Candida Tropicalis Infection Research Articles

Successful combined treatment with surgery and ALA-PDT for cutaneous infection by candida tropicalis: A case report and literature review

Candidiasis is a common fungal infection, with Candida tropicalis infections being relatively rare. These infections develop into skin fungal infections under conditions such as broad-spectrum antibiotic use, diabetes, and immunosuppression. Traditionally, antifungal drugs have been the primary treatment; however, issues like hepatotoxicity and the need for long-term use persist. Consequently, new treatment approaches are essential. Most previous reports have focused on Candida albicans, with fewer addressing Candida tropicalis. This study reports a case where a patient with a skin Candida tropicalis infection was treated with a combination of surgery and ALA photodynamic therapy(635 nm, 120 J/cm2, 177 mW/cm2). After just one session of this combined treatment, the patient achieved significant clinical remission. Therefore, the combination of surgery and ALA-PDT may offer a safe and effective treatment option.

Mitochondria-mediated ferroptosis induced by CARD9 ablation prevents MDSCs-dependent antifungal immunity

BackgroundCaspase Recruitment Domain-containing protein 9 (CARD9) expressed in myeloid cells has been demonstrated to play an antifungal immunity role in protecting against disseminated candidiasis. Hereditary CARD9 ablation leads to fatal disseminated candidiasis. However, the myeloid cell types and molecular mechanisms implicated in CARD9 protecting against disseminated candidiasis remain wholly elusive.MethodsThe role of CARD9 ablation in exacerbating disseminated candidiasis was determined in vivo and in vitro. The molecular mechanism by which CARD9 ablation promotes acute kidney injury in disseminated candidiasis was identified by RNA-sequencing analysis. The expression of mitochondrial proteins and ferroptosis-associated proteins were measured by Quantitative real-time PCR and western blot.ResultsCARD9 ablation resulted in a reduced proportion of myeloid-derived suppressor cells (MDSCs) and a substantially lower expression of solute carrier family 7 member 11 (SLC7A11) in the kidneys, which increased susceptibility to acute kidney injury and renal ferroptosis during disseminated Candida tropicalis (C. tropicalis) infection. Moreover, CARD9-deficient MDSCs were susceptible to ferroptosis upon stimulation with C. tropicalis, which was attributed to augmented mitochondrial oxidative phosphorylation (OXPHOS) caused by reduced SLC7A11 expression. Mechanistically, C-type lectin receptors (CLRs)-mediated recognition of C. tropicalis promoted the expression of SLC7A11 which was transcriptionally manipulated by the Syk-PKCδ-CARD9-FosB signaling axis in MDSCs. FosB enhanced SLC7A11 transcription by binding to the promoter of SLC7A11 in MDSCs stimulated with C. tropicalis. Mitochondrial OXPHOS, which was negatively regulated by SLC7A11, was responsible for inducing ferroptosis of MDSCs upon C. tropicalis stimulation. Finally, pharmacological inhibition of mitochondrial OXPHOS or ferroptosis significantly increased the number of MDSCs in the kidneys to augment host antifungal immunity, thereby attenuating ferroptosis and acute kidney injury exacerbated by CARD9 ablation during disseminated candidiasis.ConclusionsCollectively, our findings show that CARD9 ablation enhances mitochondria-mediated ferroptosis in MDSCs, which negatively regulates antifungal immunity. We also identify mitochondria-mediated ferroptosis in MDSCs as a new molecular mechanism of CARD9 ablation-exacerbated acute kidney injury during disseminated candidiasis, thus targeting mitochondria-mediated ferroptosis is a novel therapeutic strategy for acute kidney injury in disseminated candidiasis.

Invasive candidiasis.

Invasive candidiasis is an important fungal disease caused by Candida albicans and, increasingly, non-albicans Candida pathogens. Invasive Candida infections originate most frequently from endogenous human reservoirs and are triggered by impaired host defences. Signs and symptoms of invasive candidiasis are non-specific; candidaemia is the most diagnosed manifestation, with disseminated candidiasis affecting single or multiple organs. Diagnosis poses many challenges, and conventional culture techniques are frequently supplemented by non-culture-based assays. The attributable mortality from candidaemia and disseminated infections is ~30%. Fluconazole resistance is a concern for Nakaseomyces glabratus, Candida parapsilosis, and Candida auris and less so in Candida tropicalis infection; acquired echinocandin resistance remains uncommon. The epidemiology of invasive candidiasis varies in different geographical areas and within various patient populations. Risk factors include intensive care unit stay, central venous catheter use, broad-spectrum antibiotics use, abdominal surgery and immune suppression. Early antifungal treatment and central venous catheter removal form the cornerstones to decrease mortality. The landscape of novel therapeutics is growing; however, the application of new drugs requires careful selection of eligible patients as the spectrum of activity is limited to a few fungal species. Unanswered questions and knowledge gaps define future research priorities and a personalized approach to diagnosis and treatment of invasive candidiasis is of paramount importance.

Pulmonary candidiasis presenting as tumor-like shadow

Lung fungal infections are rare and carry a high risk of death in critically ill patients. Further investigations including radiological imaging are needed for differential diagnosis. In this article, we present a patient with a tumor-like shadow on chest X-ray and a mildly necrotic soft tissue mass of 4 cm in the first computed tomography (CT) examination of the thorax, who was therefore prediagnosed with Lung Cancer. Due to the poor general condition of the patient, his family did not accept further examinations for cancer. Approximately 40 days later, the patient was taken to the intensive care unit with the complaint of respiratory distress. The bronchial sample was negative for malignant cells and Candida Tropicalis was detected in cultures. The size of the mass decreased in CT controls after treatment with antifungal agents. We thought that the image on CT was due to Candida Tropicalis infection and regressed with antifungal treatment. In conclusion, we can conclude that pulmonary candidiasis may present with atypical radiological findings. Fungal infections should be kept in mind in the differential diagnosis of lung cancer in cases with confusing mass-like images.

Fungal Spectrum and Susceptibility Against Nine Antifungal Agents in 525 Deep Fungal Infected Cases.

Deep fungal infection has become an important cause of infection and death in hospitalized patients, and this has worsened with increasing antifungal drug resistance. A 3-year retrospective study was conducted to investigate the clinical characteristics, pathogen spectrum, and drug resistance of deep fungal infection in a regional hospital of Guangzhou, China. Non-duplicate fungi isolates recovered from blood and other sterile body fluids of in-patients of the clinical department were identified using biochemical tests of pure culture with the API20C AUX and CHROMagar medium. Antifungal susceptibilities were determined by Sensititre YeastOne® panel trays. In this study, 525 patients (283 female, 242 male) with deep fungal infection were included, half of them were elderly patients (≥60 years) (54.67%, n=286). A total of 605 non-repetitive fungi were finally isolated from sterile samples, of which urine specimens accounted for 66.12% (n=400). Surgery, ICU, and internal medicine were the top three departments that fungi were frequently detected. The mainly isolated fungal species were Candida albicans (43.97%, n=266), Candida glabrata (20.00%, n=121), and Candida tropicalis (17.02%, n=103), which contributed to over 80% of fungal infection. The susceptibility of the Candida spp. to echinocandins, 5-fluorocytosine, and amphotericin B remained above 95%, while C. glabrata and C. tropicalis to itraconazole were about 95%, and the dose-dependent susceptibility of C. glabrata to fluconazole was more than 90%. The echinocandins had no antifungal activity against Trichosporon asahi in vitro (MIC90>8 μg/mL), but azole drugs were good, especially voriconazole and itraconazole (MIC90 = 0.25 μg/mL). The main causative agents of fungal infection were still the genus of Candida. Echinocandins were the first choice for clinical therapy of Candida infection, followed with 5-fluorocytosine and amphotericin B. Azole antifungal agents should be used with caution in Candida glabrata and Candida tropicalis infections.

Voriconazole Associated Hypertension: A Case Report

Objective: The study report a case of a young female with candida tropicalis and candida krusei infection who developed severe hypertension after she had repeated received voriconazole for few days.
 Case Presentation: A 23-year-old female was admitted to hospital because of recurrent urinary tract infection. She underwent horseshoe nephrectomy, extracorporeal lithotripsy treatment and double J-tube placement in the past 5 years. After multiple surgeries, she developed recurring fungal urinary tract infections and underwent anti-infective treatment. Twenty days ago, the patient developed chills, fever, dizziness, fatigue, urinary tract irritation signs and bilateral low back pain. Urine culture suggests Candida croco (resistant to fluconazole). After taking antifungal therapy with voriconazole 300 mg q12h, the patient experienced an unexplained increased blood pressure and transient loss of consciousness.
 The patient began to experience an increase in blood pressure (140-160/90-100 mmHg) on the second day of voriconazole treatment. After 5 days of taking voriconazole, the patient developed fatigue, dizziness and blurred vision with persistent hypertension (150/100 mmHg), and temporary loss of consciousness and syncope on day8, when blood pressure was measured at 175/95 mmHg.
 Conclusion: This case illustrates that acute blood pressure elevation may manifest in patients taking normal doses of voriconazole, which deserves the attention of clinicians.

Successful Use of Interferon-Gamma for Refractory Disseminated Candida Tropicalis Infection in a Pediatric Patient with Acute Myeloid Leukemia and Heterozygous CARD9 Mutation

Invasive fungal infections remain among the most frequent severe and fatal complications of oncology, despite effective antifungal agents. Genetic aberrations may additionally increase the individual patient’s susceptibility to invasive mycosis, with the need for an intensified treatment, such as adjunctive immunotherapy combined with standard antifungal medication. Interferon-gamma (IFN-γ) as an immunostimulatory agent may represent a promising surrogate to reactivate the cytotoxic activity of macrophages in patients with ‘blind spots’. We report the case of a pediatric patient with AML and disseminated candida tropicalis infection, bearing a heterozygous CARD9 mutation, who was treated successfully with combined IFN-γ and conventional antifungal therapy.

Candida tropicalis Infection Modulates the Gut Microbiome and Confers Enhanced Susceptibility to Colitis in Mice.

Background & AimsWe previously showed that abundance of Candida tropicalis is significantly greater in Crohn’s disease patients compared with first-degree relatives without Crohn’s disease. The aim of this study was to determine the effects and mechanisms of action of C tropicalis infection on intestinal inflammation and injury in mice.MethodsC57BL/6 mice were inoculated with C tropicalis, and colitis was induced by administration of dextran sodium sulfate in drinking water. Disease severity and intestinal permeability subsequently were evaluated by endoscopy, histology, quantitative reverse-transcription polymerase chain reaction, as well as 16S ribosomal RNA and NanoString analyses (NanoString Technologies, Seattle, WA).ResultsInfected mice showed more severe colitis, with alterations in gut mucosal helper T cells (Th)1 and Th17 cytokine expression, and an increased frequency of mesenteric lymph node–derived group 2 innate lymphoid cells compared with uninfected controls. Gut microbiome composition, including changes in the mucin-degrading bacteria, Akkermansia muciniphila and Ruminococcus gnavus, was altered significantly, as was expression of several genes affecting intestinal epithelial homeostasis in isolated colonoids, after C tropicalis infection compared with uninfected controls. In line with these findings, fecal microbiome transplantation of germ-free recipient mice using infected vs uninfected donors showed altered expression of several tight-junction proteins and increased susceptibility to dextran sodium sulfate–induced colitis.ConclusionsC tropicalis induces dysbiosis that involves changes in the presence of mucin-degrading bacteria, leading to altered tight junction protein expression with increased intestinal permeability and followed by induction of robust Th1/Th17 responses, which ultimately lead to an accelerated proinflammatory phenotype in experimental colitic mice.

Candida Tropicalis Spondylodiscits in an Immunocompetent Host: A Case Report and Literature Review

Abstract Background Fungal spondylodiscitis is not common but should be suspected in some cases. Candida tropicalis infections are being more frequently diagnosed due to some factors related to the microorganism. Case Description A C. tropicalis spondylodiscitis is described in a 72-year-old man who was treated with a combination of echinocandin (micafungin) and surgery. Conclusion The presence of some risk factors should promptly raise the suspicion of fungal spondylodiscitis. Treatment should be instituted as early as possible for the best outcome for the patient.

Presence of Candida tropicalis on Staphylococcus epidermidis Biofilms Facilitated Biofilm Production and Candida Dissemination: An Impact of Fungi on Bacterial Biofilms.

While Staphylococcus epidermidis (SE) is a common cause of infections in implanted prostheses and other indwelling devices, partly due to the biofilm formation, Candida tropicalis (CT) is an emerging Candida spp. with a potent biofilm-producing property. Due to the possible coexistence between SE and CT infection in the same patient, characteristics of the polymicrobial biofilms from both organisms might be different from those of the biofilms of each organism. Then, the exploration on biofilms, from SE with or without CT, and an evaluation on l-cysteine (an antibiofilm against both bacteria and fungi) were performed. As such, Candida incubation in preformed SE biofilms (SE > CT) produced higher biofilms than the single- (SE or CT) or mixed-organism (SE + CT) biofilms as determined by crystal violet staining and fluorescent confocal images with z-stack thickness analysis. In parallel, SE > CT biofilms demonstrated higher expression of icaB and icaC than other groups at 20 and 24 h of incubation, suggesting an enhanced matrix polymerization and transportation, respectively. Although organism burdens (culture method) from single-microbial biofilms (SE or CT) were higher than multi-organism biofilms (SE + CT and SE > CT), macrophage cytokine responses (TNF-α and IL-6) against SE > CT biofilms were higher than those in other groups in parallel to the profound biofilms in SE > CT. Additionally, sepsis severity in mice with subcutaneously implanted SE > CT catheters was more severe than in other groups as indicated by mortality rate, fungemia, serum cytokines (TNF-α and IL-6), and kidney and liver injury. Although CT grows upon preformed SE-biofilm production, the biofilm structures interfered during CT morphogenesis leading to the frailty of biofilm structure and resulting in the prominent candidemia. However, l-cysteine incubation together with the organisms in catheters reduced biofilms, microbial burdens, macrophage responses, and sepsis severity. In conclusion, SE > CT biofilms prominently induced biofilm matrix, fungemia, macrophage responses, and sepsis severity, whereas the microbial burdens were lower than in the single-organism biofilms. All biofilms were attenuated by l-cysteine.

Candida tropicalis infection dramatically affects the gut microbiome in DSS-induced colitis

Abstract Candidiasis caused by Candida (C.) tropicalis has dramatically increased worldwide. The role of C. tropicalis in the pathogenesis of intestinal inflammation in Crohn’s disease patients has not been fully elucidated. We have previously reported that C57BL/6 mice infected with C. tropicalis show significantly increased severity of intestinal inflammation following induction of colitis by administration of dextran sodium sulfate (DSS) in drinking water. These effects were associated with increased gene expression of Tnfa and Ifng, and decreased expression of Th2-associated genes, such as Il4 and Il13. In the present study, we investigated the effects of C. tropicalis infection on the composition and function of the gut microbiome in this model. Analysis of 16s rRNA in fecal samples of infected mice showed that C. tropicalis significantly altered the gut microbiome composition, affecting, in particular, the abundance of mucin-degrading bacteria, such as Akkermansia Muciniphila and Ruminococcus Gnavus (β diversity analysis: P<.05). Alcian Blue staining showed a significant decrease of mucus-producing goblet cells in infected mice before and after DSS-induced colitis (number of goblet cells per power field: 50.3±9.1 vs. 21.4±5.4; P<.05). Flow cytometry analysis showed that in lymph nodes of infected mice, there was a higher percentage of group 2 innate lymphoid cells (% ILC2: 10.28±2.28 vs. 2.08±0.34, P<.05). Our data demonstrate that C. tropicalis may play a pro-inflammatory role in intestinal injury by altering the gut microbiome community and affecting the abundance of specific mucin-degrading bacteria. Therefore, the resulting dysbiosis may affect the susceptibility of the host to develop inflammatory bowel disease.

Candida Tropicalis Infection of the Knee Joint in an Immunocompromised Pediatric Patient: A Case Report

Candida Tropicalis Infection of the Knee Joint in an Immunocompromised Pediatric Patient: A Case Report

Antifungal and biofilm inhibitory effect of Cymbopogon citratus (lemongrass) essential oil on biofilm forming by Candida tropicalis isolates; an in vitro study.

Cymbopogon citratus (lemongrass) essential oil has been widely used as a traditional medicine and is well known for antimicrobial properties. Therefore, it might be a potent anti-infective and biofilm inhibitive against Candida tropicalis infections. Until now, no ideal coating or cleaning method based on an essential oil has been described to prevent biofilm formation of Candida strains on silicone rubber maxillofacial prostheses, voice prostheses and medical devices susceptible to C. tropicalis infections. To investigate the antifungal and biofilm inhibitory effects of Cymbopogon citratus oil. Clinical isolates of C. tropicalis biofilms on different biomaterials were used to study the inhibitory effect. The efficacy of Cymbopogon citratus, Cuminum cyminum, Citrus limon and Cinnamomum verum essential oils were compared on biofilm formation of three C. tropicalis isolates on 24 well polystyrene plates. C. citratus oil coated silicone rubber surfaces were prepared using hypromellose ointment as a vehicle. The antifungal tests to determine minimum inhibitory and minimum fungicidal concentrations were assessed by a microbroth dilution method and biofilm formation was determined by a crystal violet binding assay. C. tropicalis strains formed more biofilm on hydrophobic materials than on hydrophilic glass. C. citratus oil showed a high antifungal effect against all C. tropicalis strains. For comparison, C. limon oil and C. cyminum oil showed minor to no killing effect against the C. tropicalis strains. C. citratus oil had the lowest minimal inhibitory concentration of all essential oils tested and inhibited biofilm formation of all C. tropicalis strains. C. citratus oil coating on silicone rubber resulted in a 45-76% reduction in biofilm formation of all C. tropicalis strains. Cymbopogon citratus oil has good potential to be used as an antifungal and antibiofilm agent on silicone rubber prostheses and medical devices on which C. tropicalis biofilms pose a serious risk for skin infections and may cause a shorter lifespan of the prosthesis.

PB1749 A CASE OF DIAGNOSIS OF BLOODSTREAM INFECTION OF M. MICROPHYLLA IN PATIENTS WITH HEMATOLOGIC MALIGNANCIES BY USING NGS

Background:Rhizomucor pusillus Schipper is a very rare and serious opportunistic infection with very high mortality. Accurate and rapid pathogenic diagnosis is critical for early antifungal therapy and prognosis. At present, the second‐generation sequencing technology (NGS) can overcome the shortcomings of traditional methods, such as long time‐consuming and low sensitivity, and can directly detect pathogens of infectious diseases, and reports on the diagnosis of clinical infectious diseases are gradually increasing. We used NGS to detect mixed infections of Rhizopus oryzae and Candida tropicalis in the blood of a patient with refractory acute myeloid leukemia (NR), which played a key role in the successful treatment of fungal infection in patients.Aims:Second‐generation sequencing technology can be used as a complementary means of pathogen detection for sterile sites.Methods:The patient took the whole blood sample for NGS test 13 days after the operation, and extracted the fungal DNA primer sequence according to the kit requirements (reagent brand) as ITS1(F): 5’‐TCCGTAGGTGAACCTGCGG‐3 ’and ITS4(R): 5’ ‐ TCCTCCGCTTATTGATATGC‐3’. The sequence was sequenced with an illumina sequencer, and the sequence was compared with the existing sequence in GenBank. The sequence number of Rhizomucor pusillus was 1330 and the number of Candida tropicalis was 2265.Results:We reported that this patient quickly determined the mixed disseminated infection of Rhizomucor pneumoniae and Candida tropicalis using NGS on 13 days after transplantation. Using amphotericin B antifungal treatment, the whole body lesions quickly subsided after 24 hours. However, for elderly patients with refractory leukemia, especially those with basic diseases, cord blood transplantation provides a new choice, and the risk of transplantation is still huge. Even if the implantation is successful, the infection‐related complications and the infection before the immune function directly affect the prognosis.. The primary disease of this patient is malignant hematological disease, low immune function, and diabetes, and other basic diseases, which are in line with the high risk factors of mucor infection. During the treatment, the fungal hyphae were microscopically examined. The blood culture was Candida tropicalis infection. The invasive fungal infection was diagnosed clearly, but the treatment effect was not good. The possibility of combining two fungal infections was neglected, and the second generation sequencing technology was adopted. The application was carried out, and finally the neglected infection of M. oxysporum was found. After switching to liposomal amphotericin B in time, it quickly became effective. The blood flow and skin temperature were controlled within 24 hours.Summary/Conclusion:The high incidence of opportunistic infections in patients after allogeneic hematopoietic stem cell transplantation is essential for early detection of pathogens. Due to the presence of blood‐borne disseminated infection in patients with hematopoietic stem cell transplantation, the mortality rate is high and needs to be identified and treated as early as possible. Second‐generation sequencing technology can be used as a complementary means of pathogen detection for sterile sites.

Polymorphism analysis of virulence-related genes among Candida tropicalis isolates

Background:Adhesion, biofilm formation, yeast-hyphal transition, secretion of enzymes, and hemolytic activity are all considered important factors in Candida tropicalis infection. However, DNA sequence data for this pathogen are limited. In this study, the polymorphism and heterogeneity of genes agglutinin-like sequences (ALS)2, Lipase (LIP)1, LIP4, and secretory aspartyl proteinase tropicalis (SAPT)1-4 as well as the relationship between phenotype and genotype were analyzed.Methods:This study started in August 2013, and ended in July 2017. The complete length of ALS2, LIP1, LIP4, and SAPT1-4 of 68 clinical C. tropicalis isolates was sequenced. Single nucleotide polymorphisms (SNPs) as well as insertions and deletions (indels) were identified within these genes. In addition, phenotypic characteristics of the virulent factors, including adhesion and the secretion of aspartyl proteinases and phospholipases, were determined.Results:There were 73, 24, 17, 16, 13, and 180 SNPs in the genes LIP1, LIP4, SAPT1, SAPT2, SAPT3, and SAPT4, respectively. Furthermore, 209 SNPs were identified in total for the gene ALS2. Interestingly, large fragment deletions and insertions were also found in ALS2. Isolate FXCT 01 obtained from blood had deletions on all 4 sites and showed the lowest adhesion ability on the polymethylpentene surface. In addition, isolates with deletions in the regions 1697 to 1925 and 2073 to 2272 bp displayed relatively low abilities for adhesion and biofilm formation, and this phenotype correlated with the deletions found in ALS2. LIP1, SAPT4, and ALS2 displayed great heterogeneity among the isolates. Large deletions found in gene ALS2 appeared to be associated with the low ability of adhesion and biofilm formation of C. tropicalis.Conclusion:This study might be useful for deeper explorations of gene function and studying the virulent mechanisms of C. tropicalis.

Effects of immune suppression in murine models of disseminated Candida glabrata and Candida tropicalis infection and utility of a synthetic peptide vaccine.

Candida species are the second most frequent cause of fungal infections worldwide. Current knowledge of immunity to Candida has been gleaned almost exclusively from studies on Candida albicans, the most common disease-causing species. Knowledge of immunity to non-albicans Candida (NAC) species is still at an early stage due to the lack of tractable animal models with which to study these important pathogens. This is partly because many NAC species are not usually pathogenic in mouse models of candidiasis. In this study, we established an immunosuppressed mouse model of disseminated candidiasis by the two clinically important NAC species, C. glabrata and C. tropicalis. The inbred mouse strains, A/J and BALB/c, show distinct susceptibilities to disseminated Candida infection. A/J mice, deficient for complement C5, are more susceptible to disseminated infection with both C. glabrata and C. tropicalis compared to BALB/c mice, the latter having functional C5. Here we show that peptide-pulsed dendritic cell (DC) vaccination with a peptide derived from a C. tropicalis cell surface protein, significantly improved survival and reduced the fungal burdens of disseminated candidiasis in these immunocompromised mice. Importantly, this study is the first report of protective efficacy conferred by a peptide vaccine against medically important NAC species in immunosuppressed hosts. Establishing this experimental mouse model provides an important tool to further understand pathogenesis and host resistance in Candida infection. Significantly, our findings also demonstrate how this model can be used to evaluate new control strategies against candidiasis, such as vaccines.

Delinking CARD9 and IL-17: CARD9 Protects against Candida tropicalis Infection through a TNF-α-Dependent, IL-17-Independent Mechanism.

Candida is the third most common cause of bloodstream infections in hospitalized patients. Immunity to C. albicans, the most frequent species to be isolated in candidiasis, involves a well-characterized Dectin-1/caspase-associated recruitment domain adaptor 9 (CARD9)/IL-17 signaling axis. Infections caused by non-albicans Candida species are on the rise, but surprisingly little is known about immunity to these pathogens. In this study, we evaluated a systemic infection model of C. tropicalis, a clinically relevant, but poorly understood, non-albicans Candida. Mice lacking CARD9 were profoundly susceptible to C. tropicalis, displaying elevated fungal burdens in visceral organs and increased mortality compared with wild-type (WT) controls. Unlike C. albicans, IL-17 responses were induced normally in CARD9−/− mice following C. tropicalis infection. Moreover, there was no difference in susceptibility to C. tropicalis infection between WT and IL-23p19−/−, IL-17RA−/−, or Act1−/− mice. However, TNF-α expression was markedly impaired in CARD9−/− mice. Consistently, WT mice depleted of TNF-α were more susceptible to C. tropicalis, and CARD9-deficient neutrophils and monocytes failed to produce TNF-α following stimulation with C. tropicalis Ags. Both neutrophils and monocytes were necessary for defense against C. tropicalis, because their depletion in WT mice enhanced susceptibility to C. tropicalis. Disease in CARD9−/− mice was not due to defective neutrophil or monocyte recruitment to infected kidneys. However, TNF-α treatment of neutrophils in vitro enhanced their ability to kill C. tropicalis. Thus, protection against systemic C. tropicalis infection requires CARD9 and TNF-α, but not IL-17, signaling. Moreover, CARD9-dependent production of TNF-α enhances the candidacidal capacity of neutrophils, limiting fungal disease during disseminated C. tropicalis infection.

Identification of Azole Resistance Markers in Clinical Isolates of Candida tropicalis Using cDNA‐AFLP Method

Global reports have highlighted the increasing prevalence of Candida tropicalis infections as well as organism(') s drug resistance. This study aimed at identifying azole resistance markers in clinical isolates of C. tropicalis, which will be a great resource for developing new drugs. Two susceptible and resistant isolates of C. tropicalis were recovered from an epidemiological investigation of candidiasis in immunocompromised patients. C. tropicalis ATCC 750 was used as reference strain. Antifungal susceptibility to fluconazole and itraconazole was determined using Clinical and Laboratory Standards Institute (CLSI) method. Complementary DNA-amplified fragment length polymorphism (cDNA-AFLP) technology and real-time reverse-transcriptase (RT) PCR were used for identification of potential genes involved in azole resistance of C. tropicalis clinical isolates. Five genes encoding the following enzymes were identified as superoxide dismutase (SOD) implicated in antioxidant defense, ornithine aminotransferase (OAT), acetyl ornithine aminotransferase (ACOAT), adenosylmethionine-8-amino-7-oxononanoate aminotransferase (DAPA AT), and 4-aminobutyrate aminotransferase (ABAT)-belonging to pyridoxal phosphate (PLP) dependent enzymes and acting in an important physiological role in many fungal-cell cycles. Real-time RT-PCR confirmed mRNA level of the aforementioned genes. Our findings showed that factors such as PLP-dependent enzymes and SOD might be implicated in drug resistance in C. tropicalis clinical isolate. Therefore, further studies are required to explore the accurate biological functions of the mentioned genes that would be helpful for effective drug development.

Candida tropicalis biofilms: Effect on urinary epithelial cells

Candida tropicalis infection is strongly associated with the presence of biofilms in urinary catheters. Thus, the aim of this work was to study the behaviour of C. tropicalis in biofilms of different ages (24–120 h) formed in artificial urine (AU) and their effect in human urinary bladder cells (TCC-SUP). Reference strain ATCC 750 and two isolates from patients with candiduria (U69 and U75) were used in this study. The adhesion to human cells was evaluated after 2 h of contact with Candida biofilms, using the Crystal violet staining method, and the human cells response was evaluated in terms of activity inhibition and cell damage. Candida tropicalis aspartyl proteinase (SAPT) gene expression was determined by real-time PCR. Candida tropicalis biofilm cells were able to adhere to TCC-SUP cells. The highest extent of yeast attachment was obtained for the 72 h old biofilm cells. Yeasts affected TCC-SUP cells, with 120 h-biofilm cells causing the highest levels of cell injury. Generally, SAPT3 was highly expressed and SAPT4 was only detected in the reference strain. Overall, it is important to highlight that C. tropicalis cells detached from biofilms are able to colonize human cells and cause some injury and reduction of metabolic activity.

Candida tropicalis infection in a term neonate with gall bladder masses and infective endocarditis

Candida endocarditis is extremely rare in term neonates, and gall bladder involvement due to candidemia has never been reported amongst neonates and infants. A term, appropriate for gestational age neonate developed Candida tropicalis blood stream infection in second week of life. He was started on conventional amphotericin B. However, he failed to show any clinical improvement, and candidemia keep on persisting. Repeat sanctuary sites screening revealed multiple echogenic masses in heart (vegetations) and gall bladder. On changing the treatment to liposomal amphotericin B and fluconazole, he recovered clinically, echogenic masses in gall bladder disappeared, and intracardiac vegetations decreased in size.