Calculate Association Constants Research Articles

Quantitative structure -retention relationship modeling of selected antipsychotics and their impurities in green liquid chromatography using cyclodextrin mobile phases.

Applying green chromatography methods is currently one of the challenges in liquid chromatography. Among different strategies, using cyclodextrin (CD) mobile phase modifiers was applied in this paper. CDs can form inclusion complexes with a wide variety of hydrophobic organic compounds and, consequently, affect their retention behavior. CD-containing mobile phases possess complicated complexation and adsorption equilibria so retention is dependent not only on chromatographic parameters and properties of the compound but also on properties of compound-CD complex. Docking study was used to calculate association constants of the selected antipsychotics (risperidone, olanzapine, and their impurities) and β-CD complexes and predict which part of the molecule structure will most likely incorporate into the β-CD cavity. Quantitative structure-retention relationship model (QSRR) for selected model substances was built employing artificial neural network (ANN) technique. Reliable QSRR model was obtained using molecular descriptors, complex association constants, and chromatographic factors. The multilayer perceptron network with 11-8-1 topology, trained with back propagation algorithm, showed the best performance. Root mean square error for training, validation, and test was 0.2954, 0.3633, and 0.4864, respectively. The correlation coefficient (R2) between experimentally obtained retention factor values [k(exp)] and values computed or predicted by ANN [k(ANN)] was 0.9962 for training, 0.9927 for validation, and 0.9829 for test, indicating good predictive ability of the model. The optimized network was used for development of green chromatography method for separation of risperidone and its related impurities, as well as olanzapine and its related impurities in a relatively short run time and with low consumption of organic modifier. The developed methods were validated in accordance with ICH Q2 (R1) quideline and all parameters fulfilled the defined criteria. The greenness of the proposed methods has also been demonstrated. Graphical Abstract Complex association constants as inputs of QSRR model in β-cyclodextrin modified HPLC system and development of green chromatography methods.

A quantitative approach to polar organic reactivity

A method is presented which allows one to predict toxic effects which are triggered by the formation of covalent bonds between electron-deficient (electrophilic) compounds and biological electron-rich (nucleophilic) targets, as proteins or nucleic acids. It is based on our comprehensive nucleophilicity and electrophilicity scales, which we constructed as an aid for the planning of organic syntheses. For the construction of these scales, rate constants for the reactions of benzhydrylium ions (aryl2CH+) and structurally related quinone methides with nucleophiles have been measured and correlated by the equation lg k(20 °C) = sN(E + N), which yields absolute rate constants k (L mol–1 s–1) from one parameter for electrophiles (the electrophilicity E) and two for nucleophiles (the nucleophilicity parameter N and the susceptibility sN). A freely accessible database (http://www.cup.uni-muenchen.de/oc/mayr/DBintro.html) is described, which presently comprises data for 1000 nucleophiles and 260 electrophiles and provides links to the original literature reports. The kinetic scales are complemented by a thermodynamic counterpart, which enables one to calculate association constants K (L mol–1) of electrophiles with nucleophiles from the empirical Lewis acidity parameters LA and Lewis basicity parameters LB by the equation lg K (20°C) = LA + LB.

Characterization of membrane protein interactions in plasma membrane derived vesicles with quantitative imaging Förster resonance energy transfer.

Here we describe an experimental tool, termed quantitative imaging Förster resonance energy transfer (QI-FRET), that enables the quantitative characterization of membrane protein interactions. The QI-FRET methodology allows us to acquire binding curves and calculate association constants for complex membrane proteins in the native plasma membrane environment. The method utilizes FRET detection, and thus requires that the proteins of interest are labeled with florescent proteins, either FRET donors or FRET acceptors. Since plasma membranes of cells have complex topologies precluding the acquisition of two-dimensional binding curves, the FRET measurements are performed in plasma membrane derived vesicles that bud off cells as a result of chemical or osmotic stress. The results overviewed here are acquired in vesicles produced with an osmotic vesiculation buffer developed in our laboratory, which does not utilize harsh chemicals. The concentrations of the donor-labeled and the acceptor-labeled proteins are determined, along with the FRET efficiencies, in each vesicle. The experiments utilize transient transfection, such that a wide variety of concentrations is sampled. Then, data from hundreds of vesicles are combined to yield dimerization curves. Here we discuss recent findings about the dimerization of receptor tyrosine kinases (RTKs), membrane proteins that control cell growth and differentiation via lateral dimerization in the plasma membrane. We focus on the dimerization of fibroblast growth factor receptor 3 (FGFR3), a RTK that plays a critically important role in skeletal development. We study the role of different FGFR3 domains in FGFR3 dimerization in the absence of ligand, and we show that FGFR3 extracellular domains inhibit unliganded dimerization, while contacts between the juxtamembrane domains, which connect the transmembrane domains to the kinase domains, stabilize the unliganded FGFR3 dimers. Since FGFR3 has been documented to harbor many pathogenic single amino acid mutations that cause skeletal and cranial dysplasias, as well as cancer, we also study the effects of these mutations on dimerization. First, we show that the A391E mutation, linked to Crouzon syndrome with acanthosis nigricans and to bladder cancer, significantly enhances FGFR3 dimerization in the absence of ligand and thus induces aberrant receptor interactions. Second, we present results about the effect of three cysteine mutations that cause thanatophoric dysplasia, a lethal phenotype. Such cysteine mutations have been hypothesized previously to cause constitutive dimerization, but we find instead that they have a surprisingly modest effect on dimerization. Most of the studied pathogenic mutations also altered FGFR3 dimer structure, suggesting that both increases in dimerization propensities and changes in dimer structure contribute to the pathological phenotypes. The results acquired with the QI-FRET method further our understanding of the interactions between FGFR3 molecules and RTK molecules in general. Since RTK dimerization regulates RTK signaling, our findings advance our knowledge of RTK activity in health and disease. The utility of the QI-FRET method is not restricted to RTKs, and we thus hope that in the future the QI-FRET method will be applied to other classes of membrane proteins, such as channels and G protein-coupled receptors.

Evaluation of the Physicochemical Behavior of Waste Water Treatment Polyelectrolytes with Metal Ions

In this paper is describing the physicochemical behavior of polyelectrolytes (PEs) used in waste water treatment with mono-, di- and trivalent metal ions as K+, Mg2+, Zn2+, Fe3+, Sn2+, Cd2+, Pb2+, Cu2+, Ni2+, Al3+ and Cr3+. A coagulant polyelectrolyte Poly(vinyl sulfate) potassium salt (PVSK), and a commercial available Flocculant Trident 2756, were used as models for the study. The colloidal titration UV-Vis spectroscopy technique was successfully implemented in order to evaluate the complexation of PEs with Toluidine Blue O (OTB) and the ability of different metal ions to displace the OTB from the PE-OTB complex and form the PE-metal ion complex. From the experiments was concluded that PVSK has a high affinity for Al3+ and Mg2+ while the Flocculant has the highest affinity for Sn2+ followed by Zn2+and Mg2+. The absorbance profiles of polyelectrolyte-OTB complex (Absorbance vs. Metal/PE) were used to calculate association constants. On the other hand, the mass balance of OTB and its absorbance profiles were used to calculate the association constants of polyelectrolyte-metal ion complexes. Thus metal ions with the highest affinities have the highest association constant. Metal ions with the highest affinities present the highest values of association constant.

Correlation between Hydrogen Bonding Association Constants in Solution with Quantum Chemistry Indexes: The Case of Successive Association between Reduced Species of Quinones and Methanol

The functional M05-2X together with the SMD solvent model have been used to calculate hydrogen bonding association constants in dimethylsulfoxide (DMSO) solution. Data of equilibrium constants in DMSO for the case of electrochemically generated dianions interacting with methanol have been considered to test the reliability of the chemistry theoretical approach. From this approach, it was found that the successive association constants involved in the formation of the complexes depend on a linear combination of three quantum chemistry indexes which are the ionization energy, the electron affinity, and the charge on the oxygen atom receiving the methanol molecule. Under this perspective, the stoichiometry of all the dianion-methanol complexes was explained on the basis of the relative strength of the hydrogen bonding interaction compared to that of the methanol-DMSO and methanol dimer complexes. This linear combination seems to be valid regardless of the nature of the dianion structure and the number of methanol molecules in the complex, which is a relevant finding to generalize the applicability of both the functional M05-2X and the SMD solvent model, to calculate association constants for any other neutral or anionic molecules interacting by hydrogen bonding with proton donors.

Modelling triazolophane–halide binding equilibria using Sivvu analysis of UV–vis titration data recorded under medium binding conditions

Two different models that calculate association constants from UV–vis titration data have been evaluated for the 1:1 binding between triazolophane receptor ([Host] = 1–13 μM) and various halides F− , Cl− , Br− and I− in CH2Cl2 (K a ≈ 103–106 M− 1). The Drago model fits the ΔA values at a single wavelength as a function of the added guest concentration. The new computer program Sivvu performs equilibrium-restricted factor analysis using all the wavelengths of the dataset simultaneously. Both models generate comparable K a values, and both provide a means to assess the accuracy of the binding constant determination: K a [host] < 12. Analysis with Sivvu (1) allows the number of unique chemical absorbers to be identified in an unbiased manner. This analysis allowed for a 2:1, triazolophane:F− intermediate to be identified and included in the model. Sivvu also (2) allows alternate models to be quickly evaluated, (3) generates more accurate binding constants, and (4) generates the extinction profiles for each absorbing species in solution.

Accommodation and Repair of a UV Photoproduct in DNA at Different Rotational Settings on the Nucleosome Surface

Cyclobutane-thymine dimers (CTDs), the most common DNA lesion induced by UV radiation, cause 30 degrees bending and 9 degrees unwinding of the DNA helix. We prepared site-specific CTDs within a short sequence bracketed by strong nucleosome-positioning sequences. The rotational setting of CTDs over one turn of the helix near the dyad center on the histone surface was analyzed by hydroxyl radical footprinting. Surprisingly, the position of CTDs over one turn of the helix does not affect the rotational setting of DNA on the nucleosome surface. Gel-shift analysis indicates that one CTD destabilizes histone-DNA interactions by 0.6 or 1.1 kJ/mol when facing away or toward the histone surface, respectively. Thus, 0.5 kJ/mol energy penalty for a buried CTD is not enough to change the rotational setting of sequences with strong rotational preference. The effect of rotational setting on CTD removal by nucleotide excision repair (NER) was examined using Xenopus oocyte nuclear extracts. The NER rates are only 2-3 times lower in nucleosomes and change by only 1.5-fold when CTDs face away or toward the histone surface. Therefore, in Xenopus nuclear extracts, the rotational orientation of CTDs on nucleosomes has surprisingly little effect on rates of repair. These results indicate that nucleosome dynamics and/or chromatin remodeling may facilitate NER in gaining access to DNA damage in nucleosomes.

Cooperative interactions in the tandem of oligonucleotide derivatives arranged at complementary target. Quantitative estimates and contribution of the target secondary structure

The intraduplex reaction of the alkylating reagent CIRCH 2NHpd(TTCCCA) (X, CIR is p-( N-2-chloroethyl- N-methylaminophenyl) residue) with the target 26-mer d(TTGCCTTGAATGGGAAGAGGGTCATT) (P) in the presence of effectors was studied. The effectors used were Phn-L-pd(TTCAAGGC)p-L-Phn (E 1) and Phn-L-pd(TGACCCTC)p-L-Phn (E 2), where Phn is N-(2-hydroxyethyl)-phenazinium residue and L is NHCH 2CH 2NH spacer. The dependence of the alkylation extent of the target on the reagent concentration was treated using the equation derived earlier for the two-component system (reagent+target) to calculate association constants of X with P, PE 1, PE 2 and PE 1E 2. The latters were found to be K xe1 = 6.75 · 10 5 M −1, K xe2 = 4.15 · 10 4 M − and K xe12 = 5.87 · 10 6 10 6 M −1 as compared with the affinity of X to P K x = 2.16 · 10 4 M −1 in the absence of effectors. Taking into account the internal structure of the target, co-operativity parameters describing interactions in the tandem E 1 · X · E 2 arranged at the target were calculated as α 1 = 16, α 2 = 10 and α 12 = 139 for the duplexes PXE 1, PXE 2 and PXE 1E 2.

Dissection of the 16S rRNA binding site for ribosomal protein S4

The ribosomal protein S4 from Escherichia coli is essential for initiation of assembly of 30S ribosomal subunits. We have undertaken the identification of specific features required in the 16S rRNA for S4 recognition by synthesizing mutants bearing deletions within a 460 nucleotide region which contains the minimum S4 binding site. We made a set of large nested deletions in a subdomain of the molecule, as well as individual deletions of nine hairpins, and used a nitrocellulose filter binding assay to calculate association constants. Some small hairpins can be eliminated with only minor effects on S4 recognition, while three hairpins scattered throughout the domain (76–90, 376–389 and 456–476) are essential for specific interaction. The loop sequence of hairpin 456–476 is important for S4 binding, and may be directly recognized by the protein. Some of the essential features are in phylogenetically variable regions; consistent with this, Mycoplasma capricolum rRNA is only weakly recognized by S4, and no specific binding to Xenopus laevis rRNA can be detected.

Algorithms for predicting ion association in supercritical H 2O fluids

The forces that produce complexes in aqueous supercritical fluids can be understood by considering the electrostatic interaction between charged ions. We have used a modified Gilkerson-Fuoss equation to calculate association constants given the electrostatic radius of a given complex and the temperature, pressure, and dielectric constant of the solvent. Correlations between crystallographic radii, calculated electrostatic radii, and solvent-solute interaction terms for experimentally measured electrolytes in supercritical aqueous solutions permit estimation of association constants for aqueous complexes in crustal fluids between 1 and 4 kbar and from 400 to 700°C.

A new method to determine association constants for alcohols from the properties of pure compounds

Hofman, T. and Nagata, I., 1986. A new method to determine association constants for alcohols from the properties of pure compounds. Fluid Phase Equilibria, 28: 233-252. The methods used to calculate association constants and enthalpies of association from the properties of pure associated substances are critically reconsidered. A new approach is proposed for alcohols that leads to more reliable values of both enthalpies and entropies of association.

Influence of electrolytic dissociation upon rates of reactions. Part 10. Acid-catalysed aquations of some penta-ammine(carboxylato)cobalt(III) ions in aqueous solutions

Rate coefficients of aquation at constant ionic strength in lithium perchlorate–perchloric acid media of a series of penta-ammine(carboxylato)cobalt(III) complexes [Co(NH3)5L]n+ have been calculated from u.v. absorbance measurements. With most of these, increases in the observed rate coefficients are not proportional to increases in the acid concentrations. The data have been used to calculate association constants of protonated forms of the complexes and the corresponding rate coefficients of aquation. The obtained association constants are 0.64 (L = acetate; I= 2.0, 40 °C), 0.1 (L =o-methoxybenzoate; I= 2.0, 40 °C), 116 (L = oxalate; first association constant, I= 0.5, 60 °C), 0.24 (L = malonate; second association constant, I= 2.0, 40 °C), 0.69 (L = succinate; second association constant, I= 2.0, 40 °C), 0.02 dm3 mol–1(L =o-phthalate; second association constant, I= 2.0 mol dm–3, 40 °C). With the tartrato-complex the observed rate coefficients increased linearly with increasing [HClO4] and this is also so with the oxalato-complex for I > 0.5 mol dm–3 but such increases are small when compared with those of the other d ica rboxylato-complexes of the present studies. U.v. spectral decreases at constant wavelength with increasing [HClO4] under virtually static conditions have also been used to estimate the association constants of the protonated complexes. The exceptions, since no spectral decreases were found, are the o-methoxybenzoato-complex, the oxalato-form at [HClO4] > 0.5 mol dm–3, and the doubly protonated tartrato-complex. The values obtained are 0.68 (L = acetate; I= 2.0, 30 °C), 125 (L = oxalate; first association constant, I= 0.5, 60 °C), 0.37 (L = malonate; second association constant, I= 2.0, 40 °C), 0.67 (L = succinate; second association constant, I= 2.0, 40 °C), 0.1 dm3 mol–1(L =o-phthalate; second association constant, I= 2.0 mol dm–3, 40 °C). These are in reasonable agreement with the above values derived from the kinetic data and from the latter the rate coefficients of aquation of the protonated species have been estimated. There appear to be broad relationships between the rate coefficients of the protonated forms and the association constants (comparing acetate with o-methoxybenzoate and succinate with malonate). This can perhaps account for the oxalate, tartrate, and o-phthalate complexes showing little evidence of double protonation. This feature is also discussed in terms of ligand chain lengths and it is also noted that in contrast to the first association constants of the protonated dicarboxylate complexes which are large but have relatively little catalytic effect, the second association constants are small but have strong influences upon the rates of aquation.

Nitrogenases of Klebsiella pneumoniae and Azotobacter chroococcum: Complex formation between the component proteins

1. 1. Sedimentation velocity analyses of mixtures of highly purified component proteins of Azotobacter chroococcum are consistent with the formation of a tight 1 : 1 complex in the absence of Na 2 S 2 O 4. 1 : 1 complex formation between complementary proteins from A. chroococcum and Klebsiella pneumoniae was also observed. The addition of 5 mM Na 2 S 2 O 4 weakened the interaction between the A. chroococcum proteins and also the interaction between complementary proteins of A. chroococcum and K. pneumoniae. 2. 2. Steady-state kinetic data for acetylene reduction at low protein concentrations have been used to calculate association constants at 30°C for the 1 : 1 protein complexes of nitrogenase proteins from A. chroococcum, K. pneumoniae and mixtures of complementary proteins from both organisms. Values centered around 3 · 10 7 M −t were obtained. 3. 3. The temperature dependence of the association constant for the complex formed by the K. pneumoniae proteins exhibited a sharp break at 17° C with ΔH = 0 and Δ H = 418 kJ · mol −1 above and below 17°C, respectively. 4. 4. The Arrhenius plot for acetylene reduction by the complex formed by the K. pneumoniae proteins was linear over the range 12–40°C with ΔH ≠ = 80 kJ · mol −1 .