Burrows-Wheeler Aligner Research Articles

Traces of SARS-CoV-2 RNA in Peripheral Blood Cells of Patients with COVID-19.

The severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is the third virus that caused coronavirus-related outbreaks over the past 20 years. The outbreak was first reported in December 2019 in Wuhan, China, but rapidly progressed into a pandemic of an unprecedented scale since the 1918 flu pandemic. Besides respiratory complications in patients with COVID-19, clinical characterization of severe infection cases showed several other comorbidities, including multiple organ failure, and septic shock. To better understand the systemic pathogenesis of COVID-19, we interrogated the virus's presence in the peripheral blood cells, which might provide a form of trafficking or hiding to the virus. By analyzing >2 billion sequence reads of high-throughput transcriptome sequence data from 180 samples of patients with active SARS-CoV-2 infection or healthy controls collected from 6 studies, we found evidence of traces of SARS-CoV-2 RNA in peripheral blood mononuclear cells in two samples from two independent studies. In contrast, the viral RNA was abundant in bronchoalveolar lavage specimens from the same patients. We also devised a “viral spike-to-actin” RNA normalization as a metric to compare across various samples and minimize errors caused by intersample variability in total human RNA abundance. Our observation suggests immune presentation and discounts the possibility of extensive viral infection of lymphocytes or monocytes.

Genomic Landscape of Chronic Lymphocytic Leukemia in China By Targeted Gene Sequencing

IntroductionIn recent years, whole-exome sequencing (WES) and whole-genome sequencing (WGS) have identified over 60 recurrently mutated genes in both coding and non-coding regions in chronic lymphocytic leukemia (CLL) patients. However, these studies were restricted to Europeans, and the genomic landscape of CLL in Asians remains less-well defined. To better understand the genetic basis of CLL in Asians, we used target gene sequencing to define the mutational status of 63 recurrently mutated genes in CLL and other small B-cell lymphomas in a cohort of 93 Chinese patients with CLL.MethodsA total of 93 CLL patients were retrospectively enrolled. Genomic DNA was isolated from cryopreserved mononuclear cells or bone marrow aspirate specimens. Targeted gene sequencing was performed on HiSeq Sequencer (Illumina, Inc, San Diego, CA) following the manufacturer's standard sequencing protocols. The sequencing reads were aligned to hg19 using the Burrows-Wheeler Aligner (BWA). SNV calling was performed using both GATK and Varscan programs, and the called SNV data were then combined. The variants at a frequency of 0.1% or more in the 1000 genomes database or 1000g (CHB and CHS) (http://www.1000genomes.org), esp6500 (http://evs.gs.washington.edu/EVS) or ExAC03 database (http://exac.broadinstitute.org) were removed from subsequent analysis.ResultsA total of 195 driver mutations across 50 genes were identified in 80 patients (86.0%). 57 cases (61.3%) harbored mutations involving at least two genes. The most frequently mutated genes included IGLL5 (21/93, 22.6%), MYD88 (15/93, 16.1%), LRP1B (11/93, 11.8%), TP53 (9/93, 9.6%), NOTCH1 (8/93, 8.6%), ATM (7/93, 7.5%), CHD2 (7/93, 7.5%) and KMT2D (7/93, 7.5%). Only 4 cases with SF3B1 mutations (4/93, 4.3%) were identified in our cohort (Figure 1). By comparing the results from the study by Landau et al, our results showed that CLL in Chinese displayed significantly different mutational profiles from those in Caucasians (Table 1).Cases with complex karyotype (CK) had higher frequencies of TP53 (7/16 [44%] vs 2/65 [3%], p <0.0001) and EGR2 mutations (3/16 [19%] vs 0/65 [0%], p=0.0066), as compared to cases without CK . By Kaplan-Meier analysis, we found that shorter time-to-first-treatment (TTT) was significantly associated with TP53 (p <0.0001), EGR2 (p=0.0019), KMT2D (p=0.047) and DDX3X mutations (p=0.0232). Multivariate analysis of TTT revealed that only TP53 mutation (hazards ratio[HR]: 2.945, 95%CI: 1.065-8.147; p=0.037) and advanced Binet stage (HR:4.464, 95%CI:2.037-9.784; p=0.0002) independently predicted inferior TTT (Table 2). TP53 (p <0.0001), SF3B1 (p=0.017), NOTCH1 (p=0.012), EGR2 (p <0.0001) and DDX3X mutations (p=0.007) predicted reduced overall survival. Multivariate Cox analysis revealed that TP53 mutation (HR: 20.361, 95%CI: 3.220-128.753, p=0.001), EGR2 mutation (HR: 15.497, 95%CI: 1.639-146.514; p=0.017) and SF3B1 mutation (HR: 20.230, 95%CI: 2.337-175.085, p=0.006) independently predicted unfavorable overall survival.ConclusionsWe found that Chinese CLL displayed a distinct mutational landscape from that of Caucasians. Our findings suggest different mechanisms involved in the pathogenesis of Chinese CLL. Besides, our results support that targeted gene sequencing can provide important values in the prognostification of CLL. Targeted gene sequencing of a large cohort and whole exome/genome sequencing of CLL cases are needed to better define the genomic landscape of CLL in Chinese. [Display omitted] DisclosuresNo relevant conflicts of interest to declare.

Persistence of Somatic Mutation Spectrum and Clonal Architecture in Chronic Myelomonocytic Leukemia Treated with Hypomethylating Agents

Chronic myelomonocytic leukemia (CMML) is a clonal hematologic neoplasm that combines features of myelodysplasia and myeloproliferative disorder, and carries a poor prognosis due to progression to acute myeloid leukemia or complications of cytopenias. Hematopoietic stem cell transplantation is the only curative option, but many patients are ineligible due to comorbidities and old age. Previous genomic analyses reveal recurrent somatic driver mutations in a variety of genes, including many epigenetic regulators. Hypomethylating agents (HMAs) such as 5-azacitidine induce hematologic responses in approximately 40% of CMML patients, but most patients ultimately experience disease progression.To understand genetic factors driving response or resistance to HMAs, we deciphered clonal architecture and dynamics in CMML patients treated with 5-azacitidine on a prospective clinical study (NCT01350947; n=11) or in analogy to the study protocol (n=2) over 2 years. Median age at presentation was 70 years. Eleven patients had CMML-1 and two had CMML-2 based on WHO classification. Three patients (23%) achieved complete response (CR), 4 (31%) had partial response (PR), 2 had stable disease (SD), and 1 had no response according to the International Working Group 2006 response criteria. Three patients (23%) progressed after a period of SD.Whole exome sequencing was performed on mononuclear cells or sorted monocytes from serial blood/bone marrow samples collected at screening, during treatment with 5-azacitidine and at the end of study or progression (n=53, median of 4 samples/patient). Cultured mesenchymal stromal cells (n=5), skin fibroblasts (n=6) or sorted CD3+ lymphocytes (n=2) were used as sources of constitutional DNA. Paired-end sequencing was done on Illumina HiSeq 2500 (San Diego, CA) following library preparation and exome enrichment. Fastq files were aligned to the reference human genome (Genome Reference Consortium GRCh37) with Burrows-Wheeler Aligner (bwa_mem) algorithm. Variants were called with Freebayes and annotated by SnpEff. Non-exonic mutations were filtered and somatic mutations were analyzed to study clonal dynamics using SubcloneSeeker [Qiao et al. Genome Biology. 2014;15(8):443]. Copy number variation (CNV) and loss of heterozygosity (LOH) was analyzed by whole genome single nucleotide polymorphism arrays (Infinium Omni2.5-8 v1.3, Illumina).TET2 (62% of patients), SRSF2 (62%) and ASXL1 (46%) were the most frequently mutated genes. Additional mutations in other genes associated with CMML were detected at lower frequencies: R UNX1 (38%), CBL (31%), KRAS (23%), DNMT3A (15%) and NRAS (15%). No obvious CNV was seen in most patients, but trisomy 8 and LOH in chromosome 11q with uniparental disomy in CBLc.1151G>A variant were observed in a patient with disease progression.There was no correlation between the type of mutations and clinical response. Most mutations retained similar levels of variant allele frequency (VAF) in pre- and post-treatment samples, irrespective of clinical response. Models by SubcloneSeeker also demonstrated that overall clonal architecture based on somatic mutations remained unaffected by HMA treatment, and no difference was observed between responders and non-responders to HMAs. While there were modest shifts in relative sizes between individual sub-clones over time, mutations in TET2, SRSF2 or ASXL1 were consistently identified in all the sub-clones, with median VAF of 53%, 51% and 41% respectively, indicating that mutations in these epigenetic regulator genes were acquired early as part of CMML founding clones and their allele burden was not reduced by HMA. Immunophenotyping of post-treatment samples showed re-expansion of normal lymphocytic populations to a median of 24% in responders (n=4) and 13% in non-responders (n=3), suggesting that HMA suppressed myelomonocytic expansion, with or without restoring balanced hematopoiesis.Our data show that HMA-induced hematological responses in CMML occur despite largely preserved somatic mutation burden and clonal architecture, consistent with a predominantly epigenetic mechanism of action. Whether other therapeutic interventions will restore polyclonal hematopoiesis remains to be determined and may depend primarily on the availability of residual normal hematopoietic stem cells for reconstitution. DisclosuresKovacsovics:Celgene: Consultancy; Seattle Genetics: Research Funding; Flexus: Research Funding. Deininger:BMS: Consultancy, Research Funding; ARIAD: Consultancy; Ariad Pharmaceuticals, Bristol Myers Squibb, CTI BioPharma Corp, Gilead, Incyte, Novartis, Pfizer, Celgene, Blue Print, Galena: Consultancy, Membership on an entity's Board of Directors or advisory committees; Incyte: Consultancy; Novartis: Consultancy, Research Funding; Pfizer: Consultancy; Gilead: Research Funding; Celgene: Research Funding.

Germline Tissues and DNA Sequencing Analysis Methods for Optimal Somatic Variant Detection in Myelodysplastic Syndrome (MDS)

Introduction: Whole exome sequencing (WES) has identified somatic mutations significant to the pathogenesis of MDS, in which germline tissue sequencing is a challenging, yet vital, component of genetic discovery. Challenges include deriving germline DNA of sufficient quantity and quality that is devoid of neoplastic contamination. To identify the optimal control for The National MDS Natural History Study conducted by the NHLBI and the NCI, we perform a comprehensive assessment of an array of candidate germline tissues. This study will provide a future resource for genomic research in MDS and related hematopoietic diseases.Methods: Twenty-six MDS cases were included and up to six candidate germline tissues were collected for each case: ten eyebrow hair follicles/patient (n=26), a 2-4 mm skin biopsy (n=26), 50 ml urine (n=26), ten fingernail clippings/patient (n=3), purified CD3+ T-cells from peripheral blood (n=26), and buccal swabs (n=11). In addition, bone marrow mononuclear cells (BMNCs) were collected and analyzed from each case. DNA quantity, by Qubit quantification, and DNA quality, by an Illumina TapeStation, were measured on all samples. WES was performed with SureSelect (Agilent) exome enrichment on native and whole genome amplified (WGA) DNA (Illustra GenomiPhi V2 kit) from BMNCs and sequenced on a HiSeq instrument (Illumina). WGA was performed in germline tissue with less than 1.5µg total DNA (eyebrow hair and skin). Sequence reads were aligned with the Burrows-Wheeler Aligner and variant calling performed by Strelka/MuTect. Targeted resequencing using NimbleGen Hybrid Capture System (Roche) was used to confirm nucleotide variants detected by Strelka/MuTect software using native (non-WGA) DNA. False-negative and false-positive variants were defined as those missed in 1 of 4 or those identified in 1 of 4 BMNC/germline pairs, respectively.Results: All patients met a WHO-defined MDS diagnosis and had active disease at the time of sampling. Sequencing was performed on DNA from four candidate germline controls (skin, hair, ≥ 95% pure CD3+ T-cells, and buccal swabs as summarized in Table 1) from 16 MDS cases, and on DNA from the BMNCs. Buccal cells were analyzed on 11 of the cases. Urine and fingernail clippings were excluded from WES due to morphologic leukocyte contamination and poor DNA quality (mean DIN=1.6, n=3), respectively. The median coverage was 92x for WES and 404x for targeted resequencing.Strelka/MuTect identified 272 protein-coding variants in at least one BMNC-germline pair including 28 (10.2%) known variants (Papaemmanuil et al, Blood . 122:3616-3627, 2013). Of 272 total variants, 133 variants (48.8%, 8.3 variants/patient) were identified in all BMNC-germline pairs. However, a high rate of false-negative variants was seen when skin was used as the control (20%, 56 total, 3.5 variant/patient). False positive and false negative variants are summarized in Table 1.To explore missed variant calls, we compared the coverage and variant allele frequency (VAF) for all variants in the BMNCs and germline controls. No significant differences were seen in BMNC coverage, BMNC VAF, or germline tissue coverage at false negative variants (Table 1). However, increases were identified in the VAF of false negative variants in the skin (29 variants, mean VAF 5.8%, range 0-8.5%) suggesting neoplastic contamination. This result is in agreement with the observation that a larger fraction of variants were missed in BMNC-skin pairs.Given these results, we tested whether another variant caller using distinct statistical methodology would perform more favorably using skin as a germline control. VarScan employs a heuristic approach hypothesized to overcome neoplastic contamination. VarScan was able to identify variants missed by Strelka/MuTect in a subset of variants (27 of 56) with skin. However 12 of 56 positions were not called by VarScan against any germline control suggesting differences between methods.Conclusions: Identifying the bioinformatics pipeline and germline tissue that best identifies somatic variants given tumor contamination, while considering the quantity and quality of DNA obtained, may augment the spectrum of mutations seen in MDS. Skin biopsies can be contaminated with neoplastic variants, which can result in missed variant identification. Future sequencing studies should consider this and explore non-skin germline control tissues to map the MDS mutatome. [Display omitted] DisclosuresPadron:Incyte: Honoraria, Research Funding. Teer:Interpares Biomedicine: Consultancy. Komrokji:Novartis: Honoraria, Speakers Bureau; Celgene: Honoraria. Sekeres:Celgene: Membership on an entity's Board of Directors or advisory committees. Bejar:Genoptix: Consultancy, Honoraria, Patents & Royalties; Celgene: Consultancy, Honoraria, Other: DSMB, Steering Committee, Research Funding; Otsuka/Astex: Honoraria, Other: Ad-hoc advisory board; Foundation Medicine: Honoraria, Other: Ad-hoc advisory board; AbbVie/Genetech: Honoraria, Other: Ad-hoc advisory board; Modus Outcomes: Consultancy, Honoraria. Epling-Burnette:Forma Therapeutics: Research Funding; Incyte: Research Funding; Celgene: Research Funding.

Comparison of Short-Read Sequence Aligners Indicates Strengths and Weaknesses for Biologists to Consider.

Aligning short-read sequences is the foundational step to most genomic and transcriptomic analyses, but not all tools perform equally, and choosing among the growing body of available tools can be daunting. Here, in order to increase awareness in the research community, we discuss the merits of common algorithms and programs in a way that should be approachable to biologists with limited experience in bioinformatics. We will only in passing consider the effects of data cleanup, a precursor analysis to most alignment tools, and no consideration will be given to downstream processing of the aligned fragments. To compare aligners [Bowtie2, Burrows Wheeler Aligner (BWA), HISAT2, MUMmer4, STAR, and TopHat2], an RNA-seq dataset was used containing data from 48 geographically distinct samples of the grapevine powdery mildew fungus Erysiphe necator. Based on alignment rate and gene coverage, all aligners performed well with the exception of TopHat2, which HISAT2 superseded. BWA perhaps had the best performance in these metrics, except for longer transcripts (>500 bp) for which HISAT2 and STAR performed well. HISAT2 was ~3-fold faster than the next fastest aligner in runtime, which we consider a secondary factor in most alignments. At the end, this direct comparison of commonly used aligners illustrates key considerations when choosing which tool to use for the specific sequencing data and objectives. No single tool meets all needs for every user, and there are many quality aligners available.

IN SILICO ANALYSIS OF POTENTIAL OFF-TARGET SITES TO GENE EDITING FOR MUCOPOLYSACCHARIDOSIS TYPE I BY USING THE CRISPR/CAS9 SYSTEM: IMPLICATIONS FOR POPULATIONS-SPECIFIC TREATMENTS

<h3>Background</h3> The CRISPR/Cas9 system is an accessible and less onerous editing system to treat human genetic diseases, but off-target prediction is paramount to ensure the safety and efficiency of this system in clinical applications. The aim of this study is to evaluate off-target regions for a guide RNA (sgRNA) designed to correct the most common variant found in Mucopolysaccharidosis type I (MPS I) patients and also possible implications for population-specific treatment to treat genetic diseases. <h3>Methods</h3> The most employed in silico tools for off-targets prediction were used: CHOPCHOP, COSMID, Cas-OFFinder, CCTop and CRISPOR. Moreover, new PAM sequences (NNG or NGN) were also evaluated by using Burrows-Wheeler Aligner for this sgRNA against human genome version hg19. The potential off-target regions were selected from sequences selected by the tools' score and with up to 6 mismatches and up to 2 indels, and the conservation of 5 nucleotides upstream PAM (SEED). The polymorphic site evaluation was made using 1000 Genomes and Latin America databases (ABraOM and LOVD 3-Argentina). Polymorphic sites that have equal or greater 1% in at least one of the populations were selected. <h3>Results</h3> From a total of 13,422 off-targets, 272 potential off-targets were selected for this sgRNA. A total of 84 polymorphic sites were recognized in the off-target sequences. The 1000 Genomes had the highest amount of polymorphic sites, whereas ABraOM reported only six. In most cases polymorphic sites decrease the probability of off-target cleavage by increasing the number of mismatches and/or indels and also disrupt PAM and SEED regions. On the other hand, one off-target sequence not previously recognized by all the five predictors was created by a polymorphic variant with frequencies of 42% in African populations and of 16% in European and Latin American populations. <h3>Conclusion</h3> Here we show the importance of identifying potential off-target sites considering the analysis of frequent polymorphic sites in different populations. Thus, this analysis contributes to a better evaluation of safety aspects of gene editing to treat MPS I patients and other genetic diseases in a population-specific context by using the CRISPR/Cas9 system.

MiR-4477b gene as a novel pathogenic mutation occurring during the transformation of colorectal adenoma into colorectal cancer.

Polyps may develop into colorectal cancer (CRC) after 10-20 years. The occurrence of polyps and tumors caused by somatic gene mutations is considered a main pathogenesis of CRC. Among all general patients with polyps or CRC, some had adenoma of varying degrees that were consistent with familial colorectal adenomas. A patient with CRC (the propositus) and his brothers and sister, all of whom had varying degrees of colorectal polyps showed different adenomas with different members in a family. In the present study, a total of 9 family members were investigated, and a family tree was drawn. Genomic DNA was extracted from peripheral venous blood samples from family members, and whole-exome sequencing (WES) and Sanger sequencing were performed on the DNA samples. The result of WES was compared with compared directly to the reference genome (hg19) with Burrows-Wheeler Aligner, which is as control group from. We identified a base substitution in the miR-4477b gene (c.68415368T>G, chromosome 9 q13), predicted the target gene of miR-4477b through the biologic website, and analyzed the Gene Ontology (GO) and signal pathway of the target gene. The GO functional annotation analysis of the target gene of mir4477b revealed that these genes are involved mainly in the G1/S transition of the mitotic cell cycle, activation of mitogen-activated protein kinase activity, protein phosphorylation, and membrane, centrosome, cytoplasm, zinc ion-binding, protein-binding, and ligase activity. Kyoto Encyclopedia of Gene and Genomes pathway analysis revealed that miR-4477b regulates target genes mainly involved in the phosphoinositide 3-kinase/Akt signaling pathway, regulation of the actin cytoskeleton, proteoglycans in cancer, pathways in cancer, and renal cell carcinoma. The mutation of the has-mir-4477b gene likely leads to the occurrence of adenoma and CRC. In-depth studies of patients from the same family with different stages of adenoma can avoid errors caused by gene diversity, incomplete clinical data, and uncertain disease development. The has-mir-4477b gene may represent a key gene mutation in colorectal carcinogenesis and a multiyear cancer risk for patients that requires further attention.

Hardware acceleration of the novel two dimensional Burrows‐Wheeler Aligner algorithm with maximal exact matches seed extension kernel

Next-generation sequencing techniques have dramatically increased the amount of genomic data being sequenced, which calls for the acceleration of the alignment algorithms. This article proposes an FPGA-based accelerated implementation of the seed extension kernel of the Burrows–Wheeler alignment genomic mapping algorithm. The well-known Smith–Waterman algorithm is used during the seed extension to find the optimum alignment between the sequences. The state-of-the-art architectures in the literature use one-dimensional (1-D) systolic arrays to fill a similarity matrix, based on the best score out of all match combinations, mismatches and gaps are computed. The cells on the same anti-diagonal are computed in parallel in these architectures. We propose a novel 2-dimensional architecture in which all the cells on the same rows and the same columns are computed in parallel and, thereby, significantly accelerated the process. The similarity matrix cells are computed in two phases: (1) the calculation phase and (2) error compensation phase. The calculation phase roughly approximate the cell values and the approximation error is fixed up during the error compensation phase. Our simulation results show that the proposed architecture can be up to 718x and 1.7x faster than the software execution and the 1-D systolic arrays, respectively.

Recovering influenza genomes from wild bird habitats for better avian flu surveillance

Background: Avian influenza viruses (AIVs) cause severe disease in poultry and dangerous zoonotic infections in humans. Outbreaks disrupt trade, threaten food security, and jeopardize public health. They also allow novel flu viruses to adapt to human hosts, threatening future pandemics and new types of seasonal flu. A cornerstone of outbreak prevention and pandemic preparedness is surveillance of AIVs in wild waterfowl, their natural animal reservoir. Current surveillance efforts focus on testing dead or captured birds, but rarely provide warning of dangerous strains. We have developed an alternative surveillance strategy using sediment specimens from wild bird habitats; since this is where virus-laden feces from the whole wild bird community accumulate, it likely contains an extensive collection of locally-circulating viruses. Here, we report a custom laboratory method to recover influenza genomes from sediment using targeted genomic sequencing. Methods and materials: A proof-of-concept experiment was conducted on 4 sediment specimens collected near Vancouver, Canada during the fall of 2016. Total RNA was extracted from these sediments and prepared into metagenomic sequencing libraries. Hemagglutinin, neuraminidase, and matrix segments of the influenza A virus genome were enriched using 600 custom hybridization probes, then sequenced on an Illumina MiSeq. qPCR targeting the matrix gene was used to estimate the fold-enrichment provided by the probes. Consensus sequences of hemagglutinin and neuraminidase genome segments were generated by mapping sequencing reads to subtype-specific references using the Burrows-Wheeler Aligner. Reference sequences were selected by querying the reads from each library against a BLAST database containing 8555 AIV sequences. Results: Influenza genome targets were enriched 19 million-fold following two sequential captures using our custom hybridization probe method. 17 haemagglutinin and neuraminidase genome segments were recovered from these sediment samples, 9 of which were at least 80% complete. Sequence analysis identified 6 subtypes of haemagglutinin (H3, H4, H6, H9, H10, H11) and 4 subtypes of neuraminidase (N1, N2, N6, N8, and N9). Phylogenetic analysis revealed they were closely-related to other AIV sequences previously isolated from wild birds in the same region of North America in recent years. Conclusion: Targeted genomic sequencing of wetlands sediment has demonstrated its potential as a viable complement to current AIV surveillance practices.

New PTEN mutation identified in a patient with rare bilateral choroidal ganglioneuroma

BackgroundChoroidal ganglioneuroma is an extremely rare tumor, and there is little knowledge regarding its pathogenesis. We aimed to investigate the phenotypic and genetic alterations in one sporadic patient with a rare case of bilateral choroidal ganglioneuroma.MethodsA 6-year-old boy with histological diagnosis of bilateral ganglioneuroma was recruited for the study. Comprehensive ophthalmic examinations were performed. Genomic DNA was extracted from the peripheral blood samples collected from the patient, his unaffected family members, and 200 unrelated control subjects from the same population. Whole exome sequencing was performed and raw reads were aligned to the human genome reference (hg19) using Burrows-Wheeler Aligner. DNA from all available family members was Sanger sequenced for segregation analysis.ResultsExtensive bilateral retinal detachments were observed via optical coherence tomography. Diffuse thickening of choroid was identified with ultrasound B scan and magnetic resonance imaging. Genetic analysis revealed the presence of a novel heterozygous PTEN frameshift mutation, c.498delA (p.Thr167LeufsTer16), in exon 6. It was present in the affected individual, but not in any of the family members. Genetic analysis revealed that there was no mutation in neurofibromatosis-related genes in the family. Upon performing comprehensive systemic examinations, no obvious abnormalities in other organs were observed.ConclusionsA novel de novo PTEN mutation was identified in a patient with bilateral choroidal ganglioneuroma. Although PTEN mutations are known to induce multiple abnormalities, choroidal ganglioneuroma can be the first manifestation without abnormalities in other organs. Further studies are needed to confirm the association between choroidal ganglioneuroma and PTEN mutation.

SARS-CoV-2 Polymorphisms and Multisystem Inflammatory Syndrome in Children.

* Abbreviations: COVID-19 — : coronavirus disease 2019 MIS-C — : multisystem inflammatory syndrome in children SARS-CoV-2 — : severe acute respiratory syndrome coronavirus 2 SNP — : single-nucleotide polymorphism Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), which causes coronavirus disease 2019 (COVID-19), was first identified in Wuhan, China, in December 2019. It rapidly spread across the world, and on March 11, 2020, the World Health Organization declared COVID-19 a global pandemic.1 In adults, SARS-CoV-2 can manifest as severe interstitial pneumonia and hyperinflammation, with∼3% to 5% of infections requiring admission to critical care.2,3 In contrast, severe illness and death due to SARS-CoV-2 infection in children is rare.4 However, recently, a small number of cases of shock and multisystem inflammation have been reported in children who have either tested positive for SARS-CoV-2 (by polymerase chain reaction or serology) or have had epidemiological links to it. This new syndrome, which has overlapping features of Kawasaki disease, is called multisystem inflammatory syndrome in children (MIS-C).5 The exact pathogenesis of MIS-C is as yet unknown. However, it has been suggested that part of the SARS-CoV-2 viral spike protein may resemble a superantigen that could drive the development of MIS-C and trigger … Address correspondence to Judith Breuer, MD, Research Department of Infection, Division of Infection and Immunity, University College London, Cruciform Building, Gower St, London WC1E 6BT, United Kingdom. E-mail: j.breuer{at}ucl.ac.uk

Clinical Exome Sequencing in B-Cell Ph-Negative ALL Patient Demonstrates Clonal Changes at Different Stages of the Disease

CONTEXT:A substantial number of patients with acute lymphoblastic leukemia (ALL) die from progressive disease after relapse that is frequently associated with clonal evolution. Clinical exome sequencing (CES) is a useful tool for mutation investigation, particularly in leukemic subclones during relapse. OBJECTIVE:The objective of this pilot study was to determine the specific genetic abnormalities associated with primary tumor comparing with normal hematopoietic tissue and to define clonal evolution patterns at relapse. DESIGN:CES (TruSightTM One Sequencing Panel) was performed on samples obtained from the patient with B-cell Ph-negative ALL at diagnosis, remission and relapse. SETTING:DNA was extracted from bone marrow samples according to modified salting out method. Libraries were pooled together and underwent two rounds of hybridization and capture, and additional quantification and size assessment. Between 21 and 26 million reads for each sample were obtained with a MiSeq (Illumina, USA), with a coverage of at least 20x for 97% of all sequences. More than 99% of reads passed quality and length control and were used in the analysis. De-multiplexing of indexed reads and the generation of FASTQ files were performed by the MiSeq system on-instrument software. The sequencing data, composed of 150 bp paired-end reads, were processed for MiSeq Reporter (Illumina), which is endowed with Burrows-Wheeler Aligner (BWA) for alignment on a reference sequence of hg19 and Genome Analysis Toolkit (GATK) for variant calling. Then, the Variant Call format (VCF) file was processed for analyzing on VariantStudio (Illumina) and wANNOVAR (Yang H. et al, 2015), which contain annotation databases, such as the ClinVar database, OMIM, the dbSNP database), the Polymorphism Phenotyping v2 database (Polyphen-2), and the Sorting Intolerant from Tolerant database (SIFT) and some others. PATIENTS OR OTHER PARTICIPANTS :A 27-year-old woman, who was admitted to the National Research Center for Hematology (Moscow, Russia) on March, 2017, presented with a three-month history of paleness and ossalgia. Common B-ALL (BII) ALL with complex karyotype and extramedullary lesions in ovaries, kidneys, intra-abdominal and peripheral lymph nodes has been diagnosed. Patient achieved complete remission (CR) after first induction therapy according to ALL-2016 protocol (ClinicalTrials.gov NCT03462095). After 16 months of CR during maintenance therapy (July, 2019) was diagnosed a relapse, which was refractory to multiple chemotherapy approaches and the patient died from the disease (January, 2020). RESULTS:Primary dataset analysis included more than 9000 gene variations for each of the three samples. Only clonal variations (at diagnosis) that are pathogenic either by the type of mutations (insertions (frameshift) and splice site mutations) or by prediction databases (PolyPhen-2, SIFT) were selected. As a result, about 70 variations were identified for each of the samples. Table 1 shows all clonal somatic mutations by which tumor tissue differs from normal hematopoietic tissue. At the time of diagnosis, a clone with monosomy of chromosome 3 was identified, that disappeared at CR and reappeared as a minor clone at relapse. Taking in consideration that the loss of one allele was caused by monosomy, we searched for pathogenic variations in genes localized on the chromosome 3 in order to identify genes inactivated according to Knudson's "Two-Hit" Theory of cancer causation (Knudson A., 1971). Out of 500 genes variations on chromosome 3, mutations in 5 genes according to prediction databases (PolyPhen-2, SIFT) were defined as pathogenic. All mutations were germinal. Moreover, four out of five mutations were homozygous. Table 2 shows the dynamics of pathogenic variations in genes localized on the chromosome 3 at different stages of the disease. The missense mutation ofCOL7A1gene (c.2791C&amp;gt; T), which was found in a small percentage (8%), was localized on the disappeared copy of chromosome 3, and its detection in this case was possible due to the presence of normal cells. CONCLUSIONS:There is an evident change in tumor clones at relapse: a major clone diagnosed inde novoB-cell ALL patient became minor at relapse. The data obtained from this analysis suggest that at the time of diagnosis, several clones are present in the tumor, and that most of the diagnosed pathogenic variations are not associated with oncogenesis and are germinal. Disclosures No relevant conflicts of interest to declare.

First report of grapevine associated jivivirus 1 infecting grapevines in Brazil.

Grapevines can host up to 86 virus species, some of which affect plant vigor, production and fruit quality (Fuchs, 2020). In 2014, a Vitis vinifera cv. Semillon vine showing yellow speckles and mild leafroll symptoms in Bento Gonçalves, RS, Brazil, was investigated for viruses (Silva et al., 2017), resulting in the detection of grapevine enamovirus 1, grapevine yellow speckle viroid 1 and hop stunt viroid. Total nucleic acids (TNA) extracts from this sample were enriched for dsRNA (Valverde et al., 1990), prepped with TruSeq Stranded mRNA kit (Illumina, USA), then subjected to high throughput sequencing (HTS) on the Illumina HiSeq 2000 platform. The HTS yielded 13,214 Mbp raw reads, which were trimmed and the host derived sequences subtracted with Trimmomatic and Burrows-Wheeler Aligner softwares, respectively. The remaining reads were subjected to taxonomic assignment with the Kaiju webserver, preliminarily indicating 26 reads related to citrus virga-like virus (Matsumura et al., 2017). De novo assembled contigs built by SPAdes generated five contigs that were subjected to tBLASTx searches against the NCBI viral RefSeq. Four sets of primers were designed to sequence the gaps between these contigs and the PCR amplicons were sequenced by Sanger method resulting in two long contigs. A third long contig related to citrus jingmen-like virus (Matsumura et al., 2017) was also retained for further analysis. BLASTn analyses of the assembled virus contigs showed that they are closely related to grapevine associated jivivirus 1 (GaJV-1) (Chiapello et al, 2020). The derived partial tripartite genomic sequences of GaJV-1 isolate SEM-BR from Brazil (GenBank acc. nos. MT657278-MT657280) covered 84.4% (3424 nt), 40.3% (1289 nt) and 73% (1555 nt) of RNAs 1, 2 and 3 of isolate DMG 109 from Italy (MN520745-MN520747), respectively. The pairwise nt sequence identities between both isolates were 99.3% (RNA1), 97.1% (RNA2) and 100% (RNA3), indicating that they are highly identical to each other. To confirm the HTS results, fresh TNA extracts from SEM-BR and four newly sampled vines were screened by RT-PCR using specific primers F (5'GGACGAAGTCACAACCAACACAGTTT3') and R (5'CGCGAGTAGGTCTGACAACTTTCATTAT3'), designed based on GaJV-1 RNA1. The resulting 478 bp amplicons were sequenced (MT657281-MT657285) and found to share 99.4%-99.8% nt identities with the corresponding sequences of GaJV-1 SEM-BR (MT657278). To assess graft-transmissibility of GaJV-1, Semillon scions of SEM-BR source vine were grafted onto 14 GaJV-1-free 1103P rootstocks. Six of 14 recipient plants (all asymptomatic) tested positive for GaJV-1 by RT-PCR 106 days after grafting. Additionally, RT-PCR screening of a Brazilian grapevine collection block resulted in the detection of GaJV-1 in nine of 33 tested vines of different accessions (27.3%). The GaJV-1 positive vines included eight commercial cultivars (Ancelotta, Aragonez, Merlot, Semillon, Michele Palieri, Malvasia, Viognier, and Pinot Nero). This is the first report of GaJV-1 in Brazil, a virus that was recently described in Italy and Spain (Chiapello et al, 2020). Our results also demonstrated the graft-transmissible nature of the virus but it is unclear if GaJV-1 is associated to grapevine plant cells or strictly to a possible grapevine fungal endophyte. Additional studies on the GaJV-1 prevalence in commercial vineyards in Brazil and possible effects of the virus on grapevines are necessary.

Whole-exome sequencing reveals ANO8 as a genetic risk factor for intrahepatic cholestasis of pregnancy

BackgroundIntrahepatic cholestasis of pregnancy (ICP) is characterized by pruritus and cholestasis in late pregnancy and results in adverse pregnancy outcomes, including preterm delivery and birth weight, which are affected by the genetic and environmental background. However, until now, the genetic architecture of ICP has remained largely unclear.MethodsTwenty-six clinical data points were recorded for 151 Chinese ICP patients. The data generated from whole-exome sequencing (WES) using the BGISEQ-500 platform were further analyzed by Burrows-Wheeler Aligner (BWA) software, Genome Analysis Toolkit (GATK), ANNOVAR tool, etc. R packages were used to conduct t-test, Fisher’s test and receiver operating characteristic (ROC) curve analyses.ResultsWe identified eighteen possible pathogenic loci associated with ICP disease in known genes, covering ABCB4, ABCB11, ATP8B1 and TJP2. The loci Lys386Gln, Gly527Gln and Trp708Ter in ABCB4, Leu589Met, Gln605Pro and Gln1194Ter in ABCB11, and Arg189Ser in TJP2 were novel discoveries. In addition, WES analysis indicated that the gene ANO8 involved in the transport of bile salts is newly identified as associated with ICP. The functional network of the ANO8 gene confirmed this finding. ANO8 contained 8 rare missense mutations that were found in eight patients among the 151 cases and were absent from 1029 controls. Out of the eight SNPs, 3 were known, and the remaining five are newly identified. These variants have a low frequency, ranging from 0.000008 to 0.00001 in the ExAC, gnomAD – Genomes and TOPMED databases. Bioinformatics analysis showed that the sites and their corresponding amino acids were both highly conserved among vertebrates. Moreover, the influences of all the mutations on protein function were predicted to be damaging by the SIFT tool. Combining clinical data, it was found that the mutation group (93.36 µmol/L) had significantly (P = 0.038) higher total bile acid (TBA) levels than the wild-type group (40.81 µmol/L).ConclusionsTo the best of our knowledge, this is the first study to employ WES technology to detect genetic loci for ICP. Our results provide new insights into the genetic basis of ICP and will benefit the final identification of the underlying mutations.

Abstract 1192: Genetic ancestry and somatic mutational frequencies in colorectal cancer: Findings from the Latino Colorectal Cancer Consortium

Abstract Subgroups of Hispanics/Latinos (HL) experience up to 30% higher colorectal cancer (CRC) mortality than non-Hispanic Whites. This disparity is not fully explained by socio-demographics or access to care, suggesting that biology plays a role. However, biological factors have been underexplored, in part due to a lack of diversity in available datasets. To address this limitation, we established the Latino Colorectal Cancer Consortium (LC3) and examined the association between genetic ancestry and somatic mutation frequencies in HL and in non-HL from Total Cancer Care (Moffitt Cancer Center). We hypothesized that ancestral haplotypes that vary across racial/ethnic populations contribute to differential somatic mutational profiles. We identified 321 primary CRC cases (34% HL (majority of Mexican and Puerto Rican origin), 63% non-HL, 3% unknown) and whole exome sequencing data. Somatic mutations were called from tumor/normal pairs using a bioinformatic pipeline including Burrows-Wheeler Aligner, the Genome Analysis Toolkit (GATK), MuTect, and Strelka. High quality mutation calls were filtered to exclude variants at ≥1% in 1000 Genomes. Inherited variants for ancestry analysis were called using GATK. Global proportions of African (AFR), Asian (ASN), European (EUR), and Indigenous American (IA) ancestry were estimated using ADMIXTURE with exome-wide SNPs overlapping 1000 Genomes. The associations between genetic ancestry and somatic mutation status in 38 genes commonly over-mutated in CRC were examined using compositional analysis in the context of logistic regression. Among HL, ancestry proportions were: AFR (mean: 0.15; range: 2 × 10−03-0.63), ASN (0.07; 0.02-0.92), EUR (0.56, 0.08-0.85) and IA (0.22, 3 × 10−03-0.64). Among non-HL, they were: AFR (0.03; 1 × 10−05-0.83), ASN (0.10; 0.01-0.70), EUR (0.85, 0.13-0.93) and IA (0.02, 2 × 10−03-0.65). Genetic ancestry was associated with the presence of any mutation in MSH3 (P=0.014), ACVR1B (P=0.016) or BRAF (P=0.016); or specifically, with the presence of any truncating mutation in TGFBR2 (P=0.018) or ACVR1B (P=0.024). Relative to EUR ancestry, individuals with higher IA ancestry had a lower probability of any BRAF mutation (OR (95% CI)=0.72 (0.55-0.94); P=0.015) and a higher probability of an APC truncating mutation (1.17 (1.00-1.36); P=0.053). In contrast, higher AFR ancestry (relative to EUR) was associated with increased odds of ACVR1B (OR (95% CI)=1.27 (1.02-1.58); P=0.033) or NRAS mutations (1.22 (1.00-1.47); P=0.047) and decreased odds of an FBXW7 mutation (0.87 (0.77-0.98); P=0.023). Our findings from the largest study of CRC somatic landscapes in HL provide early evidence of mutation frequency differences in driver genes associated with genetic ancestry. Our ongoing efforts to expand LC3 will inform the development of ancestry-tailored treatment strategies to benefit diverse populations. Citation Format: Marco Matejcic, Jamie K. Teer, Hannah J. Hoehn, Zhihua Chen, Diana B. Diaz, Nathalie Nguyen, Douglas Cress, Estrella Carballido, Jason Fleming, Domenico Coppola, Mariana C. Stern, Brooke L. Fridley, Jane C. Figueiredo, Stephanie L. Schmit. Genetic ancestry and somatic mutational frequencies in colorectal cancer: Findings from the Latino Colorectal Cancer Consortium [abstract]. In: Proceedings of the Annual Meeting of the American Association for Cancer Research 2020; 2020 Apr 27-28 and Jun 22-24. Philadelphia (PA): AACR; Cancer Res 2020;80(16 Suppl):Abstract nr 1192.

TSLP and IL-7R Variants Are Associated with Persistent Atopic Dermatitis

TSLP and IL-7R Variants Are Associated with Persistent Atopic Dermatitis

Gene testing for osteonecrosis of the femoral head in systemic lupus erythematosus using targeted next-generation sequencing: A pilot study.

BACKGROUNDPrevious publications indicated that genetic predisposition might play important roles in the onset of osteonecrosis of the femoral head (ONFH) in systemic lupus erythematosus (SLE). Some gene loci such as complement C3d receptor 2 (CR2), nitric oxide synthase 3 (NOS3), collagen type II alpha 1 chain (COL2A1), protein tyrosine phosphatase non-receptor type 22 (PTPN22), and transient receptor potential cation channel subfamily V member 4 (TRPV4) were reported to be involved in this process.AIMTo investigate whether the risk of ONFH in SLE is associated with single nucleotide variations (SNVs) in these five genes.METHODSSNVs in the CR2, NOS3, COL2A1, PTPN22, and TRPV4 genes were examined by using FastTarget and Illumina Miseq sequencing technologies in 49 cases of SLE with ONFH. Burrows–wheeler aligner was used to align the sequencing reads to hg19, and GATK and Varscan programs were used to perform SNV calling. PolyPhen-2, SIFT, and MutationTaster were used to assess the functional effects of non-synonymous SNVs.RESULTSSix of the 49 patients were confirmed to have low frequency SNVs, including one patient with SNVs in NOS3 (exon 6: c.814G>A: p.E272K and exon 7: c.814G>A: p.E272K.), four in COL2A1 (rs41263847: exon 29: c.1913C>T: p.T638I, exon 28: c.1706C>T: p.T569I, and rs371445823: exon 8: c.580G>A: p.A194T, exon 7: c.373G>A: p.A125T), and one in CR2 (rs45573035: exon 2: c.200C>G: p.T67S).CONCLUSIONThe onset of ONFH in SLE might be associated with the identified SNVs in NOS3, COL2A1, and CR2.

Abstract B081: Common copy number aberrations in breast cancer in Latinas

Abstract Background: Latinos represent the largest and fastest-growing minority population in the US; breast cancer is the most common cancer and causes the most cancer deaths in this population. Copy number amplifications and deletions are an important determinant of the biology of breast tumors and, in some cases, may help to guide treatment. However, little is known about the copy number profile of breast tumors from Latinas. For example, in The Cancer Genome Atlas (TCGA), one of the largest publicly available tumor mutation datasets, there are data on only 31 Latina (out of a total of &amp;gt;1000) breast cancer cases. Therefore, we used whole exome sequencing on matched tumor/normal pairs in 146 tumors from 142 women, to investigate copy number aberrations in breast tumors from Latinas. Methods: We enrolled 142 Latinas with invasive breast cancer and obtained blood and tumor tissue (formalin-fixed paraffin embedded). We performed whole exome sequencing of 146 pairs of tumor (somatic) and normal (germline) samples resulting in 142 tumor-normal pairs for analysis. Target coverage for normal was ~30X and for tumor was ~100X. Sequence data were aligned using Burrows-Wheeler Aligner, and copy number aberrations were called using CNVkit. We estimated genetic ancestry from the germline genotype data using ADMIXTURE. Results: Age at diagnosis ranged from 31 to 75 years with a median age of 48 years. Histologically, 83% were estrogen-receptor positive, 71 % were progesterone-receptor positive, and 17% were human epidermal growth factor receptor positive; 87% were Stage 1 or 2 at diagnosis. The mean genetic ancestry in our sample was ~52.3% European, ~41.6% Indigenous American, and ~6.2% African. Large copy number amplifications were detected mostly commonly at 1q and 8q, and large deletions were detected at 11q, 16q and 17p. Genes commonly gained/amplified included MYC (43%), FGFR1 (19.2%), CCND1 (18.0%), and ERRB2 (14.4%). Genes commonly deleted in at least one chromosome include TP53, MAP2K4, BRCA1, PP2R2A, CHEK2, and PALB2. Summary: Breast tumors from Latinas display similar rates of large chromosomal copy number gains and losses at common positions and similar rates of gene-specific copy number amplifications and deletions compared non-Latina European ancestry women. Citation Format: Elad Ziv, Daniel Schmolze, Donglei Hu, Aaron Adamson, Shu Tao, Charleen Adams, Linda Steele, Scott Huntsman, Jeffrey Weitzel, Jung Byun, Kevin Gardner, Eliseo Perez-Stable, Anna Napoles-Springer, Susan Neuhausen. Common copy number aberrations in breast cancer in Latinas [abstract]. In: Proceedings of the Twelfth AACR Conference on the Science of Cancer Health Disparities in Racial/Ethnic Minorities and the Medically Underserved; 2019 Sep 20-23; San Francisco, CA. Philadelphia (PA): AACR; Cancer Epidemiol Biomarkers Prev 2020;29(6 Suppl_2):Abstract nr B081.

Abstract B054: Analysis of a cancer gene expression and next-generation sequencing dataset representing hispanic predominant South Florida population

Abstract People of different races and ethnicities have different likelihoods of being diagnosed with certain types of cancer and respond differently to therapeutic agents. However, genome-wide association studies of cancer have typically assumed fixed genetic effects across ethnicities, and rarely compared and contrasted findings across ethnic groups, especially the Hispanic population. Baptist Health South Florida enrolled more than 3,000 patients into the Total Cancer Care Protocol, a prospective longitudinal outcomes study designed to bank tissues and clinical information in order to allow scientists and clinicians to bring cancer treatment to a new level. Tissue samples were snap-frozen within 15 minutes of surgical removal, macrodissected to ≥85% tumor purity, and quantified for the percent of malignancy, cellularity, stroma, normalcy, and necrosis. Longitudinal clinical and pathologic data were extracted from patients' electronic medical records to annotate the biospecimens. We analyzed gene expression and sequencing data from 443 cancer patients enrolled in this study whose tumors were molecularly profiled. All the cases had gene expression data, and 32% (n=140) also had next-generation sequencing data. Most common primary cancers were breast cancer (44.2%, n=196), followed by large bowel (18.9%, n=84), lung (15.8%, n=70), and uterine (9.5%, n=42) cancer. The uniqueness of this data is the distinctive racial and ethnic distribution of the patients; the majority of them were Hispanic (51.7%, n=229) specifically from Cuban, Mexican, Puerto Rican, Central American, and South American populations, followed by whites (36.3%, n=161), blacks (6.1%, n=27), other racial/ethnic groups (5.0%, n=22) and unknown (1.0%, n=4). Microarrays, across all sites of origin, were normalized using IRON against the median sample. An RNA quality-related technical artifact was observed and corrected by subtracting the 1st principal component of a partial least squares (PLS) model trained against the RNA integrity number (RIN), a measure of RNA quality. All samples were then extracted from this master normalized quality-corrected dataset and gene expression analysis was performed. For sequencing data, reads were aligned to the human reference genome (hs37d5) using the Burrows-Wheeler Aligner (BWA). Duplicate reads were marked with Picard-Tools. Indel realignment and base quality score recalibration were performed with GATK. Variations observed among ethnic and racial groups for each primary cancer are described in this representative South Florida population. Citation Format: Zuanel Diaz, Arpit Mehta, Zasha Pou, Muni B. Rubens, Don Parris, Miguel Villalona-Calero. Analysis of a cancer gene expression and next-generation sequencing dataset representing hispanic predominant South Florida population [abstract]. In: Proceedings of the Eleventh AACR Conference on the Science of Cancer Health Disparities in Racial/Ethnic Minorities and the Medically Underserved; 2018 Nov 2-5; New Orleans, LA. Philadelphia (PA): AACR; Cancer Epidemiol Biomarkers Prev 2020;29(6 Suppl):Abstract nr B054.

The frequency of PTEN germline mutations in Chinese breast cancer patients: The PTEN gene may not be closely associated with breast cancer in the Chinese population.

PTEN is a tumour suppressor gene that has been proven to be related to breast cancer incidence and tumour progression. The aim of this study was to investigate the frequency of PTEN mutations in breast carcinomas in China and the relationships of PTEN mutations with clinicopathological parameters and clinical outcomes. Trimmomatic, Burrows-Wheeler Aligner (BWA), ANNOVAR, SAMtools, and Sanger sequencing were used to analyse PTEN mutations and identify variants in Chinese breast cancer. The frequency of PTEN mutations and the relationships of PTEN mutations with clinicopathological parameters and clinical outcomes were evaluated in breast carcinomas in China. The rate of PTEN germline mutation was 0.23% (n=9) among 3955 unselected primary breast cancer patients. Of these 9 patients, 2 carried pathogenic mutations, and both were identified as having infiltrative carcinoma. One patient had a family history. The other 7 patients carried only PTEN germline variants that were not identified as pathogenic mutations. We studied the frequency of PTEN germline mutations in a sequential cohort of Chinese breast carcinoma patients. Based on these data, we hypothesize that the germline mutation of the PTEN gene is not closely related to the occurrence of breast cancer in the Chinese population. In the clinic, the PTEN germline mutation cannot be used as the basis for the detection of breast cancer.