Brown Lesions Research Articles

Analysis of Reflectance Confocal Microscopy and Dermoscopic Imaging Features in Diagnosis and Treatment Evaluation of Extramammary Paget’s Disease: A Single-Center Retrospective Study

Objective: Extramammary Paget’s disease (EMPD) is often misdiagnosed as chronic dermatitis or eczema of the scrotum because of its clinical manifestations, leading to delayed diagnosis and treatment. Reflectance confocal microscopy (RCM) and dermoscopy are widely used in clinical practice, enabling early diagnosis and treatment assessment of skin lesions, particularly skin tumors. This study aimed to summarize the RCM and dermoscopic features of EMPD and evaluate treatment outcomes. Methods: We conducted a retrospective analysis of 104 skin lesions from 34 patients diagnosed with EMPD, confirmed through histopathological examination. These patients were treated at our outpatient clinic between January 2022 and December 2023. The analysis focused on typical changes, such as blood vessel patterns and background color under dermoscopy, as well as cellular morphology under RCM. Count data were presented as constituent ratios. Results: Among the 34 patients, 28 were male and 6 were female, and 104 skin lesions were identified. The lesions were classified into three types: 36 red patches, 41 dark red erosive patches, and 27 brown pigmented patches. Dermoscopic examination of EMPD revealed characteristic features, including milky white globules (90.4%, 94/104), irregular shiny white streaks (91.3%, 95/104), dotted blood vessels (91.3%, 95/104), and glomerular-like vessels (88.5%, 92/104). RCM demonstrated epidermal structural disorganization (100%, 104/100), vacuolated cells in the epidermis (94.2%, 98/104), and Paget cells, either scattered or clustered (88.5%, 92/104). The red macular lesions predominantly contained isolated vacuolated cells in the epidermis, the dark red erosive lesions exhibited Paget cell nests in the basal layer, and the brown pigmented lesions contained numerous dendritic cells. These findings are crucial for clinical assessment, ensuring complete tumor removal, and guiding postoperative follow-up. Conclusion: This study identified characteristic dermoscopic and RCM features in patients with EMPD, providing a foundation for non-invasive auxiliary diagnosis. These features facilitate earlier diagnosis and treatment. Additionally, RCM characteristics of different lesion morphologies can help physicians more accurately assess surgical margins, leading to more precise surgical treatment options.

First report of leaf spot disease caused by Fusarium asiaticum on Lonicera caerulea L. in Heilongjiang Province, China.

Heilongjiang is the largest province with the small, cultivated fruit plant, blue honeysuckle (Lonicera caerulea L.), in China (Sun et al. 2024). Between September 2022 and September 2023, a leaf spot disease was observed on about 10 percent of blue honeysuckles of the 'Lanjingling' cultivar grown in a 6.66-ha field in Mudanjiang (129.38°E, 44.59°N), Heilongjiang Province, China. The typical symptoms include a few small brown sunken leaf spots (approximately 2 mm) in the fruiting stage that gradually expand into larger brown sunken lesions (approximately 10 mm) in the senescence stage (Fig. S1). Small 3-4-mm segments of infected tissue from 100 randomly selected leaf samples with typical symptoms were surface sterilized with 75% ethanol and 5% sodium hypochlorite, rinsed in sterile distilled water, and transferred to 9-cm Petri dishes containing potato dextrose agar (PDA) after drying. Finally, 10 isolated fungi were obtained through single-spore culture on PDA, and their conidia displayed a morphology consistent with Fusarium spp. (Zheng et al. 2023), and no other fungi were isolated. The fungal colonies on PDA were pink to dark red with fluffy aerial mycelium and pigmentation (Fig. S2). Microconidia were not observed, and the macroconidia of fungi had 2 to 6 septa, which were slender, sickle-shaped to nearly curved, with an average size of 38.83 (21.30 to 55.20) × 3.87 (2.70 to 6.60) μm (n = 50) on carnation leaf agar (Fig. S3). Genomic DNA was extracted from the representative isolate LD-245 for molecular verification, and PCR amplification was performed with ITS1/ITS4 (White et al. 1990), RPB2-5F2/RPB2-7CR (Liu et al. 1999), and EFl/EF2 (O'Donnell et al. 1998) primers. Sequences of LD-245 ITS (OR565903), RPB2 (OR584061), and TEF (PP965657) revealed 99 to 100% (494/494, 722/726, and 654/654) of identity with Fusarium asiaticum (MT322117, MH582121, and MT330257). Phylogenetic tree was constructed based on the concatenated sequences of ITS, RPB2, and TEF genes, and LD-245 was clustered with F. asiaticum (Fig. S4, Table S1). Therefore, based on the morphological characteristics and molecular phylogeny, LD-245 was identified as F. asiaticum. Six two-year-old healthy plants of the 'Lanjingling' cultivar were selected for a pathogenicity test. Three plants were inoculated with LD-245 conidial suspension (1 × 106 spores/ml) or with sterile water as an experimental control. All plants were cultured in a greenhouse (28℃, 75% relative humidity, 12 h light and dark cycle), and each experiment was replicated three times. Typical leaf spot symptoms were observed on inoculated leaves after 10 days (Fig. S5), whereas no symptoms were detected on water-treated leaves. The pathogens re-isolated from infected leaves displayed the same morphological and molecular traits as the initial isolate, and were again identified as F. asiaticum, confirming Koch's postulate. F. asiaticum was previously reported on giant elephant's ear (Alocasia macrorrhizos) (Zheng et al. 2023), causing leaf spot disease in China. This study is the first report of blue honeysuckle leaf spot disease caused by F. asiaticum in China. China has the largest blue honeysuckle cultivation area globally, and the production of blue honeysuckle with horticultural value is important for growers (Sun et al. 2024). Therefore, we hope researchers can develop efficient measures to manage emerging plant diseases in the future.

First report of leaf blight of water chestnut (Trapa natans L.) caused by Sclerotium hydrophilum in central China.

Trapa natans L., or water chestnut, is a currently globally distributed aquatic plant. The Yangtze River basin in China, a site origin of water chestnut (Fan et al., 2022), has extensive cultivation as a vegetable. In June 2021, a survey at the National Aquatic Vegetable Resource Garden in Wuhan, Hubei, China, revealed browning and wilting of water chestnut plants, with abundant white mycelia and brown to black sclerotia on leaves, indicative of southern blight (Sclerotium rolfsii). Field disease incidence a 1 ha area reached 70%, reducing fruit yield by 50%. About 10% of diseased plants showed blackening and rot from petioles to leaves. White sclerotial primordia and small brown to black sclerotia formed on the plant surfaces. By late August, symptoms exceeded 60%. To identify the pathogen, isolations were made from 243 sclerotial samples using 75% alcohol to disinfect, rinsed three times with water, and then incubated on potato dextrose agar (PDA) at 25℃. A total of 129 isolates were obtained, most of which exhibited characteristics of S. rolfsii. However, 21 isolates had sclerotia significantly smaller than those of S. rolfsii (1 to 1.5 mm in diameter). These isolates, cultured on PDA, produced abundant fluffy white aerial hyphae, 3 to 6 μm wide. Optimal mycelium growth was between 25 °C to 30 °C, with an average daily rate of 10 mm. White to light brown sclerotia appeared after 5 days and turned black within 10 to 14 days, averaging 0.34 mm in diameter (n=50). Some isolates produced a light brown pigment. These traits matched the description of S. hydrophilum (Bashyal et al. 2021). Isolates 221 and 238 were selected for molecular identification, with genomic DNA extracted from mycelia using the CTAB method. PCR amplification was conducted using ITS1/ITS4 and NS1/NS6 primers to target the internal transcribed spacer (ITS) and the small subunit ribosomal RNA gene (ssrRNA). Sequence analysis showed that the ITS sequence of isolate 221 (GenBank Acc. No. OR512512) had 99.84% sequence identity with S. hydrophilum Msh6 (GenBank Acc. No. FJ595946), and isolate 238 (GenBank Acc. No. PP035993) had 99.72% identity with S. hydrophilum Whcc-4 (GenBank Acc. No. PP035994). The ssrRNA sequences of both isolates (GenBank Acc. No. PP237261) had 99.69% identity with S. hydrophilum strain Hbq001 (GenBank Acc. No. KY995575), confirming their identification as S. hydrophilum. To assess pathogenicity, 16 water chestnut plants (cultivar Jia-yu Ling) at the rosette stage were placed individually in 32 cm diameter, 10 cm deep containers with fresh water. Eight plants were inoculated with 50 mature sclerotia from PDA cultures of isolates 221 and 238, and incubated at 25 °C for 14 days, with four plants per isolate. The remaining eight plants served as controls. Containers were covered to maintain 100% relative humidity at 25 °C to 32 °C for 3 days. This procedure was repeated twice. After 7 days, inoculated plants developed dark brown lesions on petioles that spread to leaves by 15 days post-inoculation. Fungi isolated from diseased leaves resembled isolates 221 and 238, fulfilling Koch's postulates. S. hydrophilum infecting at least 19 genera of plants, including rice (Zhong et al. 2018), wild rice, water lily (Kernkamp et al. 1977) and watershield (Fu et al. 2024). This is the first report of S. hydrophilum infecting water chestnut (T. natans) in central China, identifying it as a co-pathogen with S. rolfsii. Their combined presence may heighten plant mortality and threaten water chestnut cultivation.

First report of leaf blight of Avena strigosa caused by Pyrenophora avenicola in Japan.

Black oat (Avena strigosa Schreb.) is used as a cereal crop, forage crop or green manure in temperate regions. In Japan, it is mainly cultivated in Hokkaido island and, because of the vigorous initial growth and ability to suppress the proliferation of plant pathogenic nematodes (Uesugi et al. 2018), its use is recently increasing. In November 2021, a leaf spot and blight disease was observed in the grass cultivated in Kitahiroshima city (N43°0, E141°31). At first, blackish brown spindle-shaped or elliptical lesions, about 3 to 5 × 1 to 2 mm were formed on leaves, and they expanded by forming yellowish-brown halos around them, eventually resulting in leaf blight later on (Fig.1), damaging 5-10 % of leaf area, varied by cultivar. The lesions were excised, surface-sterilized, and incubated on water agar under near-UV light. Three single-spore isolates of Pyrenophora-like fungus were obtained from the lesions and deposited at the NIAS Genebank, Japan (https://www.gene.affrc.go.jp/index_en.php) as MAFF511692, 511693 and 511694. The sequences of ribosomal RNA gene (rDNA) and its internal transcribed spacer (ITS), and the gpd sequences of the isolates were analyzed as described by Marin-Felix et al. 2019. The rDNA-ITS sequences (GenBank accession no. LC769170, LC769171 and LC769172) of the isolates matched with that of the ex-type strain of Pyrenophora avenicola (MK539972) isolated from Avena seed. The sequences of the gpd (accession no. LC795722, LC795723 and LC795724) matched well with that of the ex-type strain (MK540180). Conidiophores of the isolates were septate, straight or flexuous, pale brown to olivaceous brown, 81.4 to 125.7 × 4.2 to 6.5 (ave. 106.4×5.7µm, n=50) µm, with hyaline vegetative hyphae (Fig.2). Conidia were slightly verrucose, cylindrical to obclavate, pale brown to olivaceous brown, 42.2 to 78.5 × 9.0 to 13.3 µm (ave. 56.9 ×10.4µm, n =50) and 2 to 7 distoseptate. This description overlap with the original description of P. avenicolai (Marin-Felix et al. 2019) and the leaf spot pathogen of Avena sativa reported in China (Chen et al. 2022). The fungus was identified as P. avenicola on the basis of morphology and molecular phylogenetic analysis. To produce inoculum, the isolate MAFF511692 was grown on V8 juice agar at 25°C under near-UV light for 7 days. Five plants each of cv. 'Soil saver', 'New oats' of A. strigosa (Kaneko seeds co.) and 'New almighty' of A. sativa (Snow brand seed co.) were grown in a greenhouse for approximately 14 days and then inoculated by atomizing them with the conidial suspension (104 conidia/ml) at the five-leaf stage. Five plants of each cultivar sprayed with sterilized distilled water served as the control. Inoculated plants were covered with plastic bags for 24 h at 25°C. After 5 days, blackish brown elliptical lesions developed on the leaves of all inoculated plants of both cultivars of A. strigosa (Fig. 3) and A. sativa, implying broad pathogenicity of the fungus to species and cultivars of Avena plants. Halo was not observed, maybe due to fewer stress in the greenhouse environment. Controls remained asymptomatic. The produced lesions were incubated as described above and the reisolated fungus was identified as P. avenicola based on the morphology, confirming Koch's postulates. To our knowledge, this is the first report of leaf blight caused by P. avenicola on black oat in Japan.

Anthracnose Caused by Colletotrichum spaethianum on Polygonatum odoratum var. pluriflorum in Korea.

Polygonatum odoratum var. pluriflorum (Miq.) Ohwi (Asparagaceae), commonly known as Lesser Solomon's seal, is a perennial herbaceous plant widely distributed in the temperate regions of the Northern Hemisphere. It is known for tea and contains various pharmacologically active compounds (Chang et al. 2007). In September 2021, previously unseen anthracnose was encountered on Polygonatum odoratum var. pluriflorum in Chuncheon (37°45'07''N; 127°47'45''E) and Wanju (35°38'47''N; 127°31'16''E), Korea, with a disease incidence of 20 to 30% of the inspected plants. The disease symptoms begin with leaf yellowing (chlorosis) along the margins, progressing toward the central part of the leaf. As the disease progressed, brown necrotic lesions developed, covered with small, dark dots, indicating the presence of conidiomata of Colletotrichum. The disease often led to leaf blight, resulting in concentric lesions of a periodic and concentric arrangement of conidiomata, forming circular patterns within the affected tissue. It expanded rapidly during the rainy season producing water-soaked lesions but nearly slowed down during the dry season, leaving the plant with a ragged appearance. Monoconidial isolates were obtained from five fresh samples collected in Wanju, of which a representative isolate was deposited in the Korean Agricultural Culture Collection (KACC410442), and the dried specimen was housed at the herbarium of Jeonbuk National University (JBNU0135). Morphological characteristics of the fungus were examined with fresh and naturally infected leaves. Setae (n = 30) were dark brown to nearly blackish, 45 to 172 um long, 4.1 to 6.1 µm wide at the base, and becoming narrower upwards, apex pointed, 2 to 4-septate. Conidia were 1-celled, sometimes uniseptate before germination, slightly curved, with an acute or rounded apex and a more or less truncate base, and 11.4 to 23.2 × 3.1 to 4.2 µm. Appressoria were single or in groups, dark brown, lobate, irregularly shaped, and 6.0 to 11.9 × 7.0 to 14.8 µm. Two-week-old colonies grown on PDA at 25 ℃ reached 30-35 mm in diam., initially white, turning gray with age, with cottony aerial mycelia. These morphological characteristics were in good agreement with those of C. spaethianum (Damm et al. 2009; Liu et al. 2020). To confirm the morphology-based determination, genomic DNA was extracted from KACC410442, and multi-loci sequences of the internal transcribed spacer region (ITS) rDNA, glyceraldehyde 3-phosphate dehydrogenase (GAPDH), actin (actA), chitin synthase (CHS1), histone (HIS3) and tubulin (TUB2) genes were determined, as outlined by Cannon et al. (2012) and Damm et al. (2009). The resulting sequences obtained in this study were registered to GenBank (PP739190 for ITS, PP741985 for GAPDH, PP741986 for actA, PP741987 for CHS1, PP741988 for HIS3, and PP741989 for TUB2) and compared with other sequences on GenBank using the BLASTn search tool. The results showed 100% identity to other C. spaethianum sequences (e.g., MT611068 for ITS, MN400659 for actA, OP965007 for CHS1, OR060963 for GAPDH, PP480643 for HIS3, and OQ613727 for TUB2). In a maximum parsimony tree, the Korean isolate formed a well-supported clade (100% bootstrap value) with reference sequences of C. spaethianum. Pathogenicity was tested by spraying a conidial suspension (1×104 conidia/ml) from a two-week-old culture onto ten leaves of three potted plants, without wounding. Ten water-sprayed leaves were served as controls. The plants were maintained in a dew chamber and later moved to a greenhouse at 25 to 30 °C. After two weeks, all inoculated plants developed anthracnose symptoms, while the control plants remained symptomless. The fungus isolated from the inoculated plants was morphologically identical to that initially observed, fulfilling Koch's postulates. C. spaethianum has been known on various plant species, but mostly on the Asparagaceae, including Anemarrhena (Okorley et al. 2019), Hosta (Damm et al. 2009; Cheon and Jeon 2016), and Polygonatum (Liu et al. 2020; Ma et al. 2021). To our knowledge, this is the first report of anthracnose caused by C. spaethianum on P. odoratum var. pluriflorum in Korea, highlighting the continuous need for disease management and control in the cultivation of this plant.

Novel characterisation of Curvularia geniculata associated with leaf blight on Costus igneus in India

Costus igneus Nak, commonly referred as insulin plant or spiral flag, is a perennial herb belonging to the family Costaceae. Owing to its ability to regulate the blood sugar level, it is considered as a boon plant for diabetic patients, hence popularly known as the “sugar plant”. Although few foliar diseases have been documented on C. igneus, they generally occur in minor frequency under Indian conditions. However, in May 2022, a moderate to severe incidence of leaf blight was observed on insulin plants at University of Agricultural Sciences, GKVK, Bangalore, and nearby medicinal gardens. The affected leaves exhibited light brown lesions coalesced to form papery blight, gradually leading to complete drying of leaves. The current study aimed to identify, characterize, and document the fungal pathogen responsible for the disease, with a focus on its morphological, molecular, and biological characteristics to ensure accurate identification. Additionally, the study sought to determine optimal conditions for pathogen growth and sporulation to support the development of effective disease management strategies. The associated fungus was isolated, purified and identified as Curvularia geniculata through morphological and multigene phylogenetic analysis, using internal transcribed spacer (ITS) and large sub unit (LSU) regions of rDNA, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene. Biological characterization revealed that cornmeal agar (CMA) at 30 °C and pH of 7 were ideal for better growth and abundant sporulation. These findings, highlighting the emergence of C. geniculata as a novel fungal pathogen infecting C. igneus in India, are crucial for developing effective disease management strategies to safeguard the medicinal properties of the plant.

First report of Trichoderma roseum causing tea leaf rot in China.

Tea (Camellia sinensis) is consumed worldwide for its numerous benefits and China lead the world production. In March 2023, leaf spots were observed on approximately 10% of tea plants in a 50-ha commercial tea plantation in Menghai (21°46'13"N, 100°30'6"E), Yunnan, China. Initial symptoms appeared as small spots, which progressively expanded and spread over the entire leaf surface. Subsequently, pale pink mold layers developed from the lesions (Fig. S1). To isolate the pathogen, small leaf pieces (3 × 3 mm) were cut from the margins of the lesions, sterilized with 75% ethanol for 30 sec and 0.5% NaClO for another 30 sec, and rinsed three times with sterile water. The pieces were placed on acidified potato dextrose agar (PDA) plates and incubated in darkness at 28°C. A total of 15 fungal isolates with identical morphologies were collected. The colonies appeared pale pink with white mycelia initially then turned orange-pink at the center and light white at the edges. After 10-15 days, exhibiting a powdery texture and concentric rings with uniform edges. Conidia were found at the apex peduncle and were inverted pear-shaped or oval, either non-septate (15.3 ± 2 × 7.8 ± 1.8 μm in size, n = 60) or septate, with a slightly constricted spore base featuring papillary projecvtions (14.8 ± 1.5 × 7.4 ± 0.7 μm in size, n = 60). The morphology closely resembled Trichoderma roseum (Oh et al. 2014). To confirm the species, the strain CYB5 was selected for identification by sequencing the ribosomal internal transcribed spacer (ITS) and large subunit (LSU) genes using polymerase chain reaction (PCR) (White et al.1990). The ITS (GenBank accession OR889657) and LSU (PQ270526) gene sequences exhibited 98% similarity with the Trichoderma roseum sequence KP317992 from NCBI database. A phylogenetic tree was constructed using MEGA 11 (Felsenstein 1981) based on the concatenated sequences (ITS and LSU) of the strain CYB5 and reference strains (Fig. S2). The analysis confirmed that CYB5 is T. roseum (Inácio et al. 2011). Pathogenicity tests were conducted on detached healthy tea leaves placed on wet filter paper in petri dishes. Micro-wounds were made on leaves using a sterilized needle, followed by inoculation with a 6-mm plug of CYB5. Control leaves were inoculates with fungus-free agar disks. The dishes were incubated at 25°C in the dark for 7 days. The leaves inoculated with CYB5 developed reddish brown to dark brown lesions around the inoculated sites, while control leaves remained asymptomatic. The fungus was reisolated from the lesion, and the isolates were morphologically identical to the original cultures. A second pathogenicity test was conducted on potted tea plants of the cultivar 'Yunkang No. 10.' Three plants scratched with a needle and three non-wounded plants were inoculated by spraying 20 ml of a spore suspension (105 spores/ml) of CYB5. Plants sprayed with sterile water served as controls. All plants were maintained in a growth chamber at 28°C, and 70% relative humidity. The lesions developed three days post-inoculation, and typical symptoms appeared after 10 days on spore-inoculated plants only. T. roseum was reisolated and reidentified based on the morphology and molecular analyses, thus fulfilling Koch's postulates. To our best knowledge, this is the first report of T. roseum causing tea leaf rot in China.

First Report of Exserohilum pedicellatum Causing Root Rot of Wheat (Triticum aestivum L.) in Uzbekistan.

Wheat is the major staple food in Uzbekistan, and it occupies the largest harvested area (1,3 million hectares) in the country (USDA 2024). In June 2023, a survey was conducted to investigate root pathogens in wheat growing fields of Kaspi district in the Kashkadarya region of Uzbekistan. A total of 24 symptomatic plants with root rot and dark brown root lesions were collected from focal lesions in 4 different fields. From each plant, roots were excised and surface sterilized with 1% sodium hypochlorite for four minutes, then rinsed three times with sterile distilled water. Following surface sterilization, the excised roots were air dried in a laminar flow on sterile tissue sheets, rinsed twice with sterile distilled water, and then cut into 1 cm lengths segments (5 segments per one plant). The root pieces were cultured at 24°C for 4 days with a 12-hour photoperiod on potato dextrose agar supplemented with streptomycin (0.1 g/liter) and chloramphenicol (0.05 g/liter). From 24 symptomatic plants a 5 dematiaceous hyphomycete monoconidial pure isolates with abundant conidia were isolated. The conidia (n = 60) were mostly fusiform, straight, four to seven distoseptate, olivaceous brown to dark brown, and measured 51 to 88.7 × 17.9 to 25.4 μm (average 69.7 × 21.57 μm). Based on morphological characteristics the fungus was identified as E. pedicellatum according to Sivanesan (1987) and Hernandez-Restrepo et al. (2018). From five isolated monoconidial colonies, one has been chosen for molecular-genetic identification. Total DNA was extracted from it using PureLink™ Genomic DNA Mini Kit (Thermo Fisher Scientific, Waltham, MA, USA). For more informative analysis two loci, he translation elongation factor 1-alpha (tef1) and beta-tubulin (tub) genes were PCR-amplified and sequenced using gene specific primers: EF-1F （5'-CGGTGGTATCGACAAGCGT-3'), EF-2R （5'-AGCATGTTGTCGCCGTTGAAG-3'）designed by Primer3web v4.1.0 software (Untergasser et al. 2012), and Bt2a （5'- GGTAACCAAATCGGTGCTGCTTTC, Bt2b （5'-ACCCTCAGTGTAGTGACCCTTGGC -3'）described by Glass and Donaldson (1995), respectively. The resulting sequences were deposited in NCBI database under accession number PQ095881 and PQ095882. After BLAST analysis they showed highest similarity with the corresponding sequences of tef1 JQ672389 (100% identity, from 287 bp 287 bp are matching) and tub JQ671941 (100% identity, from 273 bp 273 bp are matching) of BMP 0384 isolate of E. pedicellatum from USA. In the plant inoculations (pathogenicity test), three isolates of E. pedicellatum were evaluated. For the pathogenicity test, conidia were scraped from PDA plate, suspended in water, and mixed with sterile sand to obtain a density of 500 conidia/g. A total of 20 wheat seed (Grom variety) previously disinfected 2 min with 10% NaOCl, were sown in each plastic pot (14 cm x 4 cm, 2 seeds per pot) filled with the inoculated soil (5 pots) and with sterilized soil (5 pots) as a control. Plants were grown in a growth chamber with a 12-h photoperiod at 24°C for 4 weeks. Plants grown in inoculated soil displayed symptoms on their roots similar to those observed in the field-grown plants, whereas the roots of the control plants remained asymptomatic. The fungus was reisolated from the symptomatic roots and confirmed morphologically and molecular genetically as E. pedicellatum, fulfilling Koch's postulates. To the best of our knowledge this is the first report of E. pedicellatum on wheat in Uzbekistan.Since phylogenetic analysis of the GPEB-70 strain showed clustering with strains from USA and also taking into account intensification of globalization in agriculture, rising of global seeds market and increasing demand for high-yielding USA and Canadian wheat seeds in Central Asian farmers, we speculate that there may have been a recent introduction of E. pedicellatum from USA into Uzbekistan. Given that wheat is an important and popular staple food in Uzbekistan, further work would focus on developing efficient strategies to manage this root rot disease, the development of effective management strategies for this root rot disease would be the main focus of future research.

First Report of Colletotrichum siamense Causing Leaf Anthracnose on Jackfruit in Thailand.

Jackfruit (Artocarpus heterophyllus Lam.) is commonly grown in Thailand. In June 2023, leaf anthracnose on this plant was observed at a field in Chai Prakan District (19°42'24"N, 99°01'59"E), Chiang Mai Province, Thailand, with ~25% disease incidence in a 1000-m2 plantation area. The initial symptom had brown spots with a yellow halo, enlarged, elongated, 0.2 to 2 cm in diameter, irregular, sunken, brown, with a dark brown halo, and leaves withered and dried. Pale yellow conidiomata developed on the lesions in high humidity. Ten symptomatic leaves were used to isolate the fungal causal agents through a single spore isolation method (Tovar-Pedraza et al. 2020). Four fungal isolates (SDBR-CMU492 to SDBR-CMU495) with similar morphology were obtained. Colonies on potato dextrose agar (PDA) were 70 to 85 mm in diameter, white to grayish white with cottony mycelia, the reverse pale yellow after incubation at 25°C for 1 week. All isolates produced asexual structures. Setae were brown with 1 to 3 septa, 40 to 100 × 2.2 to 4.0 µm, a cylindrical base, and acuminate tip. Conidiophores were hyaline to pale brown, septate, and branched. Conidiogenous cells were hyaline to pale brown, cylindrical to ampulliform, 7.4 to 27.2 × 2.0 to 4.5 µm. Conidia were one celled, hyaline, smooth walled, cylindrical, ends rounded, guttulate, 11.1 to 15.7 × 3.4 to 6.1 µm. Appressoria were dark brown to black, oval to irregular, 8.8 to 24.9 × 3.6 to 10 µm. Morphologically, all isolates resembled the Colletotrichum gloeosporioides species complex (Weir et al. 2012). The internal transcribed spacer (ITS) region, actin (act), β-tubulin (tub2), calmodulin (CAL), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) genes were amplified using primer pairs ITS5/ITS4, ACT-512F/ACT-783R, T1/T22, CL1C/CL2C, and GDF1/GDR1, respectively (White et al. 1990; Weir et al. 2012). Sequences were deposited in GenBank (ITS: PP068858, PP068859, PP446789, PP446790; act: PP079636, PP079637, PP460760, PP460761; tub2: PP079638, PP079639, PP460762, PP460763; CAL: PP079634, PP079635, PP460758, PP460759; GAPDH: PP079632, PP079633, PP460756, PP460757). Maximum likelihood phylogenetic analyses of the concatenated five genes identified all isolates as C. siamense. To pathogenicity test, the mature leaves of a healthy plant were surface disinfested using 0.1% NaClO for 3 min, rinsed three times with sterile water, and wounded. Conidia suspensions (15 µl of 1 × 106 conidia/ml) of each isolate grown on PDA at 25°C for 2 weeks were used to inoculate wounded and unwounded samples by the attached method. Control leaves were mock inoculated with sterile distilled water. Ten replications were conducted for each treatment and repeated twice. Plants were placed in a greenhouse at 25 to 30°C and 80 to 90% relative humidity. After 7 days, all inoculated leaves displayed brown lesions, while control leaves had no symptoms. Colletotrichum siamense was reisolated from inoculated tissues on PDA to complete Koch's postulates. Prior to this study, C. fructicola and C. gloeosporioides caused leaf anthracnose on jackfruit worldwide (Sangchote et al. 2003; Chitambar 2016). Leaf anthracnose on jackfruit caused by C. siamense has been reported from Australia (James et al. 2014) and Bazil (Borges et al. 2023). In Thailand, Bhunjun et al. (2019) reported that C. artocarpicola causes leaf anthracnose in jackfruit. Therefore, this is first report of C. siamense causing leaf anthracnose on jackfruit in Thailand. The finding will inform epidemiological investigations and future approaches to managing this disease.

First Report of Fusarium concentricum Causing Leaf Blight, Shoot Blight, Flower and Fruit Rot on Kadsura coccinea in China.

Kadsura coccinea (Lem.) A. C. Smith is a traditional medicinal plant grown in south China. Lignans and terpenoids extracted from the root, fruit and stem were found to have anti-proliferative, anti-HIV, anti-hepatitis, anti-oxidant, neuroprotective, and other pharmacological attributes for treating rheumatoid arthritis and gastroenteric et al. disorders (Yang et al., 2020). However, little is known about the biotic disorders of this evergreen climbing shrub. In surveys carried out in a 15- hectare -orchard located 23°59'55''N, 113°55'13''E, all K. coccinea plants were observed exhibiting an array of symptoms including leaf blight, shoot blight, flower rot and fruit rot from May to July of 2023, with disease incidences of 17% , 18%, 16% and 28%, respectively. A greyish -brown blight appeared predominantly on the leaf margins or tips. Light to dark brown lesions on the shoots, flower calyxes and fruits were slightly sunken, irregularly shaped, and watery, usually with white aerial mycelium. For pathogen isolation, infected tissues were cut into fragments of about 5 mm in diameter, surface sterilized with 75% ethanol for 15 s and 1% NaClO for 2 min, and then rinsed three times with sterilized distilled water. Filter paper-dried tissues were placed onto potato dextrose agar (PDA) and incubated at 28°C for 5 days. Seventy-one morphologically similar colonies were produced from 100 tissue fragments, with other tissues lacking colonies or with different colonies. Genomic DNA of 10 randomly selected isolates were extracted from 5-day-old pure cultures. Molecular characterization of the 10 subcultured strains was analyzed by sequencing three regions i.e. translation elongation factor 1-alpha (TEF-1), beta-tublin (TUB), and RNA polymerase Ⅱ second largest subunit (RPB2), amplified using primers EF1/EF2 (O'Donnell et al., 1998), T1/T22 (O'Donnell and Cigelnik 1997), and RPB2-5f2/RPB2-7cr (Liu et al. 1999). Maximum likelihood and Bayesian Inference analysis based on the dataset of the combined three sequences by MEGA 11.0 showed that nine strains were consistently identified as F. concentricum. The three sequences (OR632200, OR632199, and OR754282) of a representative strain (SGXF1) shared 99.42%, 99.62%, and 99.80% identity with those of the type strain CBS450. 97. The colonies were white to pale buff with serrated edges and sparse aerial mycelium that initially formed a loose, white cottony texture of 5-10 mm in height. After 7 d's culture at 26°C in an incubator with a photic door, dense and abundant fluffy reddish-white aerial mycelium covered the entire PDA medium of 9 cm-diameter, with alternating pale orange and reddish-grey concentric rings at center with diffusible pigments. Catenate microconidia were obovoid to fusoid-shaped, mostly 0-septate, with a flattened base, (10.98 ± 0.83) x (3.41 ± 0.15) μm (n=20), and were produced on both mono-and polyphialides, whereas macroconidia were curved and long, with a slightly beaked apical cell and a basal cell, mainly 3- to 5-septate, and (33.80 ± 0.81) x (4.31 ± 0.12) μm (n=20) in size. These morphological characteristics further indicates it to be F. concentritum (Nirenberg and O'Donnell, 1998; Xiao et al., 2023). To determine pathogenicity, three 1-y-old seedlings were wound inoculated by conidial suspension (1 × 106 conidia/mL) on different tissues and incubated at 25°C in a greenhouse with 10 replications. At 2 d after inoculation (DAI), the treated flowers gradually turned from fresh red and green to black at calyxes, with the black area then gradually expanding. At 6 DAI, part of the flowers turned black, accompanied by white mycelium and yellowish powdery spots. Similarly, leaves, stems, and fruits turned from green to dark brown at infection sites within 7 DAI. Black to brown, uneven necrotic areas, and reddish spots were observed under a dissecting microscope, with white mycelium attached at 6 DAI. The symptoms observed in lab were similar to those observed in the field, whereas three control plants remained asymptomatic. Fungal colonies identical to initial isolations were recovered from artificially infected tissues and confirmed to be F. concentricum again, thereby completing Koch's postulates. This report is the first to document F. concentricum causing disease on K. coccinea. Appropriate measures will be developed based on this study to protect this economically important plant in the field.

First Report of Botryosphaeria dothidea Causing Leaf Blight on Parrotia subaequalis in China.

Parrotia subaequalis is of great ornamental value due to its unique bark, featuring interesting textures and colors, and its large, striking galls. These characteristics make it a popular choice for bonsai cultivation. (Yan et al. 2022) . In July 2023, an outbreak of leaf blight was observed on 40, six-month-old P. subaequalis seedlings in Anqing, Anhui, China, with an incidence rate of 80%. In the early stages of infection, small brown spots appear on the leaf surface, which gradually become round or irregular and darken to a deep brown color. As the disease progresses, the affected areas expand from the leaf margins towards the center, causing the leaf surface to become concave, wilt, and necrotize. This resulted in restricted plant growth, and in severe cases, partial or complete plant death. For isolation, 30 tissue slices (5 × 5 mm) were taken from the leaves of 10 symptomatic seedlings and surface sterilized with 75% ethanol for 5 seconds, followed by five rinses with sterilized distilled water. After two days of dark incubation at 28°C, hyphal tips of fungi were transferred onto new potato dextrose agar (PDA) plates and incubated until conidia production. Six unidentified isolates with similar morphological characteristics were obtained. The colonies, initially white, darken to black after 7 to 10 days of incubation. They produced colorless, aseptate conidia that were oblong or fusiform, measuring 18-26 μm in length and 5-8 μm in width (n=50). The morphological characteristics of the isolates resembled those of Botryosphaeria (Udayanga et al. 2015) . Isolate IS2116-1 was further confirmed through molecular methods. The rDNA internal transcribed spacer (ITS) region, translation elongation factor 1-α (TEF1-α), and beta-tubulin (TUB2) genes were amplified and sequenced using the primers ITS1/ITS4 (White et al., 1990), EF1-728F/EF1-986R, and Bt2a/Bt2b (Ferreira et al., 2021; Carbone et al., 1999), respectively. BLAST analysis revealed that the ITS (OR958722) sequence was 100% similar to the B. dothidea isolate HZ5(MH329650.1), TEF1-a (PP214058) sequence was 100% similar to the B. dothidea strain JZB310220(ON890458.1), and strain TUB2 (PP214057) sequence was 99.78% similar to the B. dothidea strain L14 (KR260833.1). Maximum likelihood analyses were performed for the combined ITS、TUB2、TEF datasets using PhyloSuite v1.2.2, the resulting phylogenetic tree indicated that isolate IS2116-1 clustered together with Botryosphaeria dothidea in a clade with 97% bootstrap support(Zheng et al. 2020) . Pathogenicity tests were conducted on 3-6 month-old P. subaequalis seedlings (n = 5) grown in a greenhouse. A conidial suspension (106 spores/ml) collected from the isolates was sprayed onto P. subaequalis seedlings, while the control was treated with distilled water. All plants were maintained in a growth chamber at 28°C with a 12-h photoperiod. The experiment was conducted twice independently . After 20 days of inoculation, brownish lesions similar to those observed in the field appeared on the treated plants, while the noninoculated control plants remained symptomless. The pathogen was reisolated from the leaves of the obviously diseased seedlings and confirmed as B. dothidea through morphological and sequence analysis. No isolates were obtained from uninoculated control plants, thus fulfilling Koch's hypothesis. This report marks the first record of B. dothidea causing leaf blight in P. subaequalis. In light of the rarity of natural P. subaequalis populations, it is imperative to assess both the extent of disease spread and its economic impact. These insights are crucial for devising strategies to protect this endangered species from disease threats and to preserve its ecological significance.

First Report of Root Collar Canker Caused by Neoscytalidium dimidiatum on Jacaranda mimosifolia in China.

Jacaranda mimosifolia is widely cultivated as a garden ornamental tree. In July 2023, an unknown root collar canker of J. mimosifolia was discovered in green belts of Qingxiu District, Nanning, China, with a 8% incidence rate. Crowns of affected trees ranged from reddish brown leaves to deciduous or dead. Root collar tissue became necrotic matched by underbark dark brown lesions with irregular margins, and rotted at last. Six diseased plants distributed within 3000 m2 were choosed, and 24 root collar tissues were surface sterilized and placed on potato dextrose agar (PDA) plates to incubate at 28℃ for 3 to 5 days. Same colonies were consistently isolated from 18 tissues, and three isolates (M3-B1-1, M3-B1-2 and M3-B1-3) were purified for morphological and molecular determination. These isolates formed colonies with lush aerial mycelia rapidly, which covered a 90 mm plate in 72h. The colonies were initially white, then grayish-green to black. Arthrospores were colourless to light brown, short columnar, aseptate, truncate base, averaging 12.1±2.5 µm × 3.4±0.7 µm, sometimes formed arthric chains. Chlamydospores were dark brown, round or oval, aseptate, averaging 8.7±1.6 µm × 5.0±0.9 µm. Mature pycnidia and conidia produced for about 50 days on oatmeal agar medium (OMA), and conidia were colorless, oblong, aseptate, averaging 11.2±1.2 µm × 6.0±1.4 µm. These morphological characteristics were consistent with the description of Neoscytalidium dimidiatum (Penz.) Crous & Slippers (Crous et al. 2006). Genomic DNA was extracted from three isolates. The partial ITS region, TUB2 and TEF1-α genes were amplified (White et al., 1990; Glass and Donaldson 1995; Carbone and Kohn 1999). The sequences were deposited in GenBank (ITS: PP939650-PP939652; TUB2: PP942728-PP942730; TEF1-α: PP942731-PP942733). Blastn analysis revealed that ITS sequences of three isolates showed 99.8%, 100%, 100% identity (506 bp out of 507 bp, 507 bp out of 507 bp, 507 bp out of 507 bp) to N. dimidiatum C21 (KX447539), the TUB2 sequences showed 100% identity (436 bp out of 436 bp, 437 bp out of 437 bp, 437 bp out of 437 bp) to N.dimidiatum LNeo (ON099066), and the TEF1-α sequences showed 99.64% identity (276 bp out of 277 bp) to N.dimidiatum ARM230 (MK495384), respectively. Phylogenetic analysis based on concatenated ITS, TUB2 and TEF1-α sequences showed that three isolates were clustered into the same clade as N. dimidiatum. To fulfill Koch's postulates, pathogenicity of these isolates was tested on healthy two-year-old J. mimosifolia trees. Stem and root collar were wounded and placed mycelial plugs (8mm), and the inoculation sites were wrapped with parafilm or covered with nursery substrate to maintain the humidity. Four plants were inoculated with each isolate. As a control, four plants were inoculated with noncolonized PDA plugs. All treated plants were kept in a greenhouse at 28 ± 3°C and 70% relative humidity. Foliar blight and necrotic lesions around inoculation points were observed about 65 days after inoculation, and 50% of inoculated trees exhibited symptoms, whereas the control trees remained symptomless. Neoscytalidium dimidiatum was successfully reisolated from symptomatic tissue via morphological analysis. To our knowledge, this is the first report of root collar canker caused by N. dimidiatum on J. mimosifolia. Neoscytalidium dimidiatum has a wide range of hosts, including pitaya, pine, mulberry, pear, grape, locust tree (Luo et al. 2024). This finding will help in controlling of the disease epidemic.

First Report of Leaf Blight of Syringa oblata Caused by Botryosphaeria dothidea in China.

As an important landscaping plant, Syringa oblata is widely planted in northern China with high ornamental, medicinal, and edible value (Men et al. 2023). In September 2023, a new leaf blight disease on S. oblata was observed in Tianjin (39.0916°N, 117.1019°E), China. The onset of foliar symptoms was marked by the appearance of yellow-brown spots that originated from the tip and margin, subsequently evolving into irregularly shaped brown lesions. Finally, the lesions are distributed throughout the leaf surface, causing the leaf to wilt and seriously affecting photosynthesis. To identify the pathogen responsible for leaf blight of S. oblata, symptomatic leaves were collected and cut into square leaf blocks with a size of 0.3 cm², which were sterilized by immersion in 75% ethanol for 60 s and 5% NaClO for 30 s, and rinsed three times with sterile distilled water. The sterilized leaf pieces were then placed on potato dextrose agar (PDA) and incubated at 25 °C for 3-5 days. The peripheral hyphae of the fungal colony which developed from the infected tissues were isolated onto PDA plates. The fungal cultures on PDA plates were used for morphological observation and identification of the fungus. Colonies of B. dothidea on PDA medium were initially off-white, batting-shaped and gradually grayish-black. Aerial hyphae were well developed and could reach the tip of the petri dish. To induce sporulation, the hyphae were picked into medium containing sterilized pine needles. Conidia were found on pine needles after 30 d of incubation at 25°C. Conidia were hyaline, unicellular, oblong to spindle-shaped, and 17.5-23.0 µm in size × 6.1-8.5 µm(n=50). Based on these characteristics, the isolates were preliminarily identified as B. dothidea (Phillips et al. 2005). To provide additional evidence for the classification of the isolate, genomic DNA was extracted from the isolates of B. dothidea and used for Polymerase Chain Reaction (PCR). The internal transcribed spacer (ITS), glyceraldehyde-3-phosphate dehydrogenase (GPDH), and actin (ACT) were amplified with the primer pairs ITS1/ITS4, GDP1/GDP2, and ACT-512F/ACT-783R, respectively (Jiang et al. 2022). A BLAST search of sequences showed the ITS, GPDH, and ACT sequences had >99% identity with homologous sequences from B. dothidea isolates Bb158-4(HQ392696.1), PPO-46523(MG761771.1), and CMW7779 (AY972117.1), respectively. Phylogenetic analysis determined that the isolate was in the same clade position as B. dothidea, which confirmed the above morphological identification. To assess pathogenicity, the fungal cakes (6 mm diameter) were obtained from the edge of a fresh colony (cultured on a PDA plate for 7 days) using a sterile perforator. Ten surface-sterilized leaves of healthy S. oblata with uniform growth condition were collected and inoculated with fungal cakes after wounding. Ten leaves were inoculated with sterile PDA medium blocks as control. The test was repeated three times. All leaves were kept at 25°C and sterile H2O was sprayed daily to keep leaves surface moist. After five days, all vaccination sites showed lesions similar to those of the S. oblata diseased leaves in the field, while the controls were asymptomatic. B. dothidea was reisolated from symptomatic tissues, thus fulfilling Koch's postulates. B. dothidea is a member of Botryosphaeriaceae. Currently, B. dothidea infection of Syringa spp. plants has not been reported. However, in China, it has been reported to cause stem rot on Forsythia suspense (He et al. 2022) and leaf dieback on sweet osmanthus (Ling et al. 2010), demonstrating that B. dothidea can infect Oleaceae species. This study found that S. oblata could be infected by B. dothidea. To the best of our knowledge, this is the first report of B. dothidea causing leaf blight on S. oblata in China. Identifying the pathogen of S. oblata leaf blight is essential for the prevention and management of disease associated with S. oblata.

TREATMENT OF TRAUMATIC AMELOGENESIS IMPERFECTA THROUGH MICRO-ABRASION TECHNIQUE: A CASE REPORT

In recent decades, several ultra-conservative techniques have been employed for the treatment of amelogenesis imperfecta, primarily based on non-invasive procedures. In this article, we will shed light on the technique of microabrasion, its indications, advantages, and limitations. Subsequently, we will illustrate the steps of the technique with a clinical case. Finally, we will discuss the short-term and long-term outcomes. The microabrasion technique has proven effective as a non-invasive alternative among the array of proposed treatments for white and brown enamel lesions.

First Report of Rugonectria rugulosa Causing Dieback of Prunus salicina "Banbianhong" in China.

Banbianhong (Prunus salicina) is a valuable fruit crop cultivated in the southwestern regions of China for its high quality fruit and substantial economic benefits (Wang et al. 2021). In July 2023, dieback disease was observed in Banbianhong in Suijiang County, Zhaotong, Yunnan Province, with an incidence of up to 10%. The disease caused brownish nodules in the cortex of the infected plant, leading to dry cracking, and exposing grayish-brown xylem, which caused the plant to wither and die. Upon longitudinal cutting of twigs, lesions were evident and characterized by browning and necrosis of the cauline bundle and pith within the tissue. The diseased tissues were sectioned into 2 mm2 pieces and surface disinfected with 70% ethanol and 1% NaClO and rinsed with double distilled water. The tissue fragments were plated onto potato dextrose agar (PDA), and incubated for 7 days at 28°C. A total of six isolates were obtained, and two isolates (WG2-1 and WG2-3) were selected for morphological, molecular identification and pathogenicity testing. On PDA, the colony diameter of WG2-1 and WG2-3 were recorded as 5.50±0.56 mm/day and 6.08±0.37 mm/day, respectively. The microconidia of both isolates were zero-septate, smooth, greenish, subglobose to ellipsoidal, and measured 5 to 10 × 1.5 to 3 µm (n = 50) in size. However, macroconidia were not observed. The internal transcribed spacer rDNA (ITS) and β-tubulin 2 (TUB2) genes were amplified using the primer pairs ITS1/4 (White et al. 1989) and Bt2a/2b (Glass and Donaldson 1995). BLAST analysis of the obtained ITS sequences (accession Nos. PP581792) and TUB2 sequences (accession Nos. PP2815212) sequences showed 100% identity with Rugonectria rugulosa (accession nos. MG991753 for ITS and KM232007 for TUB2). Based on these characteristics, the isolates have been identified as R. rugulosa and have been deposited in the Agricultural Environment and Resource Research Institute plant pathogen lab at Yunnan Academy of Agricultural Sciences. In this study, Pathogenicity tests were conducted on one-year-old Prunus salicina "Banbianhong" twigs to complete Koch's postulates. The twigs were wounded using a 1-mm sterile corking borer and 14-day-old mycelium plugs of isolate (WG2-1) were inoculated and covered with sealing films. Sterile PDA plugs were placed into the wounds of control twigs. Eighteen healthy twigs were inoculated with isolates or PDA plugs (n = 6 twigs/treatment, the size of the twigs: 8 cm length and diameter about 0.7 cm, with three replications) and were placed in a closed sterile tray with the wet filter papers in a thermostatic incubator (type, HYC-260) at 28°C, respectively. The twigs inoculated with the isolates exhibited brown lesions site of inoculation, whereas the controls remained asymptomatic. R. rugulosa was successfully reisolated from the lesions but not from these control wounds and was identified by the methods described above. R. rugulosa has been reported to be associated with the die-back disease of Falcataria moluccana in China (Wang et al. 2019). The occurrence and spread of R. rugulosa in growing areas of Prunus salicina "Banbianhong" in Suijiang county have caused severe economic losses. To our knowledge, this is the first report of the die-back disease of Prunus salicina "Banbianhong" caused by R. rugulosa. These results confirm the pathogenicity of R. rugulosa in Prunus salicina "Banbianhong" and provide valuable insights for developing disease management and prevention strategies.

First report of Erwinia pyrifoliae causing flower blight and fruit rot on greenhouse-grown Fragaria × ananassa in the United States.

Erwinia pyrifoliae causes disease of pear (Pyrus spp.), apple (Malus spp.), and strawberry (Fragaria × ananassa) (Wenneker and Bergsma-Vlami 2015), which are economically important commodities in the US. Disease symptoms on pear and apple are indistinguishable from those caused by the non-quarantine fire blight pathogen, E. amylovora (Kim et al. 1999), which also causes disease on strawberries (Atanasova et al. 2005). Samples of greenhouse-grown strawberry 'Albion' from Ohio were submitted to the Purdue Plant and Pest Diagnostic Lab in December 2023. Fruits were stunted with brown lesions, while sepals and pedicels had brown-black water-soaked lesions. Cut fruit exuded bacterial ooze from the main vascular bundle. Bacterial streaming was observed microscopically from symptomatic tissue which tested positive with the E. amylovora ImmunoStrip® (Agdia Inc., Elkhart, IN); reported by the manufacturer to cross-react with E. pyrifoliae. Isolation from symptomatic tissue produced pure cultures on sucrose peptone agar and Kings medium B after incubation at 27°C for 48 hr, and colonies appeared circular and white/opaque. Crude DNA extractions were prepared by boiling colony suspensions in Tris-EDTA buffer. Two independent real-time PCR tests specific for E. pyrifoliae (Lehman et al. 2008; Yasuhara-Bell et al. 2024) produced positive results. Conventional PCR using an E. pyrifoliae-specific primer set targeting a divergent region between pstS and glmS genes (Wensing et al. 2011) also produced positive results. The amplicon was Sanger-sequenced and deposited into NCBI GenBank (Accession PP757383). BLASTn analysis using the Nucleotide collection and Whole-genome shotgun contigs revealed top matches (100% query coverage; 97.5% identity to type strain DSM 12163) with E. pyrifoliae only; next closest match was E. amylovora (53% query coverage). To confirm Koch's postulates, immature fruit of six healthy strawberry 'Albion' plants were wounded with a sterile pipette tip and then submersed in a bacterial suspension in sterile deionized water (DI H2O) (3.1×107 cells/ml). Fruit of six additional plants were mock inoculated using sterile DI H2O. Plants were placed in plastic bags for 48 hr at room temperature with a 12-hr photoperiod. Symptoms were first observed on inoculated plants 1.5 days post-inoculation (DPI). Brown discoloration was observed within fruit and as spreading lesions on fruit pedicels by 4 DPI; mock-inoculated plants remained asymptomatic. Bacterial streaming from symptomatic tissue allowed successful re-isolation of the bacterium. Molecular testing confirmed isolates to be E. pyrifoliae, thus completing Koch's postulates. Following initial confirmation, additional samples of infected strawberry ('Albion' and 'GB96') from the same greenhouse were confirmed positive for E. pyrifoliae by molecular testing and sequencing. To our knowledge this is the first time Erwinia pyrifoliae was detected in the US. There are many known pathways of introduction from Asia and Europe; however, pstS-glmS sequence comparison with strawberry isolates from the Netherlands (sequences provided by M.J.C. Pel) suggests this US strawberry strain is unique, but most closely related to Japanese strains (98.5% identity). Potential origin of this strain is unknown, but comparative genomics studies to investigate relatedness among strains are planned.

Stemphylium persianum sp. nov., (Pleosporales, Ascomycota) from Iran

Stemphylium species are saprophytes, or plant pathogens mostly associated with economically important crops. In this study, we isolated Stemphylium strains from grey to brown lesions on the culms of Schoenoplectus sp. (Cyperaceae, Poales). Based on combined morphological characteristics and sequence data of the internal transcribed spacer (ITS‒rDNA) region, parts of glyceraldehyde-3-phosphate dehydrogenase (gapdh) and calmodulin (cmdA) genes, the studied Stemphylium strains were identified and described herein as a new species, S. persianum. The new species is phylogenetically closely related to S. halophilum and S. lycii, however, they are distinguishable based on conidiophores, conidia, and ascospores morphology. Detailed morphological descriptions, illustrations, and phylogenetic relationships with other Stemphylium species are provided herein.

First Report of Neopestalotiopsis clavispora Causing Fruit Brown Spot of Pomegranate in China.

Pomegranate (Punica granatum) is an important fruit crop for therapeutic and food applications. In June 2022, brown spots were observed on the fruit surface of pomegranate cultivar named Guangyan in Mengzi (23°20'6''N,103°25'5''E), Yunnan, China. The early spots appeared as circular or irregular lesions, measuring 1~1.5 mm in diameter. They were light brown with a clear boundary between disease and healthy tissues. Over time, these spots developed into polygonal lesions covering the entire fruit surface. Eventually, the diseased fruits decayed, and more than 50% of fruits were infected in pomegranate orchards. The tissues from the interface between health and disease were cut down, immersed in 75% ethanol for 15 s, then 5% NaOCl disinfecting for 2 min, washed three times with sterile water, and the PDA cultured at 26 °C in an incubator under dark conditions. Twenty-five samples were collected for pathogen isolation, ten fungal isolates were obtained by single spore germination, and these isolates had similar morphological characters. The colonies were white with 81 mm diameter at 7 days of incubation, containing undulate edges with dense aerial mycelium. After 14 days, the black conidiomata formed superficially, gathering into black droplets. Conidiogenous cells were hyaline, short, and filiform. Conidia were fusiform, straight or slightly curved, and comprised five cells, 24.12 to 34.53 (x̄=29.78) μm × 4.21 to 12.15 (x̄=8.68) μm (n=50). The three median cells were 13.13 to 25.22 μm (x̄=18.54), dark brown, whose septa and periclinal walls were darker than the other two cells. The apical cells showed two to four appendages, 12.31 to 29.15 (x̄=21.56) μm. Only a single appendage was found on the basal cell, 2.34 to 7.16 μm. Based on morphological features, these isolates were identified as Neopestalotiopsis clavispora (Maharachchikumbura et al., 2012, 2014). Molecular identification of isolate YNSL-3 was performed by amplification and sequencing of ITS4/ITS5, BT2A/ BT2B and EF1-728F/EF-2, respectively (White et al. 1990, Glass et al.1995, Carbone et al. 1999, O'Donnell et al. 1998). These base sequences were deposited in GenBank with accession numbers OQ891378 (ITS), OR088917 (Tef) and OR513439(Tub), respectively. BLAST searches of the sequences revealed 100% (478/478 bp), 100% (484/484 bp), and 94.67% (426/450 bp) homology with those of N. clavispora NM16311a from GenBank (LC209216, LC209220, and LC209221), respectively. Phylogenetic analysis (IQ-TREE) by maximum likelihood method showed that the isolate YNSL-3 was clustered with N. clavispora. The pathogenicity was tested with the isolate of YNSL-3, YNSL-5 and YNSL-8 by detached assay. The fruit surface of pomegranate cultivar Guangyan was wounded with a sterilized needle. The mycelial blocks (5mm2) of isolates cultured on PDA for 7 days were attached to the points of inoculation. Controls were inoculated with sterile PDA agar. All inoculated fruits were maintained in a growth chamber at 26°C with 75% relative humidity. The test was performed thrice. The brown lesions were observed after 7 days, whereas the controls showed no symptoms. The same pathogens reisolated were identical to the original isolates based on morphological characterization and molecular analyses. N. clavispora could cause different diseases in many plants (Rajashekara et al. 2023, Loredana et al. 2020). To our knowledge, this is the first report of fruit brown spot on Punica granatum caused by N. clavispora in China. This finding will help improve management strategies against the fruit brown spots on P. granatum in China.

First Report of Rosa roxburghii Rot Disease Caused by Fusarium annulatum in China.

Rosa roxburghii Tratt is a rosaceous shrub originating from southwest China (Fu et al. 2020). From September to October 2022, R. roxburghii rot occurred in Guizhou Province, China, within a major R. roxburghii production area covering from 5 ha to 50 ha, with an incidence rate of 10 to 15%. Symptoms manifested as black and brown lesions on the fruit surface, which were concave, soft, foul-smelling, and surrounded by grayish-brown tissue. Three infected R. roxburghii shrubs were randomly collected from each household, placed in transparent plastic bags, and pathogen isolation was conducted in a laboratory. Infected R. roxburghii fruits were surface-sterilized with 0.5% NaOCl for 2 min, rinsed five times with sterile water, and dried. Symptomatic tissues from the margin between necrotic and healthy tissues were cut into 5 × 5 mm pieces, placed onto potato dextrose agar (PDA), and incubated at 28ºC in the dark for 5 days. Hyphal tips of fungi growing from the samples were transferred onto new PDA plates and incubated until they produced conidia. A total of five fungal isolates with similar morphological characteristics were obtained. The colony obtained by single-spore purification was light purple to dark purple with abundant aerial mycelium. Macroconidia were relatively slender with a curve and zero to three septate. Microconidia appeared obovoid to pyriform, with sizes of 5.2 to 17.2 × 2.1 to 3.3 μm (n = 50). The morphological characteristics were consistent with Fusarium annulatum (Yilmaz et al. 2021). Genomic DNA of two representative isolates (Zhaochanglin 1621 and 1622) was extracted using the DN14 cetyltrimethylammonium bromide rapid plant genome extraction kit (Aidlab Biotechnologies Co., Ltd, Beijing). The TEF1 and RPB2 gene were amplified by Polymerase Chain Reaction using primers EF1-983F/EF1-2218R (Rehner et al, 2005), bRPB2-6F/bRPB2-7.1R (Matheny et al, 2002), respectively. All sequences were deposited in GenBank (TEF1, PP236860, PP236861; RPB2, PP767864, PP767865). BLAST searches of the TEF1, and RPB2 sequences revealed the TEF1 sequences had 99.89% (937/938 bp) identity with F. annulatum isolate CBS 258.54; and the RPB2 sequences had 99.86% (737/738 bp) identity to isolate CBS 267.93. In the phylogenetic tree, the isolates (Zhaochanglin 1621 and 1622) clustered with the representative strains of F. annulatum. The morphology and multi-gene phylogenetic analysis indicated that is the isolates were F. annulatum. To complete Koch's postulates, five mature, healthy R. roxburghii fruits were surface disinfected with 1% NaClO solution for 1 min, rinsed with sterile water, and dried at 25℃ for 30 min. A conidial suspension (106 spores/ml) collected from two isolates (Zhaochanglin 1621 and 1622) was sprayed onto R. roxburghii fruits, and the control treatments were sprayed with sterile distilled water. All R. roxburghii fruits were incubated at 25 ºC with 80% relative humidity. The experiment had five replicates. After 7 days of incubation, all the inoculated fruits showed similar symptoms to those initially observed on the originally infected plants. The same pathogen was reisolated and identified by morphological character ization and molecular analysis, fulfilling Koch's postulates. Thus, the pathogen causing rot of R. roxburghii was determined to be F. annulatum (H. Zhang et al, 2024). To our knowledge, this is the first report of F. annulatum causing R. roxburghii rot disease in China. F.annulatum has a wide range of hosts and has been reported to infect a wide range of crops, fruits, and vegetables (Bacon and Nelson 1994). This study lays a foundation for further study and developing disease control methods and the improvement of the economic benefits of R. roxburghii.

First report of leaf spot disease caused by Pseudopithomyces chartarum on Lonicera caerulea L. in Heilongjiang Province, China.

Blue honeysuckle (Lonicera caerulea L.) cultivation has gradually expanded in China but continues to be limited by challenges such as leaf spot disease. Between September 2022 and September 2023, a leaf spot disease was observed on approximately 30% of 'Lanjingling' blue honeysuckles grown in a 2.66 ha field (a total of about 11,000 plants) in Jiamusi city (130.47°E, 46.16°N), Heilongjiang Province, China. Affected plants displayed brown necrotic lesions on their leaves that gradually expanded in area until the leaves fell off the plant entirely. Small, 3 to 4 mm segments of infected tissue from 50 randomly selected leaves were surface sterilized with 75% ethanol for 30 s and 5% sodium hypochlorite (NaOCl) for 3 min, rinsed three times with sterile distilled water, dried on paper towels, and plated in 9 cm Petri dishes containing potato dextrose agar (PDA) (Yan et al. 2022). Five pathogens (LD-232, LD-233, LD-234, LD-235, and LD-236) were isolated on PDA and displayed a conidia morphology consistent with Pseudopithomyces spp. (Perelló et al. 2017). The fungal colonies on PDA were villiform, white, and whorled and had sparse aerial mycelium on the surface with black conidiomata. The conidia were obpyriform and dark brown, had 0 to 3 transverse and 0 to 1 longitudinal septa, and measured 9.00 to 15.30 μm × 5.70 to 9.30 μm in size (n = 50). Genomic DNA was extracted from a representative isolate, LD-232, for molecular verification and PCR amplification was performed with ITS1/ITS4 (White et al. 1990), LROR/LR7 (Carbone and Kohn 1999), and RPB2-5F2/RPB2-7CR (Liu et al. 1999) primers. Sequences of LD-232 ITS (OR835654), LSU (OR835652), and RPB2 (OR859769) revealed 99.8% (530/531 nt), 98.8% (639/647 nt), and 99.8% (1015/1017 nt) shared identity with Pseudopithomyces chartarum sequences (OP269600, OP237014, and MK434892), respectively (Wu et al. 2023). Bayesian inference (BI) was used to construct the phylogenies using Mr. Bayes v. 3.2.7 to confirm the identity of the isolates (Ariyawansa et al. 2015). Phylogenetic trees cannot be constructed based on the genes' concatenated sequences because selective strains do not have complete rDNA-ITS, LSU, and RPB2 sequences. Therefore, based on the morphological characteristics and molecular phylogeny, LD-232 was identified as P. chartarum (Perelló et al. 2017; Wu et al. 2023). A pathogenicity test was performed with six healthy, two-year-old 'Lanjingling' blue honeysuckle plants. Three plants were inoculated by spraying the LD-232 conidial suspension (1 × 106 spores/ml) or clean water as an experimental control condition (Wu et al. 2023; Yan et al. 2023). All plants were cultured in a greenhouse at 28℃ under a 12-h light/dark cycle, and each experiment was replicated three times. Typical leaf spot symptoms were observed on inoculated leaves after 10 days. The same pathogens were reisolated from infected leaves, displayed the same morphological and molecular traits, and were again identified as P. chartarum, confirming Koch's postulate. P. chartarum previously caused leaf spot disease on Tetrapanax papyrifer in China (Wu et al. 2023). To our knowledge, this is the first report of blue honeysuckle leaf spot caused by P. chartarum in China. Identification of P. chartarum as a disease agent on blue honeysuckle will help guide future management of leaf diseases for this economically important small fruit tree.