (TuYV), the umbravirus carrot mottle virus (CMoV), and three different tlaRNAs-carrot red leaf virus aRNAs (CRLVaRNAs) gamma and sigma, and the TuYVaRNA ST9-in the model plant Nicotiana benthamiana, then investigated the effects of these different co-infections on tlaRNA systemic movement within the host, and on virus accumulation, and aphid and mechanical transmission of each of these viruses. We found that CMoV alone could support systemic movement of each of the tlaRNAs, making this the second report to demonstrate such an interaction between an umbravirus and tlaRNAs. We also report for the first time that CMoV could also impart mechanical transmissibility to the tlaRNAs sigma and ST9, and that co-infections of either of these tlaRNAs with both TuYV and CMoV increased the efficiency with which TuYV could be mechanically co-transmitted with CMoV.

Status of virus and phytoplasma diseases in carrot growing areas of Ankara and Konya provinces, Turkey

In this study, infections that may emerge from viruses and phytoplasmas were investigated in carrot cultivation fields in the Ankara and Konya provinces, which are located in the Central Anatolia Region of Turkey and have the largest agricultural areas of the country. A total of 272 symptomatic and asymptomatic carrot plants, together with their root and leaf parts, were collected from 61 fields by performing periodic field studies during the plant vegetation periods between 2018–2019. Samples were tested against carrot virus Y (CarVY), carrot red leaf virus (CtRLV), carrot red leaf virus-associated RNA (CtRLVaRNA), carrot mottle virus (CMoV), carrot torradovirus 1 (CaTV), carrot yellow leaf virus (CYLV), carrot thin leaf virus (CTLV) and cucumber mosaic virus (CMV) agents by Reverse Transcriptase-PCR (RT-PCR). To determine phytoplasmas, samples were tested using universal primers by nested PCR. Molecular tests conducted to investigate the aforementioned viruses produced negative results, but phytoplasma infections were widely found. 16SrVI-A “Candidatus Phytoplasma trifolii” and 16SrI-B “Aster yellows” subgroups were detected by in vitro/in silico RFLP and sequencing analyses. Disease incidence caused by both phytoplasma groups was 39.34%. This study determined for the first time that 16SrVI and 16SrI groups cause severe infections in the carrot fields of Turkey.

Carrot mottle virus (motley dwarf of carrot)

Carrot mottle virus (motley dwarf of carrot)

Carrot mottle virus ORF4 movement protein targets plasmodesmata by interacting with the host cell SUMOylation system.

Plant virus movement proteins (MPs) facilitate virus spread in their plant hosts, and some of them are known to target plasmodesmata (PD). However, how the MPs target PD is still largely unknown. Carrot mottle virus (CMoV) encodes the ORF3 and ORF4 proteins, which are involved in CMoV movement. In this study, we used CMoV as a model to study the PD targeting of a plant virus MP. We showed that the CMoV ORF4 protein, but not the ORF3 protein, modified PD and led to the virus movement. We found that the CMoV ORF4 protein interacts with the host cell small ubiquitin-like modifier (SUMO) 1, 2 and the SUMO-conjugating enzyme SCE1, resulting in the ORF4 protein SUMOylation. Downregulation of mRNAs for NbSCE1 and NbSUMO impaired CMoV infection. The SUMO-interacting motifs (SIMs) LVIVF, VIWV, and a lysine residue at position 78 (K78) are required for the ORF4 protein SUMOylation. The mutation of these motifs prevented the protein to efficiently target PD, and further slowed or completely abolished CMoV systemic movement. Finally, we found that some of these motifs are highly conserved among umbraviruses. Our data suggest that the CMoV ORF4 protein targets PD by interacting with the host cell SUMOylation system.

Biological and genetic characterization of carrot red leaf virus and its associated virus/RNA isolated from carrots in Hokkaido, Japan

AbstractCarrot motley dwarf (CMD) is caused by mixed infection of carrot red leaf virus (CtRLV) with either carrot mottle virus (CMoV) or carrot mottle mimic virus, and additional infection with CtRLV‐associated RNA (CtRLVaRNA). Here, the author investigated the viruses or virus‐like RNA isolated from carrots with reddening symptoms in Hokkaido, the northern island of Japan. Three types of infections were mainly detected: single infection with CtRLV, which was most prevalent; double infection with CtRLV and CMoV; and triple infection with CtRLV, CMoV, and CtRLVaRNA. Fields with the three agents were severely affected, with diseased plants showing mottling, whereas in fields where disease incidence was low and sporadic, CtRLV was often found alone in plants with mild symptoms. Inoculation tests using carrot plants showed that CMoV enhanced disease severity, and the RNA accumulation of CtRLV. However, in the presence of CtRLVaRNA (+ CMoV), distinct symptoms such as systemic mottling and stunting developed, while the enhancement of CtRLV accumulation was abolished. These results imply that CtRLVaRNA (+ CMoV) antagonizes CtRLV despite its dependence on CtRLV for aphid transmission, and that mixed infection with CtRLVaRNA is involved in the development of the conspicuous mottling. All agents detected in Hokkaido were very similar to European and American isolates in terms of their genomic sequences and host range. This represents the first report of CMD in Japan, and provides further information on the genetic and biological properties of CMD‐associated agents, as well as the aetiology of the disease.

Virusi biljaka familije štitonoša

The Apiaceae are a large plant family consisting of approximately 250 genera and over 3,000 species grown worldwide. Its representative vegetables are carrot, parsley, parsnip and celery, as well as some wellknown spice plants such as fennel, anise, caraway, dill, and coriander. Their production is imperiled by numerous pathogens, among which viruses are of great importance. Globally more than 30 viruses are known to affect carrot and other plant species belonging to family Apiaceae. The principal viruses are: Celery mosaic virus (CeMV), Parsnip yellow fleck virus, (PYFV), Carrot red leaf virus (CtRLV) and Carrot mottle virus (CMoV). In Serbia, three viruses are present on carrot and celery: CeMV, Cucumber mosaic virus (CMV) and Tomato spotted wilt tospovirus (TSWV). The economic importance of viruses infecting umbelliferous has long been recognised due to the foliar symptoms and viral dieback of seedlings. These viruses affect carrot crops only sporadically, but when they do occur they can be devastating. Other umbelliferous viruses are known to occur worlwide, however, their effects are not clear.

TRANSMISSION OF VIRUSES ASSOCIATED WITH CARROT MOTLEY DWARF BY MYZUS PERSICAE

Co-infection of Carrot red leaf virus (CtRLV), Carrot mottle virus (CMoV) and Carrot red leaf virus associated RNA (CtRLVaRNA) causes Carrot motley dwarf (CMD) disease. This study examined the capacity of the aphid Myzus persicae at transmitting viruses associated with CMD. M. persicae exposed to CMD-infected chervil plants transmitted CtRLV-, CMoV- and CtRLVaRNA to disease-free chervil, fennel, celery, carrot, cilantro, and parsley, as shown by RT-PCR using specific primers. Recipient plants developed typical CMD symptoms. Sequence analysis of the amplified virus genes showed high sequence diversity with corresponding sequences available in GenBank. This study expands on Cavariella aegopodii, the only previously recognized aphid vector of CMD-causing viruses.

Carrot yellow leaf virus is associated with carrot internal necrosis.

Internal necrosis of carrot has been observed in UK carrots for at least 10 years, and has been anecdotally linked to virus infection. In the 2009 growing season some growers had up to 10% of yield with these symptoms. Traditional diagnostic methods are targeted towards specific pathogens. By using a metagenomic approach with high throughput sequencing technology, other, as yet unidentified causes of root necrosis were investigated. Additionally a statistical analysis has shown which viruses are most closely associated with disease symptoms. Carrot samples were collected from a crop exhibiting root necrosis (102 Affected: 99 Unaffected) and tested for the presence of the established carrot viruses: Carrot red leaf virus (CtRLV), Carrot mottle virus (CMoV), Carrot red leaf associated viral RNA (CtRLVaRNA) and Parsnip yellow fleck virus (PYFV). The presence of these viruses was not associated with symptomatic carrot roots either as single viruses or in combinations. A sub-sample of carrots of mixed symptom status was subjected to MiSeq sequencing. The results from these tests suggested Carrot yellow leaf virus (CYLV) was associated with symptomatic roots. Additionally a novel Torradovirus, a novel Closterovirus and two novel Betaflexiviradae related plant viruses were detected. A specific diagnostic test was designed for CYLV. Of the 102 affected carrots, 98% were positive for CYLV compared to 22% of the unaffected carrots. From these data we conclude that although we have yet to practically demonstrate a causal link, CYLV appears to be strongly associated with the presence of necrosis of carrots.

Genomic characterization of pea enation mosaic virus-2 from the Pacific Northwestern USA.

Pea enation mosaic virus (PEMV) infects several legume crops, including chickpea (Cicer arietinum), faba bean (Vicia faba), lentil (Lens culinaris) and pea (Pisum sativum). The virus caused yield losses of food legumes in the Pacific Northwestern US during 1983, 1987 and 1990 [1]. Our recent surveys of pea and alfalfa fields in the states of Washington and Idaho, USA, have shown the prevalence of PEMV on pea. PEMV consists of a large (RNA-1 or PEMV-1) and a small (RNA-2 or PEMV-2) single-stranded positive-sense RNA, which are encapsidated separately into distinct isometric particles [2]. PEMV-2 is one of the seven distinct virus species in the genus Umbravirus. The other species of this genus are Carrot mottle virus (CMoV), Carrot mottle mimic virus (CMoMV), Groundnut rosette virus (GRV), Lettuce speckles mottle virus (LSMV), Tobacco mottle virus (TMoV) and Tobacco bushy top virus (TBTV) [3]. Members of this group lack the coat protein (CP) gene in their genomes and depend on a helper virus for survival [4]. PEMV-2 in association with PEMV-1 (genus Enamovirus), form a symbiotic bipartite virus complex referred to as PEMV. It has been suggested that RNA-1 and RNA-2 are essential for PEMV infection [4, 5]. The RNA-1 (5706 nucleotides) encodes five major ORFs (1-5) that have nucleotide and amino acid sequence similarities with subgroup II luteoviruses [5]. While PEMV-1 provides the necessary encapsidation and vector-transmission abilities for PEMV-2, the latter provides PEMV-1 with long-distance movement and mechanical transmission functions. As part of an ongoing project to determine the genetic diversity of PEMV, we recently characterized the genome of PEMV-1 from the Pacific Northwest [6]. So far, there are only two complete genomic sequences of PEMV-2 in GenBank (NC_003853 and AY714213). To better understand sequence diversity of PEMV-2, the genome structure and organization of two PEMV isolates, one from Idaho (PEMV-2-ID) and one from Washington (PEMV-2-WA), were determined in this study. The PEMV-2 genome (*4.2 kbp), like that of other umbraviruses, predominantly consists of four ORFs (1-4), which perform diverse functions [4, 7, 8]. RNA-2 lacks a polyadenylation signal at its 30 end and contains a large 50 genome-linked protein [9]. ORF-1, at the 50 end of the virus genome, initiates after a short, 20-nt non-coding region (NCR) and encodes a putative 33-kDa protein of unknown function. ORF-2 overlaps with ORF-1 at its 30 end and potentially encodes a protein of 65 kDa through a frameshift mechanism. ORF-2 contains sequence motifs characteristic of a viral RNA-dependent RNA-polymerase (RdRp). The presence of a polymerase cassette in RNA-2 also reveals its independent replicative capabilities. Also, due to the presence of an octanucleotide frameshift signal ‘‘GGATTTTT’’ immediately upstream of the stop codon of ORF-1, ORF-1, along with ORF-2, is expressed by a -1 frameshift mechanism as a minor translation product of 97 kDa [4]. ORFs 3 and 4 in the genome occur after a nonThe sequences described here were deposited in the GenBank database with the following accession numbers: JF713435 for PEMV2-WA and JF713436 for PEMV-2-ID.

First Report of Carrot red leaf virus and Carrot mottle virus, Causal Agents of Carrot Motley Dwarf, in Carrot in Mauritius.

Carrot motley dwarf (CMD) affects carrot and other apiaceous plants by causing leaf yellowing or reddening as well as plant stunting and leads often to serious economic losses wherever these crops are grown (2). CMD has been reported from Australia, Europe, Japan, Israel, and North America and is known to result from a mixed infection by at least two viruses, the polerovirus, Carrot red leaf virus (CtRLV), and one of the umbraviruses, Carrot mottle virus (CMoV) or Carrot mottle mimic virus (CMoMV). The viruses are transmitted in a circulative persistent manner by aphid species (Cavariella spp.). In November of 2008, symptoms typical of CMD were observed in carrot (Daucus carota) and coriander (Coriandrum sativum) plantations in the region of Henrietta in the central part of Mauritius. Carrot cultivars affected were Victoria, Sigma, and Namdhari. Incidences of up to 50% were recorded in some fields. Symptoms were observed mainly on plants near the edges of fields and were initially attributed to physiological factors. However, following RNA extraction from affected carrot plants and reverse transcription (RT)-PCR, fragments of the expected sizes (CtRLV; 377 bp: CMoV; 549 bp) were obtained. For CtRLV, a pair of degenerate primers (S2/AS3 [1]) for poleroviruses, and for the above mentioned umbraviruses, a universal primer pair (UmbraCS: CTTTGGAGTACACAACAACTCC and UmbraCAS: GCA/GTCIAGICCIACACAA/GACTGG, I = Inosin; unpublished) was used. Direct sequencing of one PCR product for each virus (Eurofins MWG Operon GmbH, Martinsried, Germany) and comparison with sequences retrieved from GenBank resulted in nucleotide and amino acid sequence identities of 93 and 90% (coat protein) to the CtRLV strain UK-1 (Accession No. AY695933) and 86 and 96% (replicase) to the German CMoV isolate (Accession No. FJ188473), respectively. Carrot samples also tested CtRLV-positive in triple-antibody sandwich-ELISA using polyclonal IgGs to CtRLV for trapping and a mixture of two CtRLV-specific monoclonal antibodies (CtRLV-2-3A9 and CtRLV 3-4B9) as detecting antibodies (all from the stock of the Julius Kuehn Institute; H. J. Vetten, Braunschweig, Germany). The presence of CMoV was confirmed by sap transmission to Nicotiana benthamiana and N. occidentalis 'P1', which resulted in vein yellowing/etching symptoms. In addition, agarose gel electrophoresis of the dsRNA extract of a primary infected carrot sample revealed major dsRNAs of approximately 4.2 and 1.4 kbp, which represent the genomic and subgenomic RNAs of an umbravirus. Thus, sequence analysis, as well as serological and biological data, demonstrates that CMD-affected carrot plants from Mauritius were infected with CtRLV and CMoV isolates closely related to those from Europe. The sequences obtained in this study for CtRLV and CMoV have been deposited in GenBank under Accession Nos. FJ969849 and FJ969848, respectively. To our knowledge, this is the first report of CMD in Mauritius and the Indian Ocean Region. Future works comprise an island wide survey across carrot-growing regions to determine the incidence of the virus complex and the natural host range of the viruses in Mauritius.

Nucleotide sequence of a satellite RNA associated with carrot motley dwarf in parsley and carrot

Carrot motley dwarf (CMD) is known to result from a mixed infection by two viruses, the polerovirus Carrot red leaf virus and one of the umbraviruses Carrot mottle mimic virus or Carrot mottle virus. Some umbraviruses have been shown to be associated with small satellite (sat) RNAs, but none have been reported for the latter two. A CMD-affected parsley plant was used for sap transmission to test plants, that were used for dsRNA isolation. The presence of a 0.8-kbp dsRNA indicated the occurrence of a hitherto unrecognized satRNA associated with CMD. The satRNAs of the CMD isolate from parsley and an isolate from carrot have been sequenced and showed 94% sequence identity. Nucleotide sequences and putative translation products had no significant similarities to GenBank entries. To our knowledge, this is the first report of satRNAs associated with CMD.

Complete nucleotide sequence of a carrot isolate of Carrot mottle virus from Germany

Complete nucleotide sequence of a carrot isolate of Carrot mottle virus from Germany

Carrot mottle virus. [Distribution map

Abstract A new distribution map is provided for Carrot mottle virus. Virus: Umbravirus. Hosts: carrot ( Daucus carota ); parsley ( Petroselinum crispum ), cow parsley ( Anthriscus sylvestris ) and other wild hosts. Information is given on the geographical distribution in Europe (Belgium, Denmark, France, Germany, the Netherlands, UK, England and Wales, Scotland), Asia (Japan), Africa (Morocco), North America (Canada, British Columbia, USA, California, Pennsylvania, Washington, Wisconsin), South America (Brazil, Minas Gerais, Sao Paulo), Oceania (Australia, New South Wales, South Australia, Tasmania, Victoria, Western Australia, New Zealand).

Specificity of the effect of sap‐transmissible viruses in increasing the accumulation of luteoviruses in co‐infected plants

SummaryThe concentration of potato leafroll luteovirus (PLRV) (c. 1300 ng/g leaf) in singly infected Nicotiana clevelandii plants was increased up to 10‐fold in plants co‐infected with each of several potyviruses, or with narcissus mosaic potexvirus, carrot mottle virus or each of three tobravirus isolates. With the tobraviruses, PLRV concentration was increased equally by co‐infection with either NM‐type isolates (coat protein‐free cultures containing RNA‐1) or M‐type isolates (particle‐producing cultures containing RNA‐1 and RNA‐2). In contrast, the accumulation of PLRV was not substantially affected by co‐infection with either of two nepoviruses, cucumber mosaic cucumovirus, broad bean mottle bromovirus, alfalfa mosaic virus, pea enation mosaic virus or parsnip yellow fleck virus. The specificity of these interactions between PLRV and sap‐transmissible viruses was retained in tests made in Nicotiana benthamiana and when beet western yellows luteovirus was used instead of PLRV.

Properties and partial purification of infective material from plants containing groundnut rosette virus*

SUMMARYGroundnut plants with chlorotic rosette disease contain a manually transmissible virus, groundnut rosette (GRV), which is also transmitted in the persistent (circulative) manner by aphids (Aphis craccivora), but only from plants that are co‐infected with a manually non‐transmissible luteovirus, groundnut rosette assistor virus (GRAV). Strains of GRV from plants with chlorotic or green forms of rosette are called GRV(C) and GRV(G) respectively. An isolate of GRV(C) from Nigeria remained infective in Nicotiana clevelandii leaf extracts for 1 day at room temperature and for 15 days at 4d̀C, but lost infectivity after 1 day at ‐20d̀C or after dilution to 10‐‐4. Its infectivity and longevity in vitro were not altered by addition of 1 mg/litre bentonite to the extraction buffer. Infectivity in leaf extracts was abolished by treatment with 50% (v/v) ether, 10% (v/v) chloroform or 8% (v/v) n‐butanol, but not by treatment for 30 min with RNase A at up to 100 ng/ml. In attempts to purify GRV(C), nearly all the infectivity from N. clevelandii extracts was found in the pellets from centrifugation at 65 000 g for 1. 5 h; infectivity also occurred in a cell membrane fraction that collected at the top of a 30% sucrose ‘cushion’ containing 4% polyethylene glycol and 0.2 M NaCI. However, no virus‐like particles were found in either type of preparation by electron microscopy.Nucleic acid preparations made directly from GRV(C)‐infected N. clevelandii leaves were very infective; this infectivity was totally inactivated by treatment for 30 min with RNase A at 10 ng/ml in buffers of both low and high ionic strength and was therefore attributed to ssRNA. When nucleic acid preparations were electrophoresed in gels no virus‐specific bands were visible but the position of the infectivity indicated that the infective ssRNA has an apparent mol. wt of c. 1.55 × 106. A similar mol. wt was indicated by the rate of sedimentation of the infective ssRNA in sucrose gradients. Preparations of dsRNA made from GRV(C)‐infected N. clevelandii leaves contained a species of mol. wt c. 3.0 × 106; in addition some dsRNA preparations contained an abundant component of mol. wt c. 0.6 × 106 together with several other components of intermediate mol. wt. Similar patterns of bands were observed in dsRNA preparations made from Nigerian‐grown groundnut material infected with GRV(C) alone, or with GRV(C) + GRAV, or with GRV(G) + GRAV.The properties of GRV closely resemble those of two other viruses that depend on luteoviruses for transmission by aphids, carrot mottle virus and lettuce speckles mottle virus.

Carrot Red Leaf and Carrot Mottle Viruses: Observations on the Composition of the Particles in Single and Mixed Infections

SUMMARY Particles of carrot red leaf virus (CRLV; luteovirus group) purified from chervil (Anthriscus cerefolium) contain a single ssRNA species of mol. wt. about 1.8 × 106 and a major protein of mol. wt. about 25000. CRLV acts as a helper for aphid transmission of carrot mottle virus (CMotV; ungrouped) from mixedly infected plants. Virus preparations purified from such plants possess the infectivity of both viruses but contain particles indistinguishable from those of CRLV; some of the particles are therefore thought to consist of CMotV RNA packaged in CRLV coat protein. When RNA from such preparations was electrophoresed in agarose/polyacrylamide gels, CMotV infectivity was associated with an RNA band that migrated ahead of the CRLV RNA band and had an estimated mol. wt. of about 1.5 × 106, similar to that previously found for the infective ssRNA extracted directly from Nicotiana clevelandii leaves infected with CMotV alone. Preparations of dsRNA from CMotV-infected N. clevelandii leaves contained two species: one of mol. wt. about 3.2 × 106, presumably the replicative form of the infective ssRNA, and the other, mol. wt. about 0.9 × 106, of unknown origin and function. The infective agent in buffer extracts of CMotV-infected N. clevelandii was resistant to RNase (although the enzyme acted as a reversible inhibitor of infection at high concentrations) and is therefore not unprotected RNA. It may be protected within the approximately 52 nm enveloped structures previously reported.

Further evidence on the nature of the dependence of carrot mottle virus on carrot red leaf virus for transmission by aphids

SUMMARYPreparations were made from chervil plants doubly infected with carrot mottle virus (CMotV) and its helper virus, carrot red leaf (CRLV), on which it depends for transmission by the aphid Cavariella aegopodii, by the procedure developed previously for CRLV. The preparations contained 25 nm isometric particles which were indistinguishable from those of CRLV but possessed aphid‐transmissible infectivity of both viruses and manually transmissible infectivity of CMotV. Only one sedimenting and buoyant density component was detected. The manually transmissible CMotV infectivity was resistant to freezing and to organic solvents, treatments that destroyed the CMotV infectivity in extracts from singly infected plants. The aphid‐transmissible CMotV infectivity in preparations from CRLV/ CMotV‐infected plants, and that in extracts from CRLV/CMotV‐carrying C. aegopodii, was abolished by treatment with CRLV antiserum but not with normal serum. These results show that transmission of CMotV by C. aegopodii is dependent on the packaging of its RNA in coats composed partially or entirely of CRLV particle protein.The aphid Myzus persicae does not transmit CRLV or CMotV from plants mixedly or singly infected with these viruses but it is a vector of beet western yellows virus (BWYV) and potato leafroll virus (PLRV) and it transmitted CMotV from plants that also contained either of these viruses. This suggests that the coat proteins of BWYV and PLRV can substitute for that of CRLV in packaging CMotV nucleic acid and thereby confer on it their own vector specificities.

Molecular Weight of the Infective RNA from Leaves Infected with Carrot Mottle Virus

SUMMARY Highly infective nucleic acid preparations were made from Nicotiana clevelandii leaves infected with carrot mottle virus (CMotV). The infective material had the properties of a single-stranded RNA but was less than 1% of the total RNA in the preparations. It had an apparent mol. wt. of about 1.5 to 1.6 × 106 in agarose-polyacrylamide gels and a sedimentation coefficient of about 28 to 30S in linear-log sucrose gradients. The infective RNA did not contain any considerable poly-adenylate sequence, nor did it require an associated protein for infectivity.

Aphid‐injection experiments with carrot mottle virus and its helper virus, carrot red leaf

SUMMARYCarrot mottle virus (CMotV) and its helper virus, carrot red leaf (CRLV), were not transmitted by aphids (Cavariella aegopodii) that had fed through membranes on, or had been injected with, sap from mixedly infected chervil plants or partially purified preparations of CMotV. However, the viruses were transmitted by recipient aphids injected with haemolymph from donor aphids that had fed on mixedly infected plants but not by a second series of recipients injected with haemolymph from the first series. Some of the first series of recipients transmitted both viruses for up to 11 days but others transmitted erratically and many lost ability to transmit after a few days. The results confirm that both viruses are circulative but provide no evidence for multiplication in the vector.Non‐viruliferous aphids, or aphids that had acquired CRLV by feeding, did not transmit CMotV when they were injected with haemolymph from aphids that had fed on a source of CMotV alone, confirming that they can only transmit CMotV when they acquire it from a mixedly infected plant. When extracts from donor aphids were treated with ether before injection, recipient aphids transmitted both CRLV and CMotV, although the infectivity of CMotV grown in Nicotiana clevelandii in the absence of CRLV is destroyed by ether treatment. CMotV particles acquired by aphids from mixedly infected plants therefore differed in some way from those in singly infected plants. A plausible explanation of these results, and of the dependence of CMotV on CRLV for aphid transmission, is that doubly infected plants contain some particles that consist of CMotV nucleic acid coated with CRLV protein.

Cytopathological Changes and Extractable Infectivity in Nicotiana clevelandii Leaves Infected with Carrot Mottle Virus

SUMMARY Cytopathological changes induced by carrot mottle virus in systemically infected cells of Nicotiana clevelandii plants grown at 17 °C and illuminated at 4000 lux for 8 h/day, were studied in relation to the infectivity of buffer and phenoltreated extracts. Changes were most obvious in palisade cells. About six days after inoculation, tubules appeared in the cytoplasm, associated with the plasmodesmata. Later the tubules, some of which became sheathed by cell wall material forming plasmodesmatal outgrowths, extended towards the vacuole, others towards the nucleus, causing invaginations in it. Endoplasmic reticulum and Golgi bodies increased, especially in areas adjacent to the nuclei, and complexes of cytoplasmic tubules with endoplasmic reticulum were observed. Membrane-bound particles, some with densely-staining central spots, appeared in the vacuole close to the tonoplast and reached their maximum number after 8 to 9 days. Sometimes they were clustered where a plasmodesmatal tubule or outgrowth came close to the tonoplast. Tests with the phenol-treated and buffer extracts showed that the cells contained both labile and stable forms of infectivity. The former predominated early in systemic infection (about 5 to 7 days after inoculation) and then declined, while the amount of stable infectivity increased, reaching a maximum after 8 to 9 days. It is suggested that the labile form of infectivity consists of RNase-sensitive material, probably nucleocapsids, which become stable (RNase-resistant) when they receive a protective envelope on entry into the vacuole.