Carboxymethylcellulose Medium Research Articles

Cellulase Induction in Three Aspergillus Species Isolated From Artemisia annua L. Plantation Soil Using Different Cellulose Substrates

This study was aimed at isolation and screening of fungal species associated with Artemisia annua Plantation soils from one of the under studied areas in Plateau state, Nigeria for cellulase activity. A total of thirteen fungal species were isolated from various locations within the A. annua Plantation and were screened for cellulase production. Agar plate assay was carried out using basal medium supplemented with 1% Carboxymethylcellulose (CMC) powder and staining with 0.1% Congo red solution after the incubation period. Among these species, Aspergillus fumigatus, A. niger and A. terreus were more predominant and were recorded as cellulase producing species. They have shown to possess cellulose degrading ability and exhibited maximum zones of hydrolysis on Carboxymethylcellulose medium and were selected for enzyme assay using submerged fermentation (SmF). Enzyme production was analyzed by Dinitrosalicylic acid (DNSA) methods and the enzymes assayed for were CMCase (β-1,4-endoglucanase), β-glucosidase and FPase (total cellulose) using Carboxymethylcellulose, cellulose acetate and Filter paper as substrates respectively. The highest cellulase activity was observed on the 3 rd day in A. niger with enzyme production of 0.045IU/ml and 0.040IU/ml on CMC and filter paper media respectively. A . fumigatus had high enzyme activity of 0.037IU/ml and 0.025IU/ml on filter paper and cellulose acetate media respectively. Highest enzyme production of 0.034IU/ml was recorded for A. terreus on the 3 rd day on cellulose acetate medium. These fungal species could be employed specially to perform in situ environmental applications involving cellulose biodegradation of wastes.

English

The screening plate method is commonly used for previous detection of cellulases produced by micro-organisms with biotechnological potential. In this manuscript, the authors aim to evaluate the hydrolytic ability of different fungi isolated from soil for the production of cellulolytic enzymes for cellulose degradation and determining the enzymatic index (EI) in relation to the growth of fungal colony and halo. The fungi were grown in carboxymethyl cellulose medium (CMC 1% w/v) and Avicel medium (Cellulose microcrystalline 1% w/v) for the determination of endo-glucanases and exo-glucanases respectively at 28°C for 48 h. Four chromogenic dyes were used: Congo Red, Phenol Red, Trypan Blue and Gram’s Iodine. Also, another screening method was compared using carboxymethyl cellulose medium (CMC 1% w/v) at 28°C for 96 h and exposed with Congo Red dye in buffer Tris HCl 0.1 M, pH 8.0. The results obtained allowed to find significant differences between the tested fungi, the growth time and chromogenic dyes. The strains with higher Enzymatic Index (EI) were JCO1, UFT1, UFT2 and UFT3 for endo-glucanases and JCO2, UFT1, UFT2 and UFT3 for exo-glucanases. Key words: Cellulases, chromogenic dyes, filamentous fungi, endo-glucanase, exo-glucanase.

First Report of Bacterial Leaf Spot of Pumpkin Caused by Xanthomonas cucurbitae in Georgia, United States.

In August 2012, a commercial pumpkin (Cucurbita maxima L. cv. Neon) field in Terrell County, GA, had a disease outbreak that caused severe symptoms on leaves and fruits. Leaves displayed small (2 to 3 mm), angular, water-soaked, yellow lesions while fruits had small (2 to 3 mm), sunken, circular, dry lesions. The field exhibited 40% disease incidence with observable symptoms on fruits. In severe cases, fruit rots were also observed. Symptomatic leaves and fruits were collected from 25 pumpkin plants and isolations were made on both nutrient agar and yeast extract-dextrose-CaCO3 (YDC) agar medium (1). Xanthomonad-like yellow colonies were observed on both agar plates and colonies appeared mucoid on YDC. Suspect bacteria were gram-negative, oxidase positive, hydrolyzed starch and esculin, formed pits on both crystal violet pectate and carboxymethyl cellulose media, but were indole negative and did not produce nitrites from nitrates. Bacterial isolates also produced hypersensitive reactions on tobacco when inoculated with a bacterial suspension of 1 × 108 CFU/ml. Identity of the isolates were identified as genus Xanthomonas by using primers RST2 (5'AGGCCCTGGAAGGTGCCCTGGA3') and RST3 (5'ATCGCACTGCGTACCGCGCGCGA3') in a conventional PCR assay, which produced an 840-bp band. The 16S rRNA gene of five isolates was amplified using universal primers fD1 and rD1 (3) and amplified products were sequenced and compared using BLAST in GenBank. The nucleotide sequences (1,200 bp) of the isolates matched Xanthomonas cucurbitae (GenBank Accession AB680438.1), X. campestris (HQ256868.1), X. campestris pv. campestris (NR074936.1), X. hortorum (AB775942.1), and X. campestris pv. raphani (CP002789.1) with 99% similarity. PCR amplification and sequencing of a housekeeping gene atpD (ATP synthase, 720 bp) showed 98% similarity with X. cucurbitae (HM568911.1). Since X. cucurbitae was not listed in the BIOLOG database (Biolog, Hayward, CA), substrate utilization tests for three pumpkin isolates were compared with utilization patterns of Xanthomonas groups using BIOLOG reported by Vauterin et al. (4). The isolates showed 94.7, 93.7, and 92.6% similarity to the reported metabolic profiles of X. campestris, X. cucurbitae, and X. hortorum, respectively, of Xanthomonas groups 15, 8, and 2. However, PCR assay with X. campestris- and X. raphani-specific primers (3) did not amplify the pumpkin isolates, indicating a closer relationship with X. cucurbitae. Spray inoculations of five bacterial isolates in suspensions containing 1 × 108 CFU/ml on 2-week-old pumpkin seedlings (cv. Lumina) (n = five seedlings/isolate/experiment) under greenhouse conditions of 30°C and 70% RH produced typical yellow leaf spot symptoms on 100% of the seedlings. Seedlings (n = 10) spray-inoculated with sterile water were asymptomatic. Reisolated bacterial colonies from symptomatic seedlings displayed similar characteristics to those described above. Further confirmation of bacterial identity was achieved by amplifying and sequencing the 16S rRNA gene, which showed 98 to 99% similarity to X cucurbitae accessions in GenBank. To our knowledge, this is the first report of X. cucurbitae on pumpkin in Georgia. As this bacterium is known to be seedborne, it is possible that the pathogen might have introduced through contaminated seeds.

Production and partial purification of cellulase from a novel fungus, Aspergillus flavus BS1

This study describes the isolation and characterization of a novel fungus, Aspergillus flavus BS1 and its cellulolytic activities with special emphasis on endoglucanase production. Preliminary screening studies showed that A. flavus BS1 was a potent strain for the production of cellulase. To study the cellulolytic activities in detail by submerged fermentation (SmF), productions of endoglucanase, exoglucanase, and β-glucosidase were estimated from the basal salt medium (BSM) supplemented with 1 % carboxy methyl cellulose (CMC). CMC medium supported the maximum yield of endoglucanase (2,793 U/ml) on day 5 of incubation at 28 °C and 150 rpm, which was higher than that obtained with naturally available supplements (flour) from banana, tapioca, potato, or banana peel. During cellulase production by solid-state fermentation, 10 % (w/w) tapioca flour in sawdust (teak wood) moisturized with BSM (1:2, w/v) supported maximum cellulase yield (5,408 U/g dry substrate) on day 3 at 28 °C, which was 2-fold higher than that obtained during SmF. The active cellulase was qualitatively estimated by polyacrylamide gel electrophoresis (PAGE). Native-PAGE (0.25 % CMC impregnated on the 10 % gel) activity staining with congo-red showed a clear zone for CMCase activity, whereas SDS-PAGE showed a distinct band. In conclusion, this study showed that A. flavus strain BS1 is a potent strain for the production of cellulase on lignocellulosic media, the hot enzyme for bioethanol production from the lignocellulosic biomass by SSF.

A New Report of Xanthomonas cucurbitae Causing Bacterial Leaf Spot of Watermelon in Georgia, USA.

In June 2012, watermelon leaves (Citrullus lanatus (Thunb.) Matsum. & Nakai) were observed with angular, necrotic spots with chlorotic halos in a field in Telfair County, GA. The field exhibited 20 to 25% disease incidence with no observable symptoms on fruits. Isolations were made from foliar lesions of 30 leaves onto yeast extract-dextrose-CaCO3 (YDC) agar medium (3). Yellow-pigmented, Xanthomonas-like colonies were observed after 48-h incubation at 28°C from 100% of the samples. Bacteria harvested were gram-negative, oxidase-negative, indole-negative, hydrolyzed starch and esculin, and formed pits on crystal violet pectate and carboxymethyl cellulose media. The bacterial isolates did not produce nitrites from nitrates but produced hypersensitive reactions on tobacco upon inoculation with 1 × 108 colony-forming units (CFU)/ml. These characteristics are typical of members of the Xanthomonas campestris group. The genus Xanthomonas was confirmed using conventional PCR with genus-specific primers RST2 (5'AGGCCCTGGAAGGTGCCCTGGA3') and RST3 (5'ATCGCACTGCGTACCGCGCGCGA3'), which produced an 840-bp band. Universal primers fD1 and rD1 (1) were used to amplify the 16S rRNA gene from four isolates and amplified products were sequenced and BLAST searched in GenBank. The nucleotide sequences of the isolates showed 97 to 98% similarity to X. cucurbitae (Accessions AB680438.1 and Y10760), X. campestris (HQ256868.1), X. arboricola (JF835910.1), X. oryzae pv. oryzicola (CP003057.1) and X. campestris pv. raphani (CP002789.1). PCR amplification and sequencing of the atpD gene (ATP synthase, 720 bp) showed 99% similarity with X. cucurbitae when BLAST searched in GenBank (HM568911.1). X. cucurbitae was not present in the database of BIOLOG (Biolog, Hayward, CA); therefore, substrate utilization tests of three isolates were compared with substrate utilization patterns of Xanthomonas groups reported by Vauterin et al. (4). The watermelon isolates displayed 93.7, 89.5, and 89.5% similarity with the reported BIOLOG metabolic profiles of X. campestris, X. cucurbitae, and X. hortorum, respectively, of Xanthomonas groups 15, 8, and 2. However, none of the isolates were amplified using a conventional PCR assay with X. campestris pv. campestris and X. campestris pv. raphani-specific primers (2), indicating a closer relationship with X. cucurbitae. When 2-week old watermelon seedlings cv. Crimson sweet (n = 4/isolate/experiment) were inoculated by spraying with a suspension of 1 × 108 CFU/ml, 100% of the seedlings developed symptoms (water soaked angular lesions that developed into necrotic spots) 14 days after planting under greenhouse conditions (~30°C and ~70% RH). Ten control plants inoculated with sterile water remained asymptomatic. Bacterial colonies were reisolated from symptomatic seedlings that showed similar characteristics to those described above. The identity of isolated colonies was confirmed by amplifying and sequencing the 16S rRNA gene, which showed 97 to 98% similarity to X cucurbitae accessions in GenBank. To our knowledge, this is the first report of X. cucurbitae on watermelon in Georgia since the 1950s.

Association between Pseudonocardia symbionts and Atta leaf-cutting ants suggested by improved isolation methods.

Fungus-growing ants associate with multiple symbiotic microbes, including Actinobacteria for production of antibiotics. The best studied of these bacteria are within the genus Pseudonocardia, which in most fungus-growing ants are conspicuously visible on the external cuticle of workers. However, given that fungus-growing ants in the genus Atta do not carry visible Actinobacteria on their cuticle, it is unclear if this genus engages in the symbiosis with Pseudonocardia. Here we explore whether improving culturing techniques can allow for successful isolation of Pseudonocardia from Atta cephalotes leaf-cutting ants. We obtained Pseudonocardia from 9 of 11 isolation method/colony component combinations from all 5 colonies intensively sampled. The most efficient technique was bead-beating workers in phosphate buffer solution, then plating the suspension on carboxymethylcellulose medium. Placing these strains in a fungus-growing ant-associated Pseudonocardia phylogeny revealed that while some strains grouped with clades of Pseudonocardia associated with other genera of fungus-growing ants, a large portion of the isolates fell into two novel phylogenetic clades previously not identified from this ant-microbe symbiosis. Our findings suggest that Pseudonocardia may be associated with Atta fungus-growing ants, potentially internalized, and that localizing the symbiont and exploring its role is necessary to shed further light on the association.

Optimization and Validation of a Plaque Reduction Neutralization Test for the Detection of Neutralizing Antibodies to Four Serotypes of Dengue Virus Used in Support of Dengue Vaccine Development

A dengue plaque reduction neutralization test (PRNT) to measure dengue serotype–specific neutralizing antibodies for all four virus serotypes was developed, optimized, and validated in accordance with guidelines for validation of bioanalytical test methods using human serum samples from dengue-infected persons and persons receiving a dengue vaccine candidate. Production and characterization of dengue challenge viruses used in the assay was standardized. Once virus stocks were characterized, the dengue PRNT50 for each of the four serotypes was optimized according to a factorial design of experiments approach for critical test parameters, including days of cell seeding before testing, percentage of overlay carboxymethylcellulose medium, and days of incubation post-infection to generate a robust assay. The PRNT50 was then validated and demonstrated to be suitable to detect and measure dengue serotype-specific neutralizing antibodies in human serum samples with acceptable intra-assay and inter-assay precision, accuracy/dilutability, specificity, and with a lower limit of quantitation of 10.

Biocontrol of Pythium aphanidermatum by the cellulolytic actinomycetes Streptomyces rubrolavendulae S4

Streptomyces rubrolavendulae (Yen) S4, isolated from a termite mound in Kanchanaburi, Thailand, was used to control the seedling damping-off disease of the horticultural plant Joseph's coat caused by Pythium aphanidermatum (Edson) Fitz. In a previous study, S. rubrolavendulae S4 was shown to strongly inhibit the growth of P. aphanidermatum on potato dextrose agar. This study investigated the modes of the antagonistic action of S. rubrolavendulae S4 on P. aphanidermatum. On carboxymethyl cellulose medium, S. rubrolavendulae S4 produced the highest cellulase activity of 65 U/ml in 5 days. The S. rubrolavendulae culture supernatant, with and without heat treatment, was tested for fungal growth inhibition using an agar well-diffusion method. The inhibitory effect was retained with the heat inactivated culture supernatant, indicating that the inhibition was derived from an antifungal compound rather than an enzyme produced by S. rubrolavendulae S4. The parasitic activity of S. rubrolavendulae S4 upon P. aphanidermatum was demonstrated by light and scanning electron micrographs. Joseph's coat (Amaranthus tricolor) seedlings were grown in peat mosses inoculated with S. rubrolavendulae S4 and P. aphanidermatum. In pots containing S. rubrolavendulae S4, the proportion of healthy seedlings was significantly increased. This was equivalent to the effect of the fungicide metalaxyl, and similar to the results from sterilized peat moss. Hence S. rubrolavendulae S4 can be used as an effective biological control agent in Joseph's coat cultivation.

Isolation, Screening, and Optimization of the Fermentation Conditions of Highly Cellulolytic Bacteria from the Hindgut of Holotrichia parallela Larvae (Coleoptera: Scarabaeidae)

From the hindgut contents of Holotrichia parallela, 93 cellulolytic bacterial isolates were isolated after enrichment in carboxymethyl cellulose medium. Among these isolates, a novel bacterium, designated HP207, with the highest endoglucanase productivity was selected for further study. This bacterium was identified as Pseudomonas sp. based on the results of the 16S ribosomal DNA analysis, morphological characteristics, and biochemical properties. The production of the endoglucanase was optimized by varying various physical culture conditions using a submerged fermentation method. Under the optimized fermentation conditions, the maximum endoglucanase activity of 1.432 U mL(-1) in bacterial cultures was obtained, higher than those of the most widely studied bacteria and fungi, which are the attractive candidates for the commercial producer of cellulase. And the crude endoglucanase enzyme was also highly thermostable; approximately 55% of the original activity was maintained after pretreatment at 70 °C for 1 h. Thus, from the present study, the bacterium can be added up to the database of cellulolytic bacteria.

Construction of the mutant strain in Aspergillus oryzae 3.042 for abundant proteinase production by the N+ ion implantation mutagenesis

SummaryBecause of secreting large amounts of enzymes, Aspergillus oryzae was widely used in the fermentation of soy sauce in many Asian countries. Here, N+ ion implantation mutagenesis was applied to improve the ability of A. oryzae to secrete acid protease. Several mutants were screened using three kinds of plates (Casein medium, Czapek’s medium and carboxymethyl cellulose medium agar plates). Compared with the other mutants, the mutant A100‐8 could secrete the most protease. Acid protease activity of A100‐8 was enhanced about 44.1% at 36 h by koji fermentation test. In addition, A100‐8 was stable by periodically subculturing and maintaining on the agar slant. The mRNA expression levels of two kinds of acid protease (serine carboxypeptidase and aspartyl protease) were measured by RT‐PCR at different periods. Serine carboxypeptidase and some kinds of aspartyl protease of A100‐8 were significantly (P < 0.01) expressed higher than the control at all times.

Enzymatic degradation of steam-pretreated Lespedeza stalk (Lespedeza crytobotrya) by cellulosic-substrate induced cellulases

The cellulase production by Trichoderma viride, cultivated on different substrates, namely steam-pretreated Lespedeza, filter paper, microcrystalline cellulose (MCC) or carboxymethyl cellulose (CMC), was studied. Different cellulase systems were secreted when cultivated on different substrates. The cellulolytic enzyme from steam-pretreated Lespedeza medium performed the highest filter paper activity, exoglucanase and endoglucanase activities, while the highest β-glucosidase activity was obtained from the enzyme produced on filter paper medium. The hydrolytic potential of the enzymes produced from different media was evaluated on steam-pretreated Lespedeza. The cellulase from steam-pretreated Lespedeza was found to have the most efficient hydrolysis capability to this specific substrate. The molecular weights of the cellulases produced on steam-pretreated Lespedeza, filter paper and MCC media were 33, 37 and 40 kDa, respectively, and the cellulase from CMC medium had molecular weights of 20 and 43 kDa. The degree of polymerization, crystallinity index and micro structure scanned by the scanning electron microscopy of degraded steam-pretreated Lespedeza residues were also studied.

Detection of single nucleotide polymorphisms in the conserved ESTs regions of Gossypium arboreum

Cellulase is a group of enzymes (endoglucanase, exoglucanase and beta-glucosidase) required for cellulosic feedstock hydrolysis during bioethanol production. The use of recombinant cellulase is a strategy to reduce the enzyme cost. In this context, the present work describes the construction of a cellulase expression vector (pEglABglA), which allowed constitutive co-expression of endoglucanase A (EglA) from an endophytic Bacillus pumilus and the hyperthermophilic β-glucosidase A (BglA) from Fervidobacterium sp. in Escherichia coli . When compared to the non-modified strain DH5α, the recombinant Escherichia coli DH5α (pEglABglA) reduced fivefold the viscosity of the carboxymethylcellulose medium (CMC-M). Also, it presented almost 30-fold increase in reducing sugar released from CMC-M, enabling the recombinant strain to grow using CMC as the sole carbon and energy source. When cultivated in rich media, specific growth rates of recombinant E. coli strains BL21, JM101 and Top10 were higher than those of DH5α and DH10B strains. The constructed plasmid (pEglABglA) can be used as backbone for further cellulase gene addition, which may enhance even more E. coli cellulolytic capacity and growth rate.

Production of endoglucanases and xylanases by white-rot fungi, in carboxymethyl cellulose medium

Production of endoglucanases and xylanases by white-rot fungi, in carboxymethyl cellulose medium

Production of bacterial endoglucanase from pretreated oil palm empty fruit bunch by bacillus pumilus EB3

In this study, endoglucanase was produced from oil palm empty fruit bunch (OPEFB) by a locally isolated aerobic bacterium, Bacillus pumilus EB3. The effects of the fermentation parameters such as initial pH, temperature, and nitrogen source on the endoglucanase production were studied using carboxymethyl cellulose (CMC) as the carbon source. Endoglucanase from B. pumilus EB3 was maximally secreted at 37 degrees C, initial pH 7.0 with 10 g/l of CMC as carbon source, and 2 g/l of yeast extract as organic nitrogen source. The activity recorded during the fermentation was 0.076 U/ml. The productivity of the enzyme increased twofold when 2 g/l of yeast extract was used as the organic nitrogen supplement as compared to the non-supplemented medium. An interesting finding from this study is that pretreated OPEFB medium showed comparable results to CMC medium in terms of enzyme production with an activity of 0.063 U/ml. As OPEFB is an abundant solid waste at palm oil mills, it has the potential of acting as a substrate in cellulase production.

Biocontrol and other beneficial activities of Bacillus subtilis isolated from cowdung microflora

Bacillus subtilis strains isolated from cowdung (CD) had several beneficial attributes, which included biocontrol, plant growth promotion, sulphur (S) oxidation, phosphorus (P) solubilization and production of industrially important enzymes (amylase and cellulase). The B. subtilis strains from CD inhibited the in vitro growth of fungi, Fusarium oxysporum (25-34%) and Botryodiplodia theobromae (100%), isolated from the postharvest rots of yam (Dioscorea rotundata) tubers. Other than biocontrol, B. subtilis strains were able to promote root elongation in seedlings of Cicer arietinum up to 70-74% as compared to untreated seeds (control). B. subtilis strains had also the ability to oxidize elemental S to sulphate (2-15microgml(-1)) and showed distinct P-solubilization activity in vitro. In addition, the cultures showed cellulase activity in carboxy methyl cellulose medium (1.5-1.8mg of reducing sugar24h(-1)ml(-1)) and amylase activity in vitro.

탄소원의 종류가 반추위 혐기 곰팡이 Neocallimastix sp. NLRI-3의 섬유소 분해효소 활력에 미치는 영향 비교

한국 재래산양에서 분리된 Neocallimastix sp NLRI-3을 이용하여 기질의 종류에 따른 미생물의 성장 특성 및 효소단백질의 발현양상을 비교하고자 본 연구를 수행하였다. 혐기배지에 glucose, starch, 볏짚, filter paper, CMC, sigmacell, xylan 및 xylose를 0.2% 수준으로 첨가하여 배양하였다. 배양결과 가스 발생량은 96시간대에서 filter paper 배지에서 가장 높았고 CMC배지에서 가장 낮게 조사되었다(P<0.05). 곰팡이 포자 발생량은 72시간대에서 살펴보면 처리구들 중 볏짚 배지에서 가장 높게 나타났다 (P<0.05). 곰팡이가 분비하는 enzyme activity는 보통 72시간대 이후부터 급격히 증가함을 보이는데 CMCase의 경우에 filter paper disc, sigmacell, xylose에서 활성이 높게 나타났다. xylanase 역가는 starch, rice straw, sigmacell에서 높게 나타났다. Zymogram을 이용하여 각 효소단백질의 발현을 분석한 결과 효소단백질의 발현양상은 전 처리구에 걸쳐 유사하였으나 발현정도는 기질의 종류에 따라 차이가 있음을 알 수 있었다. 또한, zymogram 결과에 의해 6개의 CMCase와 4개의 xylanase가 검출 되었다. 본 연구의 결과로 혐기성 곰팡이의 효소단백질은 배양액에 존재하는 기질의 종류에 의해 발현정도가 영향을 받음을 알 수 있었다. 이러한 결과는 산업적으로 이용 가능한 혐기곰팡이 유래 효소제의 개발에 필요한 배양조건의 결정에 이용될 수 있을 것으로 사료된다. The purpose of this study was to investigate the fungal growth and enzyme production under different carbohydrate substrate conditions. The anaerobic fungus Neocallimastix sp. NLRI-3 isolated from the rumen of Korean native goat was incubated with different carbohydrate media containing 0.2% of glucose, starch, rice straw, filter paper, carboxymethyl cellulose(CMC), Sigmacell cellulose, xylan or xylose, respectively. The culture head gas production was the highest in the culture of filter paper medium, and the lowest in the culture of CMC medium at 96h incubation (P<0.05). The fungal zoospore production reached peak at 72h incubation, and its number was the highest in rice straw medium among the treatments (P<0.05). At 96h incubation, carboxymethyl cellulase(CMCase) activity was the highest in the culture of filter paper medium and the lowest in the culture of starch medium (P<0.05). While xylanase activity was the highest in the culture of rice straw medium and the lowest in the culture of xylose medium(P<0.05) at 72h incubation. There were no differences in culture supernatant protein expression among the treatments. However, the patterns of enzyme expression were different among the treatments with zymogram analysis. Six CMCases and 4 xylanase were detected from the results of zymogram analysis. Therefore the present study indicating that the fungal enzyme expression could be stimulated with insoluble substrates in the culture medium.

Regulation of cellulase production in two thermophilic fungi Melanocarpus sp. MTCC 3922 and Scytalidium thermophilum MTCC 4520

This paper reports regulation of cellulase production in two thermophilic fungi, Melanocarpus sp. MTCC 3922 and Scytalidium thermophilum MTCC 4520. The expression of endoglucanase (EG), avicel adsorbable endoglucanase (AAEG) and β-glucosidase in both fungi was inducible. Of the different carbon sources tested, rice straw induced maximal levels of cellulase in both fungi. While, the addition of fructose (1%, w/v) to the carboxymethylcellulose (CMC) medium resulted in two-fold increase in endoglucanase production in Melanocarpus sp., however, the addition of ethanol (1%, v/v) resulted in eight-fold-increased expression of endoglucanase in S. thermophilum. The expression profiles of different components of cellulase complex were shown to be co-regulated in S. thermophilum but independently regulated in Melanocarpus sp.

Gas–liquid mass transfer studies with triple impeller system on a laboratory scale bioreactor

The gas–liquid mass transfer coefficient K L a in a fermentor is known to be a strong function of the mode of energy dissipation and physicochemical properties of the liquid media. Three impeller combinations namely, single, double and triple impellers, respectively have been tested in the laboratory bioreactor (2 l) for their gas–liquid mass transfer performance. The liquid phase physico-chemical properties have been varied using distilled water, aqueous solutions of sodium carboxymethyl cellulose and simulated fermentation medium. The effects of the process variables such as the impeller speed, gas flow rate and the liquid phase physico-chemical properties on the volumetric liquid phase mass transfer coefficient of oxygen, K L a in a stirred bioreactor were investigated by static gassing out method. Correlations have been developed for the predictions of the gas–liquid mass transfer coefficient with liquids having different physico-chemical properties. It has been observed that triple impeller system gave highest values of gas–liquid mass transfer coefficient with the least power consumption.

Isolation and characterization of a cellulolytic Geobacillus thermoleovorans T4 strain from sugar refinery wastewater.

A novel, cellulolytic, bacterial thermophilic strain, T4, was isolated from sugar refinery wastewater in southern Taiwan. This isolate, a Gram-negative, motile, aerobically growing sporulating rod, can secrete thermostable endocellulase (endo-1,4-beta-D-glucanase, EC 3.2.1.4) and hydrolyze carboxymethylcellulose (CMC), phosphoric acid-swollen cellulose, Avicel, filter paper, and salicin. When strain T4 was grown in CMC medium, the cellulolytic enzyme activity in culture supernatants was stable up to 70 degrees C. More than 10% of the original activity was still detectable after heating to 100 degrees C with a pH 7.0 for 1 h. Based on 16S rDNA sequence analysis, DNA base composition, phenotypic and physiological characteristics, as well as DNA-DNA hybridization, strain T4 was classified as Geobacillus thermoleovorans T4 (DSM 14791 = CCRC 17200). We also demonstrated that the type species G. stearothermophilus (DSM 22 = ATCC 12980) could hydrolyze amorphous and crystalline (filter paper) celluloses at a rate of 13 and 14%, respectively, in comparison with strain T4.

Injected calcium sulfate for consolidation of distraction osteogenesis in rabbit tibia.

This study investigated the effects of calcium sulfate powder injection in a rabbit tibial distraction model. There was one experimental group and two control groups. The calcium sulfate powder, suspended in carboxymethylcellulose (CMC) medium, was injected into the distracted tissue in the experimental rabbit group, whereas only CMC medium was injected into the one control group. The other control group did not undergo any intervention. On radiography and bone mineral density tests, the amount of newly formed bone was greater in the distracted zone of the experimental group than in the two control groups, which showed incomplete bone deposition and calcification. The application of calcium sulfate to distracted tissue increased the rate of osteogenesis and calcification.