Cajanus Scarabaeoides Research Articles

Transgressive Segregation for Seed Protein in an Inter-specific Cajanus Cross

Three inter-specific Cajanus crosses were assessed for their intra-population variation for protein content. In the unselected F7 bulk population of a cross involving a wild species (Cajanus scarabaeoides) and an early maturing cultivar, “Baigani,” the transgressive segregation for both high as well as low protein contents was observed. The high protein (35.6%) transgressive segregant produced 24% more protein than the wild species donor parent (28.7%). Similarly, the low-protein (18.8%) transgressive segregant had 17% less protein than the low-protein parent (22.7%). It is concluded that the parents of this cross carried different sets of dominant and recessive protein-controlling alleles; their complementary and/or additive gene effects produced these transgressive segregants.

The characterization and quantification of structures of Cajanus scarabaeoides phytochemicals and their seasonal variation analysis using ultra-performance liquid chromatography-tandem mass spectrometry.

Cajanus scarabaeoides, belonging to the Fabaceae family, is an underutilized herb and traditionally used to treat several ailments. However, it is not well explored phytochemically. Therefore, mass spectrometry (MS)-based phytochemical analysis was carried out to investigate the bioactive ingredients of the herb. A ultra-performance liquid chromatography (UPLC) coupled to photodiode array detection (PDA) and electrospray ionization (ESI) tandem mass spectrometry (UPLC-PDA-ESI-MS/MS) system was used for the qualitative and quantitative analysis of phytochemicals. The chromatographic separation was achieved on the Acquity BEH C18 column (150 × 2.1mm, 1.7μm) using a gradient system consisting of three solvents, acetonitrile, methanol, and 0.1% formic acid, used at a flow rate of 0.300 ml/min. Sixteen bioactive ingredients (gallic acid, gallocatechin, epigallocatechin, catechin, procyanidin dimer, epicatechin, procyanidin trimer, isoorientin, orientin, vitexin, isovitexin, quercetin-mono-O-glycoside, isoquercitrin, luteolin-7-O-glucoside, quercetin, and luteolin) were identified and structurally characterized. Consequently, 12 compounds were reported for the first time from C. scarabaeoides, and 13 were quantitatively determined in different seasons. Isoorientin (10.2-7.1% w/w) and orientin (5.78-5.17% w/w) were the most abundant constituents in the dry weight of plant material, followed by vitexin and isovitexin in the rainy season. The phytochemical investigation has revealed that C. scarabaeoides could be a potential alternate source of bioactive ingredients, namely, isoorientin, orientin, vitexin, and isovitexin, contributing to further exploration of its biological activity. In addition, analytical methods can be used for the rapid identification and quantification of bioactive ingredients in C. scarabaeoides.

Identification of dynamic microRNA associated with systemic defence against Helicoverpa armigera infestation in Cajanus scarabaeoides

Helicoverpa armigera is a major insect pest of several crop plants, including pigeonpea. Resistant gene sources are not available in the cultivated gene pool, but resistance has been observed in its crop wild relative, Cajanus scarabaeoides. Gene regulatory mechanisms governing the systemic immune response of this plant to pod borer infestation have not yet been deciphered. MicroRNA (miRNA) profiles of H. armigera-infested and undamaged adjacent leaves of C.scarabaeoides were compared to gain an insight into the plant-insect interactions and to identify dynamic miRNA molecules potentially acting as mediators of systemic defence responses. A total of 211 conserved, temporally dynamic miRNA were identified in the unfed adjacent leaves, out of which 98 were found to be differentially expressed in comparison to control leaves. On further analysis, most of the miRNA detected in the adjacent leaves was found to target genes involved in the defence pathways and plant immune response. An overlap of the differentially expressing miRNAs was observed between insect-fed and adjacent unfed leaves, indicating the transmission of signal from the site of infestation to the undamaged parts of the plant, indicative of induction of a systemic defence response. The miRNA response in the unfed leaves had the signatures of induced changes in metabolism and signal transduction for induction of defence pathway genes. This study reveals the participation of miRNAs in imparting pod borer resistance and mounting a systemic defence response against pod borer infestation in C. scarabaeoides. © 2022 Society of Chemical Industry.

Comparative analysis of herbivory responsive miRNAs to delineate pod borer (Helicoverpa armigera) resistance mechanisms in Cajanus cajan and its wild relative Cajanus scarabaeoides.

Comparative analysis of herbivory responsive miRNAs between pod borer susceptible C. cajan and its resistant Crop Wild Relative (CWR) C. scarabaeoides revealed miRNA-based regulation of defense genes and plant-insect interactions. Gram pod borer (Helicoverpa armigera) is one of most devastating pests of pigeon pea (Cajanus cajan) worldwide, responsible for huge losses in crop productivity. The lack of genes conferring resistance to pod borer in pigeon pea has proven to be a bottleneck for its improvement. One of its CWR, C. scarabaeoides has demonstrated resistance to this pest and can be exploited for developing pest resistant crop varieties. Differences in expression patterns of herbivory responsive microRNAs in the susceptible C. cajan and resistant C. scarabaeoides after different time duration of pod borer infestation (2h, 8h and 18h) were identified, characterized and functionally validated to understand their role in insect defense response. A total of 462 conserved and 449 novel miRNAs and 273 conserved and 185 novel miRNAs, were identified in C. cajan and C. scarabaeoides, respectively. Among the identified miRNAs, 65, 68 and 65 miRNAs were found to be differentially expressing between the C. scarabaeoides and C. cajan libraries 2h, 8h and 18h post infestation, respectively. These miRNAs were found to target genes involved in a number of pathways contributing to defense and acquired resistance in C. scarabaeoides against pod borer, indicating miRNA-based regulation of defense pathways. Expression patterns of eight of these miRNAs were validated by qRT-PCR. This study provides novel insights into the miRNA-mediated plant-insect interactions and the mechanisms of regulatory pathways involved in insect defense. These findings can be utilized for further exploring the mechanism of herbivore defense in plant systems.

Reaping the Potential of Wild Cajanus Species through Pre-Breeding for Improving Resistance to Pod Borer, Helicoverpa armigera, in Cultivated Pigeonpea (Cajanus cajan (L.) Millsp.).

Simple SummaryPigeonpea is an important legume crop that is severely affected by various insect pests, especially pod borer. Because there are low resistance levels to pod borers in the cultivated pigeonpea gene pool, it is necessary to introduce resistance-related traits from its wild relatives. In this study, we conducted a series of crosses to introduce traits related to pod borer resistance from two wild relatives of pigeonpea into two popular cultivated varieties. We generated populations from four different crosses and screened these populations for traits related to pod borer resistance: i.e., low levels of insect damage, high concentrations of insect-deterring compounds in the seeds, and the presence of trichomes on the leaves. The most promising lines were tested across seasons and locations. Ultimately, we identified 21 lines with excellent traits related to pod borer resistance. These lines will be useful for breeding new insect-resistant pigeonpea cultivars. The availability of such cultivars will reduce the use of pesticides to control pests on pigeonpea crop.Pod borer (Helicoverpa armigera) causes the highest yield losses in pigeonpea, followed by pod fly (Melanagromyza obtusa). High levels of resistance to pod borer are not available in the cultivated genepool. Several accessions of wild Cajanus species with strong resistance, and different resistance mechanisms (antixenosis and antibiosis) to pod borer have been identified. These accessions can be utilized to improve the pod borer resistance of cultivated pigeonpea. Using pod borer resistant Cajanus scarabaeoides and Cajanus acutifolius as pollen donors and popular pigeonpea varieties as recipients, pre-breeding populations were developed following simple- and complex-cross approaches. Preliminary evaluation of four backcross populations consisting of >2300 introgression lines (ILs) under un-sprayed field conditions resulted in identifying 156 ILs with low visual damage rating scores (5.0–6.0) and low pod borer damage (<50%). Precise re-screening of these ILs over different locations and years resulted in the identification of 21 ILs having improved resistance to pod borer. Because these ILs were derived from wild Cajanus species, they may contain different alleles for different resistance components to pod borer. Hence, these ILs are ready-to-use novel and diverse sources of pod borer resistance that can be utilized for improving the pod borer resistance of cultivated pigeonpea.

Phytochemical Investigation, Antioxidant Profiling and GCMS Analysis of Cajanus scarabaeoides Seed Extracts

Rajesh Rokkam, Felicity Pinipay, Archana Bollavarapu, Gangaraju Rapaka, Satyanarayana Botcha and Raghava Rao Tamanam Cajanus scarabaeoides (family: Fabaceae) is a wild species of the genus Cajanus and it is traditionally used in various healthcare practices.

First report of Fusarium equiseti (Corda) Sacc. causing wilt of Cajanus scarabaeoides, a wild relative of pigeonpea in India.

Wild species or crop wild relatives (CWRs) provide a unique opportunity to introduce novel traits and expand the genetic base of the cultivated pigeonpea (Bohra et al. 2010, 2020). Among the wild relatives of pigeonpea, Cajanus scarabaeoides is cross-compatible with cultivated pigeonpea (C. cajan). To identify the resistant sources for use in the pigeonpea breeding, the present study was conducted using 79 wild pigeonpea accessions at ICAR-Indian Institute of Pulses Research, Kanpur, India during 2016-17 and 2017-18 (Figures 1 a and b). The pigeonpea accessions belonged to three different genera Cajanus, Rhynchosia and Flemingia. During field scouting, seedlings were observed with foliar chlorosis and wilting (Fig. 2a). Infected stem tissue exhibited brown to black discoloration, followed by gradual plant drying, and ultimately plant death (Fig. 2b). Infected plants were collected from the field and pathological examination was performed in the laboratory conditions. Wilted plant parts were surface-disinfected with 1% sodium hypochlorite for two minutes and 5.0 mm size pieces of stem tissue were transferred to petri-dishes containing 90ml of Fusarium Specific Medium (FSM) (Nash and Snyder 1962) and incubated at 27oC. After 48 hrs of incubation, white to orange aerial mycelial growth was observed (Fig. 2c). The fungus was transferred to fresh FSM and purified by the single-spore technique (Choi et al. 1999). Macroconidia had four to six septa, slightly curved at the apex ranged from 20.0 to 25.0 × 3.0 to 5.5 μm (Fig. 2d). Microconidia were absent. The isolated fungus was putatively identified as belonging to the F. equiseti species complex based on colony morphology and macroconidia characteristics and size (Booth, 1977; Leslie and Summerell 2004). The pathogenicity test was conducted on 15-day old healthy seedlings of wild pigeonpea using 'root dip inoculation' and 'soil inoculation' technique (Haware and Nene 1994). Plant roots were immersed in a conidial suspension (6×106 conidia/ml water as determined by a hemocytometer) for 3-4 minutes (Marley and Hillocks 1996), while the roots of control plant were immersed in sterilized distilled water. A single spore culture of F. equiseti was grown on PDA-containing perti-dishes. Two actively grown mycelia discs (5 mm dia) from the periphery of 7-day old pure culture of F. equiseti were separately inoculated in 500 ml conical flasks containing 100g pigeonpea meal medium. The flasks were incubated at 28±2°C for 10 days. A fungus-soil mixture was prepared by mixing 200 g of inoculums with 2kg of autoclaved sand: soil mixture (3:7). Earthen pots having 15-cm diameter were sterilized by formalin (0.1%). These pots were then filled with fungus-soil mixture. Seeds sterilized with mercuric chloride (1%) were sown in each pot. Seeds sown in uninoculated pots served as control. Five seeds were sown in each pot with three replications. Disease symptoms developed 10 days after inoculation of wild pigeonpea plants in greenhouse. Symptoms were identical to those observed in the field. No symptoms were observed in control. Re-isolating the F. equiseti pathogen from the inoculated wild pigeonpea seedlings corroborated Koch's postulates. Reference cultures of three isolates of F. equiseti were deposited in Indian Type of Culture Collection (ITCC), Division of Plant Pathology, ICAR-Indian Agricultural Research Institute (IARI), New Delhi with the accession numbers ITCC8413, ITCC8414 and ITCC8415. Fungal genomic DNA was extracted through modified CTAB method (Murray and Thompson 1980). The ITS regions 1 and 2, including 5.8S ribosomal DNA (rDNA) region, and part of translation elongation factor 1-α (TEF) were amplified by using the ITS6F (GAAGGTGAAGTCGTAACAGG) and ITS4R (TCCTCCGCTTATTGATATGC) and tef (F: ATGGGTAAGGAAGACAAGAC; R: GGAAGTACCAGTGAATCATGTT) primers. BLASTn analysis of the sequences generated showed a 98.78% homology with F. equiseti. The sequences were deposited at GenBank (Accession numbers of ITS region: MF351849, MF351850, MF351851, and Tef region: MK259963, MK264345, MK264346). Phylogenetic analysis of the ITS and Tef region sequences revealed that all Fusarium isolates belong to the F. equiseti species complex and other available sequences of Fusarium spp. (Fig. 3). Occurrence of F. equiseti on various plant species is reported worldwide by several researchers (Liang et al. 2011; Ramachandra and Bhatt 2012; Prasad et al. 2017). To the best of our knowledge and based on the literature, this is the first report of wilt disease on wild pigeonpea in India, caused by F. equiseti (Corda) Sacc.

Comparative transcriptome analyses revealed different heat stress responses in pigeonpea (Cajanus cajan) and its crop wild relatives.

Comparative transcriptome analyses accompanied by biochemical assays revealed high variability in heat stress response in Cajanus species. Among the studied species, C. scarabaeoides was the most thermotolerant followed by C. cajanifolius, C. cajan, and C. acutifolius. Pigeonpea is one of the climate-resilient grain legumes. Though the optimum temperature for cultivated pigeonpea is ~ 25-35°C, its wild relatives grow in temperatures ranging between 18 and 45°C. To gain insight into molecular mechanisms responsible for the heat stress tolerance in pigeonpea, we conducted time-series transcriptome analysis of one pigeonpea cultivar (Cajanus cajan) and two wild relatives, Cajanus acutifolius, and Cajanus scarabaeoides subjected to heat stress at 42 ± 2ºC for 30min and 3h. A total of 9521, 12,447, and 5282 identified transcripts were differentially expressed in C. cajan, C. acutifolius, and C. scarabaeoides, respectively. In this study, we observed that a significant number of genes undergo alternative splicing in a species-specific pattern during heat stress. Gene expression profiling analysis, histochemical assay, chlorophyll content, and electrolyte leakage assay showed that C. scarabaeoides has adaptive features for heat stress tolerance. The gene set enrichment analyses of differentially expressed genes in these Cajanus species during heat stress revealed that oxidoreductase activity, transcription factor activity, oxygen-evolving complex, photosystem-II, thylakoid, phenylpropanoid biosynthetic process, secondary metabolic process, and flavonoid biosynthetic process were highly affected. The histochemical assay showed more lipid peroxidation in C. acutifolius compared to other Cajanus species inferring the presence of higher quantities of polyunsaturated fatty acids in the plasma membrane which might have led to severe damage of membrane-bound organelles like chloroplast, and high electrolyte leakage during heat stress. This study paves the way for the identification of candidate genes, which can be useful for the development of thermo-tolerant pigeonpea cultivars.

Field screening of pigeonpea for their resistance against Melanagromyza obtusa (Diptera: Agromyzidae)

Melanagromyza obtusa (Malloch) has been recorded for the first time on pigeonpea at Nagpur, India and named as 'tur pod fly'. It is a monophagous species and devours the developing seeds of pigeonpea crop. It was reported to infest 12 to 100% pods causing losses of 2.4-95.0% on seed or grain (=250000 tonnes by weight) and are estimated at US $ 256 million annually. Therefore, a field experiment was conducted at Research Farm, Agricultural Research Station, Badnapur (VNMKV), India during kharif 2015-16 to source some promising pigeonpea genotypes against M. obtusa. The present investigations revealed the population of M. obtusa on 20 genotypes ranged from 0.00-277.64 maggots per 100 pods; pod and grain damage were ranging from 0.00-89.75 and 0.00-82.02%. The highest M. obtusa population, pod and grain damage was recorded in BRG-2 (277.64 maggots and 101.26 pupae per 100 pods; and 89.75 and 82.02%). On the basis of pod damage a total of five, two, eight, four and one genotypes were categorized as highly tolerant, tolerant, moderately tolerant, susceptible and highly susceptible; for grain damage these were seven, seven, three, two and one, respectively. The maximum yield was recorded from BDN-2010-1 (22.33 q/ha), followed by V-127 (21.61 q/ha). However, Cajanus scarabaeoides showed no maggot and pupal population, pod and grain damage by M. obtusa indicating its virtue of genetic resistance and it can be used in breeding programmes to develop resistant cultivars for farmer’s welfare.

Mapping QTL for important seed traits in an interspecific F2 population of pigeonpea

Seed traits present important breeding targets for enhancing grain yield and quality in various grain legume crops including pigeonpea. The present study reports significant genetic variation for six seed traits including seed length (SL), seed width (SW), seed thickness (ST), seed weight (SWT), electrical conductivity (EC) and water uptake (WU) among Cajanus cajan (L.) Millspaugh acc. ICPL 20340 and Cajanus scarabaeoides (L.) Thouars acc. ICP 15739 and an F2 population derived from this interspecific cross. Maximum phenotypic values recorded for the F2 population were higher than observed in the parent ICPL 20340 [F2 max vs ICPL 20340: SW (7.05 vs 5.38), ST (4.63 vs 4.51), EC (65.17 vs 9.72), WU (213.17 vs 109.5)], which suggested contribution of positive alleles from the wild parent, ICP 15739. Concurrently, to identify the QTL controlling these seed traits, we assayed two parents and 94 F2 individuals with 113 polymorphic simple sequence repeat (SSR) markers. In the F2 population, 98 of the 113 SSRs showed Mendelian segregation ratio 1:2:1, whereas significant deviations were observed for 15 SSRs with their χ 2 values ranging between 6.26 and 20.62. A partial genetic linkage map comprising 83 SSR loci was constructed. QTL analysis identified 15 marker-trait associations (MTAs) for seed traits on four linkage groups i.e. LG01, LG02, LG04 and LG05. Phenotypic variations (PVs) explained by these QTL ranged from 4.4 (WU) to 19.91% (EC). These genomic regions contributing significantly towards observed variability of seed traits would serve as potential candidates for future research that aims to improve seed traits in pigeonpea.

Flavonoids with chemotaxonomic significance from Cajanus scarabaeoides

Phytochemical investigation of Cajanus scarabaeoides (L.) Thouars (Fabaceae) led to the isolation of six compounds. The chemical structures of all compounds were determined by spectroscopic methods. All isolates were reported from this species for the first time. The presence of these compounds is consistent with the chemical classes reported from other members of the genus Cajanus. In summary, this study reported six compounds isolated from Cajanus scarabaeoides and discussed the plant chemotaxonomy of Cajanus genus.

Introgression of productivity enhancing traits, resistance to pod borer and Phytopthora stem blight from Cajanus scarabaeoides to cultivated pigeonpea.

The study aimed at introgression of productivity enhancing traits and resistance to pod borer and Phytophthora stem blight from wild to cultivated pigeonpea through an inter-specific cross between Cajanus scarabaeoides (ICP 15683) and C. cajan (ICPL 20329). Progenies derived from the direct segregating (without backcross) population and backcross population were evaluated for yield and yield contributing traits namely fruiting branches and pods plant-1 and 100-seed weight. Introgressed progenies having higher fruiting branches, pods and yield plant-1 compared to the cultivated parent were identified in both populations. A few progenies with significantly shorter plant height, early flowering and early maturity as compared to both cultivated and wild parents were also recovered in both populations. Progenies from both the populations were identified with higher resistance to pod borer and Phytophthora stem blight. However, some introgressed progenies having lower seed weight and seeds per pod were also recovered. The promising progenies are currently being used in the breeding programme to develop cultivars with improved productivity and resistance to pod borer and Phytophthora stem blight.

Non-coding RNAs having strong positive interaction with mRNAs reveal their regulatory nature during flowering in a wild relative of pigeonpea (Cajanus scarabaeoides).

In higher plants, flower development is a result of crosstalk between many factors like photoperiod, vernalization, hormone concentration, epigenetic modification etc. and is also regulated by non-coding RNAs (ncRNAs). In the present study, we are reporting the involvement of long non-coding RNAs (lncRNAs) and miRNAs during the process of flower development in Cajanus scarabaeoides, an important wild relative of pigeonpea. The transcriptome of floral and leaf tissues revealed a total of 1672 lncRNAs and 57 miRNAs being expressed during flower development. Prediction analysis of identified lncRNAs showed that 1593 lncRNAs were targeting 3420 mRNAs and among these, 98 were transcription factors (TFs) belonging to 48 groups. All the identified 57 miRNAs were novel, suggesting their genera specificity. Prediction of the secondary structure of lncRNAs and miRNAs followed by interaction analysis revealed that 199 lncRNAs could interact with 47 miRNAs where miRNAs were acting in the root of interaction. Gene Ontology of the ncRNAs and their targets showed the potential role of lncRNAs and miRNAs in the flower development of C. scarabaeoides. Among the identified interactions, 17 lncRNAs were endogenous target mimics (eTMs) for miRNAs that target flowering-related transcription factors. Expression analysis of identified transcripts revealed that higher expression of Csa-lncRNA_1231 in the bud sequesters Csa-miRNA-156b by indirectly mimicking the miRNA and leading to increased expression of flower-specific SQUAMOSA promoter-binding protein-like (SPL-12) TF indicating their potential role in flower development. The present study will help in understanding the molecular regulatory mechanism governing the induction of flowering in C. scarabaeoides.

A Wild Cajanus scarabaeoides (L.), Thouars, IBS 3471, for Improved Insect-Resistance in Cultivated Pigeonpea

Cajanus scarabaeoides (L.), Thouars, is the closest wild crop relative of cultivated pigeonpea, Cajanus cajan (L.), Millspaugh. This wild pigeonpea has several insect-resistance mechanisms, particularly to Helicoverpa armigera (Hübner). Estimated economic losses in the semi-arid tropics from H. armigera damage in pigeonpea are approximately two billion USD/year. Therefore, it is imperative to improve pest resistance in this crop. In this study, we investigated insect-resistance components in IBS 3471, a C. scarabaeoides accession, and explored the possibility of transferring resistance mechanism/s to cultivated pigeonpea. A detached leaf bioassay revealed that IBS 3471 has more effective antibiosis and antixenosis resistance mechanisms against H. armigera compared to the susceptible C. cajan variety, ICPL 87. To further investigate the antibiosis resistance mechanism, we fed H. armigera larvae a heated and non-heated artificial diet supplemented with lyophilised IBS 3471 leaf powder. Incorporation of IBS 3471 leaf powder inhibited H. armigera larval weight and delayed larval development compared to larvae reared on diet supplemented with ICPL 87 leaf powder. The putative insect-resistance compounds in C. scarabaeoides were heat-labile. Proteomic analysis revealed higher levels of potential insecticidal proteins, namely lectin and cysteine proteinase inhibitor, in wild pigeonpea compared to the cultivated variety. Nutritional analysis and interspecific hybridisation experiments also indicated that IBS 3471 is a potential candidate for improvement of insect-resistance in pigeonpea. This study demonstrates that IBS 3471 has multiple resistance mechanisms against H. armigera, and they are transferable to cultivated pigeonpea.

Devising selection criteria based on variability and association studies in segregating populations derived from an interspecific cross between Cajanus scarabaeoides × C. cajan

Segregating populations (BC1F3 and F3:4) from an interspecific cross (C. scarabaeoides × C. cajan) were evaluated for variability and association studies for yield and its component traits. In both the generations, high values of PCV and GCV were obtained for pods per plant, seed yield per plant and fruiting branches per plant. High estimates of heritability as well as genetic advance were observed for fruiting branches per plant followed by pods per plant and seed yield per plant. High heritability coupled with high genetic advance revealed the presence of less environmental influence and prevalence of additive gene action. Seed yield per plant had highly significant and positive association with pods per plant, fruiting branches and 100-seed weight. Path coefficient analysis revealed that pods per plant, fruiting branches and 100-seed weight contributing maximum towards seed yield per plant. The study revealed that fruiting branches and pods per plant could be used as selection criteria for improving yield.

Polyphenol enriched ethanolic extract of Cajanus scarabaeoides (L.) Thouars exerts potential antifilarial activity by inducing oxidative stress and programmed cell death.

Development of antifilarial drug from the natural sources is considered as one of the most efficacious, safe, and affordable approaches. In this study, we report the antifilarial activity of a leguminous plant Cajanus scarabaeoides (L.) Thouars. The polyphenol-rich ethanolic extract obtained from the stem part of the plant C. scarabaeoides (EECs) was found to be efficient in killing the filarial nematode Setaria cervi in all the three developmental stages viz. oocytes, microfilariae (Mf) and adults with LD50 values of 2.5, 10 and 35 μg/ml, respectively. While studying the molecular mechanism of action, we found that induction of oxidative stress plays the key role in inducing the mortality in S. cervi. The redox imbalance finally results in activation of the nematode CED pathway that executes the death of the parasite. Intriguingly, EECs was found to be selectively active against the worm and absolutely non-toxic to the mammalian cells and tissues. Taken together, our experimental data demonstrate that C. scarabaeoides can be chosen as an affordable natural therapeutic for treating filarial infection in the future with high efficacy and less toxicity.

&lt;b&gt;New distribution records of some wild crop relatives from India&lt;/b&gt;

Field surveys across various parts of the country coupled with an analysis of literature and examination of herbarium specimens revealed the natural distribution of six wild relatives of crop species in various states/union territories of India, viz., Cajanus scarabaeoides (from Lakshadweep), Cucumis javanicus (from Meghalaya), Hystrix duthiei (from Jammu &amp; Kashmir), Luffa echinata (from Haryana) and Trichosanthes pilosa (from Andhra Pradesh), which have not been reported earlier from these states. Their descriptions, phenology, habitat and other field notes have been presented here.

Chloroplast Genome Sequence of Pigeonpea (Cajanus cajan (L.) Millspaugh) and Cajanus scarabaeoides (L.) Thouars: Genome Organization and Comparison with Other Legumes.

Pigeonpea (Cajanus cajan (L.) Millspaugh), a diploid (2n = 22) legume crop with a genome size of 852 Mbp, serves as an important source of human dietary protein especially in South East Asian and African regions. In this study, the draft chloroplast genomes of Cajanus cajan and Cajanus scarabaeoides (L.) Thouars were generated. Cajanus scarabaeoides is an important species of the Cajanus gene pool and has also been used for developing promising CMS system by different groups. A male sterile genotype harboring the C. scarabaeoides cytoplasm was used for sequencing the plastid genome. The cp genome of C. cajan is 152,242bp long, having a quadripartite structure with LSC of 83,455 bp and SSC of 17,871 bp separated by IRs of 25,398 bp. Similarly, the cp genome of C. scarabaeoides is 152,201bp long, having a quadripartite structure in which IRs of 25,402 bp length separates 83,423 bp of LSC and 17,854 bp of SSC. The pigeonpea cp genome contains 116 unique genes, including 30 tRNA, 4 rRNA, 78 predicted protein coding genes and 5 pseudogenes. A 50 kb inversion was observed in the LSC region of pigeonpea cp genome, consistent with other legumes. Comparison of cp genome with other legumes revealed the contraction of IR boundaries due to the absence of rps19 gene in the IR region. Chloroplast SSRs were mined and a total of 280 and 292 cpSSRs were identified in C. scarabaeoides and C. cajan respectively. RNA editing was observed at 37 sites in both C. scarabaeoides and C. cajan, with maximum occurrence in the ndh genes. The pigeonpea cp genome sequence would be beneficial in providing informative molecular markers which can be utilized for genetic diversity analysis and aid in understanding the plant systematics studies among major grain legumes.

Identification of potential stress responsive microRNAs and their targets in Cajanus spp.

Plant under stress exercises a variety of changes at genetic and molecular level, including microRNA (miRNA) mediated post-transcriptional gene silencing. MicroRNA is a small endogenous non-coding RNA, which regulates the target genes post-transcriptionally. In the present study, 9 stress responsive miRNAs was successfully identified from available stress related EST libraries of Cajanus species applying computational approach. Six of them namely., miRNA156, miRNA2924, miRNA6214, miRNA5652, miRNA1862 and miRNA7982 are responsive to heat, drought and flood stresses and 3 miRNAs namely, miRNA395, miRNA417 and miRNA867 are disease responsive in Cajanus spp. Three out of 9 miRNAs namely, miRNA156, miRNA6214 and miRNA1862 identified in heat, drought and flood stress libraries, respectively belonged to Cajanus scarabaeoides, a close wild relative of C. cajan. miRNA156, miRNA1862, miRNA395 and miRNA417 target different transcription factors like wrky, cw-type zing finger protein, b3 domain containing protein and bsd domain-containing transcription factors. The target genes of identified miRNAs are playing crucial role in well defined molecular pathways like., cell division, translation machinery, epigenetic modification and ubiquitin proteasome pathway. The stress responsive miRNAs of Cajanus species identified in the present study provides a better understanding of the regulatory role of miRNAs in biotic and abiotic stresses.

Genetic linkage mapping of loci conferring resistance to Blue butterfly (Lampides boeticus L.) and Plume moth (Exelastis atomosa Wals.) on chromosome 2 (CcLG02) in Pigeonpea

Inheritance of host resistance to blue butterfly (PBB1) and plume moth (PPM1) in interspecific mapping populations (F2, F3 and BC1) derived from a cross involving Cajanus cajan (cv. ICP-26) × Cajanus scarabaeoides (acc. ICPW-94) appeared to be under monogenic control either by a single major gene or a cluster of tightly linked genes. Bulked segregant analysis using 237 [85 simple sequence repeats (SSR), 143 random amplified polymorphic DNA (RAPD) and nine inter simple sequence repeats (ISSR)] parental polymorphic primers led to the identification of 43 markers that distinguished the resistant and susceptible bulks alike to parents, and which were also segregating among F2 progenies. Linkage analysis of these markers along with interaction phenotype score for both traits generated a linkage group consisting of 11 markers (two SSR, seven RAPD and two ISSR) and two trait loci (PBB1 and PPM1). This linkage group distributed over 133.9 cM with an average marker interval of 10.3 cM. The PBB1 and PPM1 loci were linked to each other by 11.2 cM (rf 0.110), and were flanked by ISSR marker UBC8722000 (15.9 cM), and RAPD marker OPA09910 (15.3 cM), respectively. On the basis of sequence homology of linked marker OPA09910 these two loci were assigned to chromosome 2 (CcLG02). Composite interval mapping led to the detection of two major quantitative trait loci (qPBB2.1 and qPPM2.1) controlling blue butterfly and plume moth resistance, respectively and the quantitative trait locus peaks coinciding with PBB1 and PPM1 loci on the map.