Capsicum Annuum Cv Research Articles

RNA-dependent RNA polymerase (NIb) of the potyviruses is an avirulence factor for the broad-spectrum resistance gene Pvr4 in Capsicum annuum cv. CM334.

Potyviruses are one of the most destructive viral pathogens of Solanaceae plants. In Capsicum annuum landrace CM334, a broad-spectrum gene, Pvr4 is known to be involved in resistance against multiple potyviruses, including Pepper mottle virus (PepMoV), Pepper severe mosaic virus (PepSMV), and Potato virus Y (PVY). However, a potyvirus avirulence factor against Pvr4 has not been identified. To identify the avirulence factor corresponding to Pvr4 in potyviruses, we performed Agrobacterium-mediated transient expressions of potyvirus protein coding regions in potyvirus-resistant (Pvr4) and -susceptible (pvr4) pepper plants. Hypersensitive response (HR) was observed only when a RNA-dependent RNA polymerase (NIb) of PepMoV, PepSMV, or PVY was expressed in Pvr4-bearing pepper leaves in a genotype-specific manner. In contrast, HR was not observed when the NIb of Tobacco etch virus (TEV), a virulent potyvirus, was expressed in Pvr4-bearing pepper leaves. Our results clearly demonstrate that NIbs of PepMoV, PepSMV, and PVY serve as avirulence factors for Pvr4 in pepper plants.

Variación en grados de latencia en semillas entre colectas de chile piquín ( Capsicum annuum var. glabriusculum )

El chile piquín ( Capsicum annuum var. glabriusculum ) que se consume en México es, en su mayoría, recolectado de plantas silvestres. Esta actividad podría amenazar la diversidad genética de la especie. Idealmente, el chile piquín debería producirse intensivamente para proteger la población silvestre y satisfacer la demanda; sin embargo, la baja germinación de semillas de esta especie de chile ha sido tradicionalmente un problema para su establecimiento a nivel comercial. Las causas de lo anterior son desconocidas. Identificar las causas de la baja germinación y la diversidad entre colectas es, por tanto, de importancia. Se evaluaron 16 diferentes colectas de chile piquín provenientes de siete estados del país y del sur de Estados Unidos. Un estudio morfológico determinó que en las colectas evaluadas no existen diferencias ni barreras morfológicas que impidan la germinación apropiada de las semillas. Una cinética de imbibición determinó que no existen impedimentos físicos para el paso apropiado de agua al interior de las semillas; sin embargo, la germinación de las 16 colectas fue muy variable (0 a 66%), con un promedio de 15%. El pretratamiento de las semillas con la hormona AG3 (5,000 ppm), elevó la tasa promedio de germinación a 59% en 14 de las 16 colectas, mientras que los tratamientos de acondicionamiento con peróxido de hidrógeno y nitrato de potasio solamente mejoraron la germinación de semillas en dos y cuatro colectas, respectivamente. El presente trabajo corrobora que la limitante de germinación en semillas de chile piquín se debe a un fenómeno de latencia fisiológica, la cual puede romperse con aplicación exógena de AG3 a 5,000 ppm, cuyos efectos varían entre colectas.

Molecular Characterization of Tomato Yellow Leaf Curl Virus in Korea and the Construction of an Infectious Clone

Several tomato production regions in Korea were surveyed for tomato yellow leaf curl disease (TYLCD). Tomato leaf samples showing TYLCD-like symptoms were collected from Tongyeong (To), Geoje (Gi), and Gimhae (Gh) cities of the southern part of Korea. Tomato yellow leaf curl virus (TYLCV) was detected and the full-length genomes of the isolates were sequenced. The TYLCV isolates found in Korea shared high sequence identity (> 99%) with TYLCV-IL [JR:Omu:Ng] (AB110217). Phylogenetic relationship analysis revealed that they formed two groups (with little genetic variability), and the To, Gj, and Gh isolates belonged to the TYLCV-IL group. An infectious clone of TYLCV-To (JQ013089) was constructed and agroinoculated into Nicotiana benthamiana, Nicotiana tabacum var. Xanthi, Petunia hybrida, Capsicum annuum, and Lycopersicon esculentum cv. Hausumomotaro. Agroinfection with a dimeric infectious clone of TYLCV-To induced severe leaf curling and stunting symptoms in these plants, excluding C. annuum. Tomato plants then developed typical yellow leaf curl symptoms.

Deficit Irrigation Affects Growth, Yield, Vitamin C Content, and Irrigation Water Use Efficiency of Hot Pepper Grown in Soilless Culture

Hot pepper (Capsicum annuum cv. Battle) was grown in a 1:1 v/v sand-to-cotton stalk compost and subjected to four irrigation treatments: 100% of water-holding capacity (control) and 85%, 70%, and 55% of water-holding capacity, which were considered deficit irrigation treatments. All treatments were given to the plants at the first day of transplanting and continued during the whole growing season. Our results demonstrated that deficit irrigation had a negative effect on plant growth and yield. Increasing irrigation deficiency exhibited a reduction in vegetative growth, fruit parameters, and yield and a nonsignificant increase in irrigation water use efficiency and a corresponding reduction in the amount of irrigation water. Vitamin C content in fruit was significantly decreased by deficit irrigation treatments at various ripening stages. Water-holding capacity of 100% and 85%, respectively, resulted in the highest content of vitamin C obtained at the ripening stage. We concluded that ‘Battle’ hot pepper is sensitive to deficit irrigation. Supplying this cultivar with water at 85% of water-holding capacity could be a practical irrigation technique for high value of vitamin C production as well as saving a large amount of water, which outweighs the decrease in total fresh yield of fruit, especially in areas suffering from water shortage.

Solanum americanum: reservoir for Potato virus Y and Cucumber mosaic virus in sweet pepper crops

Weeds can act as important reservoirs for viruses. Solanum americanum (Black nightshade) is a common weed in Brazil and samples showing mosaic were collected from sweet pepper crops to verify the presence of viruses. One sample showed mixed infection between Cucumber mosaic virus (CMV) and Potato virus Y (PVY) and one sample showed simple infection by PVY. Both virus species were transmitted by plant extract and caused mosaic in tomato (Solanum lycopersicum cv. Santa Clara), sweet pepper (Capsicum annuum cv. Magda), Nicotiana benthamiana and N. tabaccum TNN, and local lesions on Chenopodium quinoa, C. murale and C. amaranticolor. The coat protein sequences for CMV and PVY found in S. americanum are phylogenetically more related to isolates from tomato. We conclude that S. americanum can act as a reservoir for different viruses during and between sweet pepper crop seasons.

Genome sequence of the hot pepper provides insights into the evolution of pungency in Capsicum species

Hot pepper (Capsicum annuum), one of the oldest domesticated crops in the Americas, is the most widely grown spice crop in the world. We report whole-genome sequencing and assembly of the hot pepper (Mexican landrace of Capsicum annuum cv. CM334) at 186.6× coverage. We also report resequencing of two cultivated peppers and de novo sequencing of the wild species Capsicum chinense. The genome size of the hot pepper was approximately fourfold larger than that of its close relative tomato, and the genome showed an accumulation of Gypsy and Caulimoviridae family elements. Integrative genomic and transcriptomic analyses suggested that change in gene expression and neofunctionalization of capsaicin synthase have shaped capsaicinoid biosynthesis. We found differential molecular patterns of ripening regulators and ethylene synthesis in hot pepper and tomato. The reference genome will serve as a platform for improving the nutritional and medicinal values of Capsicum species.

First Report of Soft Rot Caused by Pectobacterium carotovorum subsp. carotovorum on Pepper Fruits (Capsicum annuum) in Malaysia.

Symptoms of water-soaked lesions and soft rot were first observed in June 2011 on bell pepper fruits (Capsicum annuum cv. Annuum) in the two main regions of pepper production in Malaysia (Cameron Highlands and Johor State). Economic losses exceeded 40% in severely infected fields and greenhouses with the estimated disease incidence of 70%. In pepper fruits damaged by insects, sunscald, or other factors, symptoms initially appeared in the peduncle and calyx tissues and entire fruits were turned into watery masses within 2 to 6 days. Fruits infected in the field tended to collapse and hang on the plant. When the contents leaked out, the outer skin of the fruit dried and remained attached to the plant. Field-grown transplants and infected soil were identified as probable sources of inocula. A total of 50 attached fruits were collected from 10 pepper fields and greenhouses located in the two growing regions. Tissue from the margins of water-soaked lesions was surface-sterilized in 1% NaOCl for 2 min, rinsed in sterile water, dried, and plated onto nutrient agar (NA) and eosin methylene blue agar (EMB) media (3). A similar bacterium was isolated from all samples. After 2 days, white to creamy bacterial colonies on NA and emerald green colonies on EMB developed. Five independent strains were subjected to further biochemical, molecular, and pathogenicity tests. Bacterial strains were gram-negative, motile rods, grew at 37°C, were facultatively anaerobic, oxidase-negative, phosphatase-negative, and catalase-positive. They degraded pectate, were sensitive to erythromycin, did not utilize Keto-methyl glucoside, were indole production-negative, and reduced sugars from sucrose (3). Acid production was negative from sorbitol and arabitol, but positive from melibiose and citrate. PCR amplification of the pel gene by Y1 and Y2 primers produced a 434-bp fragment (2). Amplification of the intergenic transcribed spacer (ITS) region by G1 and L1 primers (4) gave two amplicons ca. 550 and 580 bp long. The expected amplicon was not produced with any of the strains using primers Br1f/L1r and Eca1f/Eca2r (1), whereas a 550-bp PCR product, typical of Pectobacterium carotovorum subsp. carotovorum, was obtained with primers EXPCCF and EXPCCR (1). Based on biochemical and molecular characteristics, and analysis of PCR-RFLP of 16S-ITS-23R rRNA genes using Rsa I enzyme (4), all five bacterial strains were identified as P. carotovorum subsp. carotovorum. BLAST analysis of the 16S rRNA sequence (GenBank Accession No KC189032) showed 100% identity to the 16S rRNA of P. carotovorum subsp. carotovorum strain PPC192. For pathogenicity tests, four mature pepper fruits of cv. Annuum were inoculated by injecting 10 μl of a bacterial suspension (108 CFU/ml) into pericarps and the fruits were incubated in a moist chamber at 80 to 90% relative humidity and 30°C. After 72 h, water-soaked lesions similar to those observed in the fields and greenhouses were observed and bacteria with the same characteristics were consistently reisolated, thereby fulfilling Koch's postulates. Symptoms were not observed on water-inoculated controls.

First Report of Impatiens necrotic spot virus in Mexico in Tomatillo and Pepper Plants.

Mexico contributes 20% of the total worldwide pepper exports (1). Impatiens necrotic spot virus (INSV) (genus Tospovirus; family Bunyaviridae) has emerged and has possibly caused diseases in various crops and ornamentals in Mexico. INSV was treated as a quarantine virus in Mexico (2) but not anymore. During the growing seasons of 2009 to 2011, surveys were conducted in the counties of Guanajuato and Querétaro in the states of the same names. Sampling included tomatillo (Physalis ixocarpa) and pepper (Capsicum spp.) plantations where plants with possible viral symptoms were observed. The symptoms observed were dark necrotic spots on some leaves and on the stems. These were similar to those observed elsewhere (3). Leaf spots further developed into localized necrotic areas. Using ELISA (Agdia, Elkhart, IN) with polyclonal antibodies, all collected samples showing symptoms tested positive for INSV and negative for Alfalfa mosaic virus (AMV), Cucumber mosaic virus (CMV), Potato X virus (PVX), Potato Y virus (PVY), Tobacco mosaic virus (TMV), Tomato spotted wilt virus (TSWV), Tobacco ringspot virus (TRSV), and Tomato ringspot virus (ToRSV). In order to identify the causal agent of these symptoms, INSV-specific sequences available for the S genomic fragments were obtained from NCBI GenBank. They were aligned and used to design primers to amplify a 250-bp fragment from total extracted RNA from healthy and symptomatic plants using reverse transcription (RT)-PCR. Primers used were INSVF (5'CCCAACTGCCTCTTTAGTGC3') and INSVR (5'GGACAATGGATCTGCTCTGA3'). Three extracted plasmids, each containing an amplified and cloned fragment for the pepper and tomatillo isolates, were sequenced (GenBank Accession Nos. KC503051 and KC503052, respectively). Both nucleotide sequences showed 95% identity with the Chinese, Italian, and Japanese INSV sequences (FN400773, DQ425096, and AB207803, respectively) and 94% identity to other INSV isolates (4). The putative Mexican INSV pepper isolate, derived from a necrotic spot, was mechanically inoculated to other experimental host plants after grinding 1 g of symptomatic leaf tissue in 3 ml of a buffer with quaternary ammonium salts at 0.5%, pH 7.8. Ten plants, at the second true-leaf stage, of each Capsicum annuum cv. cannon and Citrullus lanatus were inoculated after carborundum abrasion of the second true leaf. At 15 days post inoculation, systemic chlorotic necrotic spots, stunting, and apical malformation were observed in capsicum plants while wilting was shown in watermelon plants. RT-PCR analyses and nucleotide sequence of the amplified product confirmed the presence and identity of both virus isolates. To our knowledge, this is the first report of INSV in Mexico found naturally in tomatillo and pepper and experimentally in watermelon plants. Derived from this report, INSV distribution in Mexico should be studied due to its potential impact on these two economically important crops.

Evaluation of Entomopathogenic Fungi Against Chilli Thrips,Scirtothrips dorsalis

Commercial strains of entomopathogenic fungi were evaluated for control of chilli thrips, Scirtothrips dorsalis Hood (Thysanoptera: Thripidae), an invasive pest of ornamental and vegetable plants in the Caribbean and southeastern United States. In laboratory assays, LC50 values against adult S. dorsalis were 5.1 × 104 CFU/mL for Beauveria bassiana GHA, with higher values 3.1 × 105 for Metarhizium brunneum F52 and 3.8 × 105 for Isaria fumosorosea Apopka 97. Second instars were comparatively less susceptible to all isolates, ostensibly due to moulting, with LC50 values of 1.1 × 108, 7.0 × 105, and 9.9 × 105 CFU/spores per mL for GHA, F52, and Apopka 97 strains, respectively. In greenhouse cages, compared with controls, three applications of mycoinsecticides and other biorational insecticides at 7 to 14 day intervals reduced overall S. dorsalis populations on pepper plants Capsicum annuum cv. California Wonder: spinosad reduced populations by 94–99%, M. brunneum F52 by 84–93%, B. bassiana GHA by 81–94%, I. fumosorosea PFR-97 by 62–66%, and different horticultural oils by 58–85%. The proportion of marketable fruit was significantly increased by M. brunneum F52, B. bassiana GHA, and 2% SuffOil-X treatments. Slightly lower levels of control were observed in nursery tests with ornamental rose shrubs, Rosa sp. Red Double Knock Out®, during hot sunny conditions. Four applications reduced thrips populations over 10 weeks: spinosad by an average of 91%, M. brunneum F52 by an average of 81%, B. bassiana GHA by an average of 62%, SuffOil-X by an average of 50%, and I. fumosorosea PFR-97 by an average of 44%. The data show that mycoinsecticides can be used in management strategies for low to moderate populations of S. dorsalis and provide resistance management tools for the limited number of insecticides that are effective against this pest.

Research Article: Effects of salt stress on capsaicin content, growth, and fluorescence in a Jalapeño cultivar ofCapsicum annuum(Solanaceae)

Abstract. Although there are many different species of pepper plants (Capsicum spp.), all are from the New World tropics, and landraces such as Jalapeno (Capsicum annuum cv. Jalapeno) have been selected for optimum performance in response to local abiotic and biotic stresses. Pepper plants produce the phenolic compound capsaicin, primarily in the placenta of fruits, possibly to deter mammalian herbivores in favor of avian frugivores. Capsaicin content is influenced by genetic and environmental conditions including soil moisture and fertility, temperature, and light. In order to explore the relationship between abiotic stress and fruit capsaicin content, Jalapeno pepper plants were grown from seed, and then treated with 0.0, 0.5, 1.0, and 1.5% NaCl solution. Capsaicin extracts from Jalapeno fruits were analyzed using High Performance Liquid Chromatography (HPLC). None of the parameters tested were significantly different between the control or treatment groups, but the following trends were found in the da...

Antioxidant and Oxidant Levels of Pepper (Capsicum annuum cv. ‘Charlee’) Infected with Pepper Mild Mottle Virus

Total antioxidant status (TAS), total oxidant status (TOS), as well as total phenol (TP), free phenol (FP), conjugated phenol (CP), and the vitamin C content of pepper plants (Capsicum annuum cv. ‘Charlee’) infected with Pepper mild mottle virus (PMMoV) were determined via a novel automated antioxidant system using test kits. PMMoV was first identified in Turkey in 1994 in commercial pepper (Capsicum annuum cv. ‘Charlee’) fields and caused an outbreak in southern Turkey by 2006, especially in greenhouses. Infected plants were confirmed by ELISA using commercial kits for the virus. The infected plants had stunted growth; and leaves and fruits became mottled, puckered, malformed, deformed, and marked by off-colored sunken areas. Fruits expressing virus symptoms were utilized for biochemical analyses. The percent ratio of TOS to TAS was calculated as the oxidative stress index (OSI). The TAS level and the vitamin C content were found to be significantly lower in infected peppers as compared to healthy peppers. However, TOS, OSI, TP, FP, and CP levels were significantly higher in infected pepper fruits than in healthy ones. In this study, it has been demonstrated that low levels of TAS and high levels of TOS, as well as high OSI status, reflects the quality of peppers. Using this method, the quality of fruits and the condition of plants can be determined in advance of stress development.

Characterization of Rehmannia mosaic virus isolated from chili pepper (Capsicum annuum) in Japan

In 2010, severe necrotic mosaic disease and fruit distortion were observed on greenhouse-grown chili pepper (Capsicum annuum cv. Fushimi-amanaga) plants in Kyoto Prefecture, Japan. Electron microscopic imaging and genomic RNA sequencing indicated that the virus responsible was a new isolate of Rehmannia mosaic virus (ReMV), which had not been previously reported in Japan. Although ReMV systemically infected many Solanaceae species, including chili pepper and tomato (Solanum lycopersicum), tobamovirus-resistance genes from species of Capsicum (L 1a , L 2 , L 3 , and L 4 ) and tomato (Tm-1, Tm-2, and Tm-2 a ) conferred resistance against ReMV.

First Report of Tomato chlorosis virus Infecting Sweet Pepper in Costa Rica.

In September 2008, a survey of whiteflies and whitefly-borne viruses was performed in 11 pepper-growing greenhouses in the province of Cartago, Costa Rica. During this survey, the vast majority of sweet pepper (Capsicum annuum cv. Nataly) plants showed interveinal chlorosis, enations, necrosis, and mild upward leaf curling. Large populations of whiteflies were present and they were found to be composed only of Trialeurodes vaporariorum. Total RNA from frozen plant samples was extracted with TRI Reagent (Molecular Research Inc., Cincinnati, OH). RevertAid H Minus Reverse Transcriptase Kit (Fermentas, Hanover, MD) was used for reverse transcription of the total RNA extract, with cDNA synthesis directed using random primers. A real-time PCR assay was performed to detect Tomato chlorosis virus (ToCV) (genus Crinivirus, family Closteroviridae) using the SYBR Green PCR Master Mix (Applied Biosystems, Carlsbad, CA). Three sets of primers were used to confirm the presence of ToCV in the samples: TocQ875F/TocQ998R primer set directed to a fragment of 123 bp of the HSP gene (3); ToCVp22RQF (5'-TGGATCTCACTGGTTGCTTG-3')-ToCVp22RQR (5'-TAGTGTTTCAGCGCCAACAG-3') primer pair that amplifies a 198-bp segment of the ToCV p22 gene (R. Hammond, E. Hernandez, J. Guevara, J. A. Vargas, A. Solorzano, R. Castro, N. Barboza, F. Mora, and P. Ramirez, unpublished) and the ToCVCPmRQF (5'-CATTGGTTGGGGATTACGTC-3')-ToCVCPmRQR (5'-TCTCAGCCTTGACTTGAGCA-3') primer pair designed to amplify a 170-bp portion of the ToCV CPm gene (R. Hammond, E. Hernandez, J. Guevara, J. A. Vargas, A. Solorzano, R. Castro, N. Barboza, F. Mora and P. Ramirez, unpublished). Fifteen symptomatic samples per greenhouse were tested for a total of 165 sweet pepper plants. From this total, seven samples from four different greenhouses produced amplification of PCR products with all three sets of primers. One of the seven samples showed mild chlorosis, but others were highly chlorotic with different levels of upward leaf curling. None of the other samples showed amplification with any of the primer sets; the symptoms on these plants could have been due to nutritional deficiencies or infection by viruses. Sequence analysis of the 460-bp HSP PCR products, produced using previously reported primers (3), and 150-bp fragment of the P22 revealed 100% sequence identity with a tomato isolate of ToCV from the United States (GenBank Accession No. AY903448). Because of the low number of samples infected with ToCV and the high incidence of symptoms, DNA extraction and a begomovirus PCR detection assay was performed using primer pair AV494/AC1048 (4). Negative results were obtained for all samples. To our knowledge, this is the first report of ToCV infecting sweet pepper plants in Costa Rica and the third one worldwide. ToCV has also been found to be infecting tomato in open field and greenhouses (1) and other weeds in greenhouses including Ruta chalepensis (Rutaceae), Phytolacca icosandra (Phytolaccaceae), Plantago major (Plantaginaceae), and Brassica sp. (Brassicaceae) (2) in the same region of Costa Rica, suggesting that it has adapted to the conditions of the area and poses an important threat to the vegetable production.

Sweet pepper production in substrate in response to salinity, nutrient solution management and training system

The objective of the present study was to evaluate the marketable fruit yield of sweet pepper plants (Capsicum annuum cv. Orlando) in function of the management of nutrient solution with training system. Plants were grown on coconut coir dust under greenhouse conditions in the southeast of Spain. A randomized block design in split-split plot with four blocks was used to test the effect of the nutrient solution strength (full or half-strength Hoagland nutrient solution), training system (two and three stems per plant) and water salinity (saline and non-saline) on total and marketable yield, fruit quality, and fruit mineral concentration. Salt treatment decreased fruit yield by decreasing the fruit fresh weight but not the number of fruits per plant. Under saline and non-saline conditions, the higher yield of fruits was obtained in plants watered with half-strength Hoagland solution, and grown with three stems per plant. Blossom end rot incidence increased under saline conditions or using full-strength Hoagland solution, but decreased with the combination of half-strength Hoagland solution and three-stem training system. Salt treatment also decreased fruit quality in all the treatments due to a decrease in PO2-, SO4(2-), Fe2+;3+, Cu1+;2+ and Mn2+ concentrations, and fruit shape index. Likewise, plants exposed to salinity and watered with half-strength Hoagland solution and trained with three stems showed a reduction in juice glucose and fructose concentration. Based on these results, an increase of the marketable fruit yield could be obtained under non or moderate saline conditions with the implementation of suitable culture practices.

Development of infectious transcripts from full-length and GFP-tagged cDNA clones of Pepper mottle virus and stable systemic expression of GFP in tobacco and pepper

A full-length cDNA clone (pSP6PepMoV-Vb1) of the genomic RNA of a Korean isolate of Pepper mottle virus (PepMoV-Vb1) was constructed downstream of a bacteriophage SP6 RNA polymerase promoter in the plasmid. In vitro RNA transcripts generated from pSP6PepMoV-Vb1 corresponded to PepMoV-Vb1 RNA (9641 nt) with an extra guanosine residue at the 5′ terminus and a 15-nt, poly (A) tract at the 3′ end. The RNAs synthesized from the pSP6PepMoV-Vb1 clone, by in vitro run-off transcription in the presence of the 5′ cap analog m 7GpppG, were highly infectious in Nicotiana benthamiana and Capsicum annuum cv. Early Calwonder. Visible symptoms appeared at 4–5 days post-inoculation, at essentially the same time as occurred on these host plant species inoculated with wild-type PepMoV-Vb. Symptoms induced by progeny virus of the transcripts were indistinguishable from wild-type PepMoV-Vb on their experimental and natural hosts. The gene encoding the green fluorescent protein (GFP), turboGFP, was inserted between the coding regions for NIb and CP in the pSP6PepMoV-Vb1 clone. RNA transcripts of the resulting GFP-tagged clone, designated SP6PepMoV-Vb1/GFP, were highly infectious and symptoms were not different from those induced by either transcripts of pSP6PepMoV-Vb1 or wild-type PepMoV-Vb. However, GFP expression could be detected earlier than virus-induced symptom in plants infected by SP6PepMoV-Vb1/GFP. This study is the first report of the construction of a biologically active, full-length cDNA copy of the Pepper mottle virus RNA genome and the stable expression of a foreign gene within the modified virus.

Chemical Pretreatments Affecting Drying Characteristics of Chilli (cv. Huarou Yon)

One- (70°C) and two-temperature regimes (70 and 50°C) were used to dry chilli (Capsicum annuum cv. Huarou Yon) using a laboratory tray dryer compared to conventional sun drying. A pretreatment was done by soaking chilli in antibrowning solutions before drying. It was found that the drying rate of chilli soaked in chemical solutions was increased and the drying period of chilli was decreased. Page's model was found to fit well with the experiment for one- and two-temperature drying using least squares analysis. The highest value of the coefficient of determination (R2 > 0.99), the lowest value of standard error of estimation (SEE < 0.00031), and the lowest value of the mean relative deviation (P < 10%) were obtained. The effective moisture diffusivities of chilli drying at 70°C and two-stage drying were between 6.01–7.22 × 10−10 m2/s and 3.16–3.89 × 10−10 m2/s, respectively. In contrast, the lowest value of effective moisture diffusivity of chilli was obtained by the conventional sun-drying method (0.597 × 10−10 m2/s). The highest value of moisture diffusivity was observed for chilli soaked in sodium metabisulfite (NaMS) mixed with CaCl2 solution for both one- and two-temperature regimes. The color of chilli was improved by using chemical pretreatments, in particular, chilli soaked in NaMS mixed with CaCl2 solution.

First Report of Tomato spotted wilt virus in Sweet Pepper in Taiwan.

A new disorder on pepper showing symptoms of chlorosis and chlorotic spots on leaves was observed in sweet pepper (Capsicum annuum cv. Andalus) fields in Ren-Ai Township, Nantou County in July, 2009. The disorder occurred in more than 30% of the pepper plants, with a height of approximately 40 cm (1.5 feet), which was approximately one-half the size of the asymptomatic ones. Symptomatic plants bore much smaller fruits with abnormal shapes. Three symptomatic sweet pepper plants were collected and tested for potential viruses. Reverse transcription (RT)-PCR was performed for the detection using three degenerate primer pairs, gL3637/gL4435c for tospoviruses (2), Hrp5/Pot1 for potyviruses (1,3), and Tob-Uni1/Tob-Uni2 for tobamoviruses (4), and specific primers, FJJ2001-7/FJJ2001-8 (5'-TATGTCCATGGACAAATCCGAATCA and 5'-TCTCTGGATCCACGAGTTCAAACTGGGAG) for the coat protein gene of Cucumber mosaic virus (CMV). An 819-nt DNA fragment containing the partial L RNA of tospovirus was amplified from the total RNA isolated from each of these three samples by RT-PCR with primer pair gL3637/gL4435c. One amplified fragment was cloned and sequenced. A homology search in GenBank indicated that the new pepper-infecting virus in Taiwan was Tomato spotted wilt virus (TSWV) since the partial L RNA shared more than 94.5% nucleotide and 98.2% amino acid identity with five TSWV isolates (Accession Nos. AB190813, AB198742, AY070218, D10066, and NC_002052). No DNA fragment was obtained by RT-PCR using primer pairs for CMV, potyviruses, or tobamoviruses. A virus culture (TwPep1) isolated from one of the symptomatic sweet pepper plants was then established in Nicotiana tabacum cv. White Burley and N. benthamiana through triple single-lesion isolation. TWPep1 reacted positively only to the antiserum against TSWV by indirect-ELISA but not to those of Watermelon silver mottle virus, Capsicum chlorosis virus, Tobacco mosaic virus, Tomato mosaic virus, and CMV. Partial L RNA and the full-length nucleocapsid (N) gene of TWPep1 were obtained by RT-PCR with primer pairs gL3637/gL4435c and FJJ2002-74/FJJ2002-75 (5'-GCGCGCGGATCCTAATTTAACTTACARCTGCT 5'-TGCTGCCTCGAGCATACGGTCAAAGCATATAA), respectively. The 819-nt L RNA conserved region of TwPep1 (Accession No. GU222652) shared 94.4 to 97.7% nucleotide and 98.2 to 100% amino acid identity with those available in GenBank. The 777-bp N gene of TwPep1 (Accession No. GU222651) shared 96.7 to 99.1% nucleotide and 97.3 to 99.6% amino acid identity with 37 TSWV isolates available in GenBank. Sequence comparisons indicated that TwPep1 is an isolate of TSWV. TSWV was later detected by RT-PCR in all 10 symptomatic samples of sweet pepper plants collected from five fields in August 2009. To our knowledge, this is the first report of TSWV in sweet pepper in Taiwan. This is also the first demonstration of isolation and characterization of TSWV in Taiwan although TSWV was once detected in lisianthus (Eustoma rusellianum) by RT-PCR (1) but the isolation was not successful then. The occurrence of TSWV in pepper will have a direct economic impact on the important vegetable and floral industry in Taiwan because TSWV reportedly comprises a wide host range.

Effect of High Temperature during the Seed Development on Quality and Chemical Composition of Chili Pepper Seeds

An analysis was performed on chili pepper (Capsicum annuum (L.) cv. Huay Si Thon and Shishito) seed vigor and quality produced by plants grown under control and high temperature conditions (29} 2/24}2 and 36 + 2/27} 2Ž, mean day and night temperatures, respectively) after anthesis to elucidate the effect of high temperature during seed development on seed quality. High temperature significantly reduced fruit growth in both varieties . More than 20 % of the seeds produced under the high temperature regime were flat with a dark brown color and did not germinate. High temperature inhibited seed fresh and dry weight increase and the seed size was slightly reduced. Standard germination of Huay Si Thon and Shishito seeds occurring under the high temperature conditions was lower than that of the control seeds by 28 and 25 %, respectively. Similarly, seed vigor was reduced, as evidenced by the reduction in the accelerated aging germination rate and the higher value of the germination index. Protein content was maximal during the early stages of seed development and decreased afterwards continuously during the seed maturation stage, while no conspicuous reduction of the protein content by heat was observed. High temperature reduced the carbohydrate content of seeds by 40 % in Huay Si Ton and 50 % in Shishito, respectively. High temperature reduced the lipid content to less than half. These results suggested that high temperature during seed development reduced chili pepper seed germination and vigor, presumably due to the limitation in the accumulation of storage products, especially carbohydrates, and lipids.

A New Disease, Arboricola Leaf Spot of Bell Pepper, Caused by Xanthomonas arboricola.

In June 2007, a leaf spot disease was observed on seedlings of bell pepper (Capsicum annuum L. var. angulosum) in a commercial greenhouse in Iksan City, Korea. Symptoms on leaves included small, irregularly shaped, brown lesions with yellow halos and marginal necrosis. Four bacterial isolates, BC2526, BC2527, BC2528, and BC2529, were obtained from the diseased plants. The isolates were gram-negative aerobic rods with a single flagellum. On peptone sucrose agar, colonies were yellow and raised with smooth margins. Pathogenicity was confirmed by spraying cell suspensions containing 106 CFU/ml onto seedlings of bell pepper (cv. Fieste), tomato (Solanum lycopersicon cv. Seokwang), and hot pepper (Capsicum annuum cv. Daekwang) in a greenhouse maintained at 26 ± 3°C. The isolates induced symptoms, spots, and margin blights on leaves of bell pepper, tomato, and hot pepper 2 weeks after inoculation. No symptoms were noted on the control plants inoculated with sterilized distilled water. The identity of the bacteria was confirmed with the Biolog Microbial Identification System, version 4.2 (Biolog Inc., Hayward, CA). The gyrB region was partially sequenced to aid in identification of four isolates using PCR primers reported by Parkinson et al. (1). A 701-bp fragment of the gyrB region from the isolates was compared with sequences of the reference strains of Xanthomonas available in the DDBL/EMBL/GenBank databases (4). The bacterial isolates clustered with Xanthomonas arboricola pathovars in a phylogenetic tree generated with the neighbor-joining method in MEGA (version 4.1) (3). The sequence of the gyrB from the isolates had distance indexes of 0.016, 0.014, 0.016, 0.013, 0.037, and 0.019 as determined by the Jukes-Cantor model (2) with sequences of the reference strains of X. arboricola pvs. pruni (EU498953), celebensis (EU498984), corylina (EU499002), juglandis (EU 498951), populi (EU 499035), and a X. arboricola strain from bell pepper (EU 499039) (4), respectively. To our knowledge, this is the first report of a leaf disease on bell pepper caused by X. arboricola. We propose the name arboricola leaf spot for the disease. Further studies are required for determining pathovar status of the strain. Nucleotide sequence data reported are available under Accession Nos. GQ502678, GQ502679, GQ502680, and GQ502681 for gyrB of BC2626, BC2527, BC2528, and BC2923, respectively. The disease is expected to have a significant economic impact on tomato and pepper production in Korea.

Effects of 24-epibrassinolide on growth, chlorophyll, electrolyte leakage and proline by pepper plants under NaCl-stress

Brassinosteroids are steroidal phytohormones that have the ability to overcome plant environmental stress. This study was carried out to investigate the role of 24-epibrassinolide in inducing pepper plant salt tolerance as measured by a range of physiological parameters: growth, chlorophyll, electrolyte leakage and proline. Capsicum annuum cv. Beldi seedlings were sprayed with 24-epibrassinolide both in the presence or the absence of NaCl and were sampled, 28 days after treatments. As a result of analysing the cultures under salinity stress, it was determined that the biomass and the chlorophyll decreased significantly, while the electrolyte leakage and the proline concentration increased considerably under salinity stress. However, the application of 24-epibrassinolide significantly ameliorated the adverse effects of salinity on the examined parameters, confirming the suppositions of previous authors who have claimed that exogenously applied 24-epibrassinolide can increase growth and protect the integrity of the cellular membrane in stressed plants.