Bp Insertion Research Articles

Analysis of The Open Reading Frame (ORF) 29-TrnC (GCA) Sequence to Detect Indica and Japonica Sub Species on Upland Rice of Situ Bagendit and Inbred Rice of Ciherang

The identification and the characterization of genetic diversity of rice was the first step in the rice plant breeding program. This study aimed to detect indica or japonica sub-species on upland rice Situ Bagendit and inbred rice Ciherang using molecular markers ORF 29-TrnC (GCA) on the chloroplast genome. Rice was included to the indica sub-species if the 32 bp insertion on ORF 29-TrnC (GCA) sequence was found, on the contrary, if the deletion 32 bp on ORF 29-TrnC (GCA) was found then it was included to the japonica sub-species. DNA isolation was examined from the leaves of the rice plants, and then it tested quantitatively to determine the transparency and DNA concentration from the isolation results. PCR amplification was performed using a pair of primers CP2 and it was followed by agarose gel electrophoresis. The visualization of the DNA bands used the gel documentation. Sequencing of PCR products produced a long base 390 bp in Situ Bagendit rice and 390 bp in Ciherang rice. Analysis of the sequences showed that the insertions occurred throughout the 32 bp in Situ Bagendit rice and the insertions occurred throughout the 32 bp in Ciherang rice. The results showed that upland rice Situ Bagendit and inbred rice Ciherang were included in the indica sub-species. The knowledge of variety of genetics of rice can be used as bio-information in the plant breeding program. Further, the knowledge can be used to protect in genetic power source, the selection and the composing of superior varieties of rice which is tolerant with kinds of biotic and abiotic factor.

Genetic diversity of Mycobacterium tuberculosis isoniazid monoresistant and multidrug-resistant in Rio Grande do Sul, a tuberculosis high-burden state in Brazil

Tuberculosis (TB) remains a major public health problem in the world and Brazil is among the countries with the highest incidence and prevalence rates, and Rio Grande do Sul, a Brazilian state, occupy a prominent position. Multidrug-resistant Mycobacterium tuberculosis (MDR-TB) further aggravates this scenario, making it more difficult to treat and control the disease. Isoniazid monoresistance (IMR) may increase the risk of progression to MDR-TB and treatment failure. However, most drug resistance molecular tests only focus on detecting rifampicin (RIF) resistance.In the present study, we characterized a total of 63 drug resistant isolates of M. tuberculosis (35 MDR, 26 IMR and two isolates monoresistant to rifampicin [RMR]) of the Rio Grande do Sul state by MIRU-VNTR (24 loci), spoligotyping, presence of RDRio, fbpC103, pks15/1 and sequencing of the katG, rpoB and inhA genes. We observed a higher proportion of the LAM family 30/63 (47.61%). In IMR, mutations were found in the katG gene (98% at codon 315) in 72.5%, and mutations in the promoter region of the inhA gene in 6.25% of the isolates. In MDR-TB and RMR-TB isolates, 92.1% had mutations in the rpoB gene (57% at codon 531). The presence of a 12 bp insertion between codons 516 and 517 of the rpoB gene in MDR-TB isolates was found in five isolates.In conclusion, we observed that the highest frequency of IMR-TB and MDR-TB strains belong to the LAM and Haarlem genotypes in Rio Grande do Sul state. A significant number of isolates previously characterized as Mycobacterium pinnipedi2 through spoligotyping were found to belong to the M. tuberculosis LAM family. This was responsible for a number of significant cases and the molecular profile of this strain and the pattern of mutations related to drug resistance were analyzed. These findings may contribute to a better understanding about the spread of M. tuberculosis resistant in southern of Brazil.

γ-glutamyl transpeptidase deficiency caused by a large homozygous intragenic deletion in GGT1.

γ-Glutamyl transpeptidase deficiency (glutathionuria, OMIM 231950) is a rare disease, with only six patients reported in the literature, although this condition has probably been underdiagnosed due the difficulty to routinely analyze glutathione in clinical samples and to the fact that no genetic defect has been coupled to the disease so far. We report two siblings with mild psychomotor developmental delay and mild neurological symptoms, who presented a markedly increased excretion of glutathione in urine and a very low γ-glutamyl transpeptidase activity in serum. Whole-genome sequencing revealed the presence of a 16.9 kb homozygous deletion in GGT1, one of the genes encoding enzymes with γ-glutamyl transpeptidase activity in the human genome. Close analysis revealed the presence of a 13 bp insertion at the deletion junction. This is the first report of a genetic variant as the cause of glutathionuria. In addition, genetic characterization of the patients' parents and a healthy sibling has provided direct genetic evidence regarding the autosomal recessive nature of this disease.

Deficiency of a pyrroline-5-carboxylate reductase produces the yellowish green cocoon ‘Ryokuken’ of the silkworm, Bombyx mori

The silkworm cocoon colour has attracted researchers involved in genetics, physiology and ecology for a long time. 'Ryokuken' cocoons are yellowish green in colour due to unusual flavonoids, prolinylflavonols, while 'Sasamayu' cocoons are light green and contain only simple flavonol glucosides. We found a novel gene associated with the cocoon colour change resulting from a change in flavonoid composition and named it Lg (light green cocoon). In the middle silk glands of the + Lg /+ Lg larvae, 1-pyrroline-5-carboxylic acid (P5C) was found to accumulate due to a decrease in the activity of pyrroline-5-carboxylate reductase (P5CR), an enzyme reducing P5C to proline. Sequence analysis of BmP5CR1, the candidate gene for Lg, revealed a 1.9 kb insertion and a 4 bp deletion within the 1st intron, a 97 bp deletion within the 4th intron, and a > 300 bp insertion within the 3'-UTR, in addition to two amino acid changes on exons 3 and 4 in + Lg /+ Lg compared to Lg/Lg. Decreased expression of BmP5CR1 was observed in all of the investigated tissues, including the middle silk glands in + Lg /+ Lg , which was probably caused by structural changes in the intronic regions of BmP5CR1. Furthermore, a BmP5CR1 knockout strain exhibited a yellowish green cocoon with the formation of prolinylflavonols. These results indicate that the yellowish green cocoon is produced by a BmP5CR1 deficiency. To our knowledge, this is the first report showing that the defect of an enzyme associated with intermediate metabolism promotes the conjugation of phytochemicals derived from foods with endogenously accumulating metabolites in animal tissues.

Vibrio fujianensis sp. nov., isolated from aquaculture water

A Gram-stain-negative, facultatively anaerobic strain, designated FJ201301T, was isolated from aquaculture water collected from Fujian province, China. Phylogenetic analysis of 16S rRNA gene sequences indicated that strain FJ201301T belonged to the genus Vibrio, formed a distinct cluster with Vibriocincinnatiensis ATCC 35912T and shared the highest similarity with Vibriosalilacus CGMCC 1.12427T. A 15 bp insertion found in the 16S rRNA gene was a significant marker that distinguished strain FJ201301T from several phylogenetic neighbours (e.g. V. cincinnatiensis). Multilocus sequence analysis of eight genes (ftsZ, gapA, gyrB, mreB, pyrH, recA, rpoA and topA; concatenated 4135 bp sequence) showed that, forming a long and independent phylogenetic branch, strain FJ201301T clustered with V. cincinnatiensis ATCC 35912T, Vibrioinjenensis KCTC 32233T and Vibriometschnikovii CIP 69.14T clearly separated from V. salilacus CGMCC 1.12427T. Furthermore, the highest in silico DNA-DNA hybridization and average nucleotide identity values between strain FJ201301T and the closest related species were 26.3 and 83.1 % with V. cincinnatiensis ATCC 35912T, less than the proposed cutoff levels for species delineation, i.e. 70 and 95 %, respectively. Biochemical, sequence and genomic analysis suggested the designation of strain FJ201301T representing a novel species of the genus Vibrio, for which the name Vibrio fujianensis sp. nov. is proposed. The type strain is FJ201301T (=DSM 104687T=CGMCC 1.16099T).

Identification of a novel 24 bp insertion–deletion (indel) of the androgen receptor gene and its association with growth traits in four indigenous cattle breeds

Abstract. During the past decades, insertions and deletions (indels) have become increasingly popular in animal breeding for understanding the relationship between genotypes and phenotypes. The androgen receptor (AR) plays the vital role of a bridge on the function of the androgen and has sexual size dimorphism. For this reason, the objective of this study was to explore the novel indel variants within the cattle AR gene and to detect their effects on growth traits in four breeds of Chinese yellow cattle. Herein, we first confirmed a novel 24 bp indel (AC_000187.1g.4187270-4187293delAATTTATTGGGAGATTATTGAATT) within the intron of the cattle AR gene. This is consistent with the results predicted from the NCBI SNP database. The distribution of the indel genotypes of four Chinese yellow cattle were significantly different from each other (P < 0.01). After significant correlation analysis, many remarkable phenotypic differences among the three genotypes were found (P < 0.05). In conclusion, a novel 24 bp indel within the AR gene significantly affected growth traits, suggesting that this indel may be a useful DNA marker for the elimination or selection of excellent individuals for cattle breeding.

CXorf56, a dendritic neuronal protein, identified as a new candidate gene for X-linked intellectual disability.

Intellectual disability (ID) comprises a large group of heterogeneous disorders, often without a known molecular cause. X-linked ID accounts for 5-10% of male ID cases. We investigated a large, three-generation family with mild ID and behavior problems in five males and one female, with a segregation suggestive for X-linked inheritance. Linkage analysis mapped a disease locus to a 7.6 Mb candidate region on the X-chromosome (LOD score 3.3). Whole-genome sequencing identified a 2 bp insertion in exon 2 of the chromosome X open reading frame 56 gene (CXorf56), resulting in a premature stop codon. This insertion was present in all intellectually impaired individuals and carrier females. Additionally, X-inactivation status showed skewed methylation patterns favoring the inactivation of the mutated allele in the unaffected carrier females. We demonstrate that the insertion leads to nonsense-mediated decay and that CXorf56 mRNA expression is reduced in the impaired males and female. In murine brain slices and primary hippocampal neuronal cultures, CXorf56 protein was present and localized in the nucleus, cell soma, dendrites, and dendritic spines. Although no other families have been identified with pathogenic variants in CXorf56, these results suggest that CXorf56 is the causative gene in this family, and thus a novel candidate gene for X-linked ID with behavior problems.

Genetic variation in N- and C-terminal regions of bovine DNAJA1 heat shock protein gene in African, Asian and American cattle.

DNAJA1 or heat shock protein 40 (Hsp40) is associated with heat adaptation in various organisms. We amplified and sequenced a total of 1,142 bp of bovine Hsp40 gene representing the critical N-terminal (NTR) and C-terminal (CTR) regions in representative samples of African, Asian and American cattle breeds. Eleven and 9 different haplotypes were observed in the NTR in Asian and African breeds respectively while in American Brangus, only two mutations were observed resulting in two haplotypes. The CTR appears to be highly conserved between cattle and yak. In-silico functional analysis with PANTHER predicted putative deleterious functional impact of c.161 T>A; p. V54Q while alignment of bovine and human NTR-J domains revealed that p.Q19H, p.E20Q and p. E21X mutations occurred in helix 2 and p.V54Q missense mutation occurred in helix 3 respectively. The 124 bp insertion found in the yak DNAJA1 ortholog may have significant functional relevance warranting further investigation. Our results suggest that these genetic differences may be concomitant with population genetic history and possible functional consequences for climate adaptation in bovidae.

Three Mutations in the Bilateral Frontoparietal Polymicrogyria Gene GPR56 in Pakistani Intellectual Disability Families

Bilateral frontoparietal polymicrogyria (BFPP, MIM 606854) is a heterogeneous autosomal recessive disorder of abnormal cortical lamination, leading to moderate-to-severe intellectual disability (ID), seizure disorder, and motor difficulties, and caused by mutations in the G protein-coupled receptor 56 ( GPR56 ) gene. Twenty-eight mutations in 40 different families have been reported in the literature. The clinical and neuroimaging phenotype is consistent in these cases. The BFPP cortex consists of numerous small gyral cells, with scalloping of the cortical-white matter junction. There are also associated white matter, brain stem, and cerebellar changes. GPR56 is a member of an adhesion G protein-coupled receptor family with a very long N-terminal stalk and seven transmembrane domains. In this study, we identified three families from Pakistan, ascertained primarily for ID, with overlapping approximately 1 Mb region (chr16:56,973,335-57,942,866) of homozygosity by descent, including 24 RefSeq genes. We found three GPR56 homozygous mutations, using next-generation sequencing. These mutations include a substitutional variant, c.1460T > C; p.L487P, (chr16:57693480 T > C), a 13-bp insertion causing the frameshift and truncating mutation, p.Leu269Hisfs*21 (NM_005682.6:c.803_804insCCATGGAGGTGCT; Chr16: 57689345_57689346insCCATGGAGGTGCT), and a truncating mutation c.1426C > T; p.Arg476* (Chr16:57693446C > T). These mutations fully segregated with ID in these families and were absent in the Exome Aggregation Consortium database that has approximately 8,000 control samples of South Asian origin. Two of these mutations have been reported in ClinVar database, and the third one has not been reported before. Three families from Pakistan with GPR56 mutations have been reported before. With the addition of our findings, the total number of mutations reported in Pakistani patients now is six. These results increase our knowledge regarding the mutational spectrum of the GPR56 gene causing BFPP/ID.

Apancreatic pigs cloned using Pdx1-disrupted fibroblasts created via TALEN-mediated mutagenesis.

Pancreatic and duodenal homeobox 1 (PDX1) plays a crucial role in pancreas development, β-cell differentiation, and maintenance of mature β-cell function. In this study, we designed a strategy to produce PDX1-knockout (KO) pigs. A transcription activator-like effector nuclease (TALEN) pair targeting exon 1 of the swine PDX1 gene was constructed. Porcine fetal fibroblasts (PFFs) were transfected with the TALEN plasmids plus a surrogate reporter plasmid. PDX1-mutated PFFs were enriched by magnetic separation and used to produce homozygous PDX1-KO pigs via a two-step somatic cell nuclear transfer (SCNT) cloning process. In the first SCNT step, we obtained eight fetuses, established PFF cell lines, and analyzed PDX1 gene mutations by T7 endonuclease 1 assays and Sanger sequencing. Five fetuses showed mutations at the PDX1 loci with two biallelic mutations and three monoallelic mutations (mutation rate of 62.5%). In the second step, a PDX1 biallelic mutant PFF cell line with a 2 bp deletion in one allele and a 4 bp insertion in the other allele was used as a donor to generate cloned pigs via SCNT. From 462 cloned embryos transferred into two surrogates, nine live piglets were delivered. These piglets at birth were not clearly distinguishable phenotypically from wild-type piglets, but soon developed severe diarrhea and vomiting and all died within 2 days after birth. Dissection of PDX1-KO piglets revealed that the liver, gallbladder, spleen, stomach, common bile duct, and other viscera were present and normal, but the pancreas was absent in all cases.

Acute Myeloid Leukemia with Mutated NPM1 Is Dependent on the Cytoplasmic Localization of NPM1c

▪NPM1 mutations are among the most common mutations in acute myeloid leukemia (AML), being found in about 30% of de novo AML in adults. NPM1 is a multifunctional nucleolar chaperone involved in genomic stability and ribosome biogenesis. All the mutations in NPM1 described so far result in cytoplasmic protein localization (NPM1c) through the acquisition of a nuclear export signal (NES) at the C-terminus. Based on these observations, we hypothesized that cytoplasmic localization of NPM1c is necessary for AML pathogenesis and maintenance. To test our hypothesis, we edited the C-terminus of the NPM1 mutant allele in order to remove the NES and re-localize NPM1c to the nucleus.Specifically, using our recently optimized CRISPR-Cas9 approach (Gundry, et al. Cell Reports 2016), we sought to introduce indels to disrupt the C-terminal NES in AML cells bearing NPM1 mutation A (heterozygous 4bp insertion at the C-terminus), thereby creating novel edited alleles encoding for a mutant NPM1 with nuclear localization. Cell lines, primary derived xenografts (PDX) and primary AML samples harboring NPM1 mutation A were successfully edited with an sgRNA spanning the 4bp insertion.While the NPM1 wild-type allele remained intact, the mutant allele was edited with up to 90% efficiency. The novel edited alleles could direct nuclear localization of a GFP-NPM1 fusion construct. Additionally, re-localization of cytoplasmic NPM1 in edited cells was confirmed by immunofluorescence. Return of NPM1 protein to the nucleus resulted in terminal differentiation, and significantly impaired cell growth, colony forming ability and engraftment in xenograft models. Transcriptome analysis on two cell lines with mutated NPM1 revealed that upon nuclear re-localization of NPM1c, only 22 genes were down regulated more than 2 fold in both cell lines. Strikingly, 11 of these 22 genes were HOX genes. Altogether these data indicate that the cytoplasmic localization of NPM1c is necessary to maintain the transcriptional signature and leukemic phenotype of AML cells with mutated NPM1 .To extend our study further, we used homology-directed repair (HDR) to successfully correct NPM1 mutations to the wild type sequence in AML cell lines (Fig.1). We simultaneously fused GFP to the C-terminus of the protein to verify its appropriate localization (Fig.1). Moreover, to assess whether the phenotype of AML cells depends on the amount of mutant NPM1 in the cytoplasm, we inserted a series of NPM1 mutant alleles (a, b and c) that resulted in different proportions of cytoplasmic versus nuclear localization (i.e. a - no cytoplasmic mutant NPM1, b - ~50% cytoplasmic/50% nuclear mutant NPM1, c - ~100% cytoplasmic mutant NPM1; Fig.1) in two different AML cell lines with mutated NPM1 . Cells with high levels of nuclear NPM1 tended to differentiate rapidly, while cells with a greater proportion of cytoplasmic NPM1 remained less differentiated and continued to proliferate (Fig.1). This established an ongoing competition in which cells with higher nuclear NPM1 were rapidly outcompeted by unedited cells, while cells with higher cytoplasmic NPM1 were not. Thus, these experiments clearly demonstrate the dependence of the leukemic phenotype on the cytoplasmic localization of NPM1.Recently, compounds able to inhibit the nuclear exporter CRM1/XPO1 have been developed and are currently being tested in clinical trials (e.g. selinexor). Since NPM1 is shuttled to the cytoplasm by CRM1/XPO1, its inhibition re-localizes NPM1c to the nucleus. We therefore treated cell lines, PDX and primary samples with selinexor with the aim to reproduce the nuclear re-localization observed using CRISPR-Cas9. As expected, selinexor treatment resulted in clear growth arrest, differentiation, and NPM1c re-localization with dynamics similar to what was seen with gene editing. Importantly, after only 3 days of treatment selinexor produced a dramatic drop of HOXA, HOXB and MEIS1 expression.In conclusion, allele-specific editing is a powerful tool to probe the mechanistic aspects of oncogenic dependencies. By achieving nuclear re-localization of mutant NPM1, we demonstrated that cytoplasmic localization of NPM1c is necessary for NPM1-mutant AML cells to maintain their leukemic phenotype. Drugs promoting mutant NPM1 nuclear localization are therefore attractive candidates for clinical treatment of AML with mutated NPM1 . [Display omitted] DisclosuresNo relevant conflicts of interest to declare.

Whole genome sequencing of Oryza sativa L. cv. Seeragasamba identifies a new fragrance allele in rice.

Fragrance of rice is an important trait that confers a large economic benefit to the farmers who cultivate aromatic rice varieties. Several aromatic rice varieties have limited geographic distribution, and are endowed with variety-specific unique fragrances. BADH2 was identified as a fragrance gene in 2005, and it is essential to identify the fragrance alleles from diverse geographical locations and genetic backgrounds. Seeragasamba is a short-grain aromatic rice variety of the indica type, which is cultivated in a limited area in India. Whole genome sequencing of this variety identified a new badh2 allele (badh2-p) with an 8 bp insertion in the promoter region of the BADH2 gene. When the whole genome sequences of 76 aromatic varieties in the 3000 rice genome project were analyzed, the badh2-p allele was present in 13 varieties (approximately 17%) of both indica and japonica types. In addition, the badh2-p allele was present in 17 varieties that already had the loss-of-function allele, badh2-E7. Taken together, the frequency of badh2-p allele (approximately 40%) was found to be greater than that of the badh2-E7 allele (approximately 34%) among the aromatic rice varieties. Therefore, it is suggested to include badh2-p as a predominant allele when screening for fragrance alleles in aromatic rice varieties.

Ancient Evolution and Dispersion of Human Papillomavirus 58 Variants.

ABSTRACTHuman papillomavirus 58 (HPV58) is found in 10 to 18% of cervical cancers in East Asia but is rather uncommon elsewhere. The distribution and oncogenic potential of HPV58 variants appear to be heterogeneous, since the E7 T20I/G63S variant is more prevalent in East Asia and confers a 7- to 9-fold-higher risk of cervical precancer and cancer. However, the underlying genomic mechanisms that explain the geographic and carcinogenic diversity of HPV58 variants are still poorly understood. In this study, we used a combination of phylogenetic analyses and bioinformatics to investigate the deep evolutionary history of HPV58 complete genome variants. The initial splitting of HPV58 variants was estimated to occur 478,600 years ago (95% highest posterior density [HPD], 391,000 to 569,600 years ago). This divergence time is well within the era of speciation between Homo sapiens and Neanderthals/Denisovans and around three times longer than the modern Homo sapiens divergence times. The expansion of present-day variants in Eurasia could be the consequence of viral transmission from Neanderthals/Denisovans to non-African modern human populations through gene flow. A whole-genome sequence signature analysis identified 3 amino acid changes, 16 synonymous nucleotide changes, and a 12-bp insertion strongly associated with the E7 T20I/G63S variant that represents the A3 sublineage and carries higher carcinogenetic potential. Compared with the capsid proteins, the oncogenes E7 and E6 had increased substitution rates indicative of higher selection pressure. These data provide a comprehensive evolutionary history and genomic basis of HPV58 variants to assist further investigation of carcinogenic association and the development of diagnostic and therapeutic strategies.IMPORTANCE Papillomaviruses (PVs) are an ancient and heterogeneous group of double-stranded DNA viruses that preferentially infect the cutaneous and mucocutaneous epithelia of vertebrates. Persistent infection by specific oncogenic human papillomaviruses (HPVs), including HPV58, has been established as the primary cause of cervical cancer. In this work, we reveal the complex evolutionary history of HPV58 variants that explains the heterogeneity of oncogenic potential and geographic distribution. Our data suggest that HPV58 variants may have coevolved with archaic hominins and dispersed across the planet through host interbreeding and gene flow. Certain genes and codons of HPV58 variants representing higher carcinogenic potential and/or that are under positive selection may have important implications for viral host specificity, pathogenesis, and disease prevention.

Molecular characterization of the llama FGF5 gene and identification of putative loss of function mutations.

Llama, the most numerous domestic camelid in Argentina, has good fiber-production ability. Although a few genes related to other productive traits have been characterized, the molecular genetic basis of fiber growth control in camelids is still poorly understood. Fibroblast growth factor 5 (FGF5) is a secreted signaling protein that controls hair growth in humans and other mammals. Mutations in the FGF5 gene have been associated with long-hair phenotypes in several species. Here, we sequenced the llama FGF5 gene, which consists of three exons encoding 813bp. cDNA analysis from hair follicles revealed the expression of two FGF5 alternative spliced transcripts, in one of which exon 2 is absent. DNA variation analysis showed four polymorphisms in the coding region: a synonymous SNP (c.210A>G), a single base deletion (c.348delA), a 12-bp insertion (c.351_352insCATATAACATAG) and a non-sense mutation (c.499C>T). The deletion was always found together with the insertion forming a haplotype and producing a putative truncated protein of 123 amino acids. The c.499C>T mutation also leads to a premature stop codon at position 168. In both cases, critical functional domains of FGF5, including one heparin binding site, are lost. All animals analyzed were homozygous for one of the deleterious mutations or compound heterozygous for both (i.e. c.348delA, c.351_352insCATATAACATAG/c.499T). Sequencing of guanaco samples showed that the FGF5 gene encodes a full-length 270-amino acid protein. These results suggest that FGF5 is likely functional in short-haired wild species and non-functional in the domestic fiber-producing species, the llama.

Using CRISPR/Cas9-mediated gene editing to further explore growth and trade-off effects in myostatin-mutated F4 medaka (Oryzias latipes)

Myostatin (MSTN) suppresses skeletal muscle development and growth in mammals, but its role in fish is less well understood. Here we used CRISPR/Cas9 to mutate the MSTN gene in medaka (Oryzias latipes) and evaluate subsequent growth performance. We produced mutant F0 fish that carried different frameshifts in the OlMSTN coding sequence and confirmed the heritability of the mutant genotypes to the F1 generation. Two F1 fish with the same heterozygous frame-shifted genomic mutations (a 22 bp insertion in one allele; a 32 bp insertion in the other) were then crossbred to produce subsequent generations (F2~F5). Body length and weight of the MSTN−/− F4 medaka were significantly higher than in the wild type fish, and muscle fiber density in the inner and outer compartments of the epaxial muscles was decreased, suggesting that MSTN null mutation induces muscle hypertrophy. From 3~4 weeks post hatching (wph), the expression of three major myogenic related factors (MRFs), MyoD, Myf5 and Myogenin, was also significantly upregulated. Some medaka had a spinal deformity, and we also observed a trade-off between growth and immunity in MSTN−/− F4 medaka. Reproduction was unimpaired in the fast-growth phenotypes.

P094 Difficulty detecting a novel HLA-C allele with next generation (NGS) technology

Routine typing of a sample from a donor joining the Australian Bone Marrow Donor Registry identified a potential novel HLA-C allele. The sample was initially typed using the One Lambda Labtype kit which identified a group 2 pair of common and well documented HLA-C alleles (one common allele and one not common allele): HLA-C∗06:02:01, 07:207. The laboratory routinely confirms ‘non-common’ alleles using sequence based typing. Exons 2 and 3 were sequenced in both directions using the Conexio SBT Resolver HLA-C kit and analysed using Assign SBT software. The sequencing data indicated an indel in exon 3, reflexive sequencing with HARPs identified the indel as a 36 bp insertion at position 592 of the HLA-C∗07 allele. Further analysis of the sequence indicated that the inserted 36 bp appeared to be a duplication of the previous 36 bp of the sequence in-frame, which would potentially add 12 amino acids to the mature protein. The sample was referred for NGS typing to our colleagues at the Department of Clinical Immunology, Fiona Stanley Hospital in Perth and was subsequently tested in-house using the Immucor Mia Fora NGS Flex kits. The NGS sequencing analysis results did not flag the presence of the insertion, calling the allele C∗07:18 with no unusual flags. Further analysis of the NGS data indicates that the software inserted bases to call the C∗07:18, which is unusual. This case study highlights a limitation of the NGS software packages to deal with large insertions. Although not conclusive to confirm this allele as having aberrant expression; the presence of the HLA-Cw7 antigen was not detected by serology using commercial typing trays.

Facile Reversible Benzophenone Insertion into Rare‐Earth Metal Pyrazolate Complexes

Treatment of the homoleptic CeIV pyrazolate complex [Ce(Me2pz)4]2 (Me2pz = 3,5‐dimethylpyrazolato) with benzophenone (bp) led to the formation of an Me2pz‐substituted diphenylmethoxy‐(N,O)‐chelating ligand (pdpm), possibly metal‐templated through initial coordination of bp to the cerium atom and subsequent bp insertion into the Ce–N(Me2pz) bond. This coordination/insertion process was shown to be reversible, leading to a complex sequence of equilibria involving multiple degrees of insertion/de‐insertion and association/dissociation. The dependency on temperature and the amount of bp of all equilibria was revealed, with insertion/association of bp being favored at low temperatures and de‐insertion/dissociation preferentially occurring at elevated temperatures. Such sets of equilibria were also observed for the treatment of trivalent complexes [Ln(Me2pz)3(thf)]2 (Ln = La, Ce, Lu) with bp. Through structural analysis, the trivalent complexes were shown to be less effective in the bp‐to‐pdpm conversion than the CeIV derivative, giving direct evidence of how an increase in rare‐earth Lewis acidity aids in ketone anchorage and concomitant conversion. The observed equilibria seem to also apply to the more illustrious organocerium systems. The conversion of bp into the corresponding tertiary alcohol by the routinely employed reagent CeCl3/nBuLi is the most selective when termination of the reaction by hydrolysis is performed at lower temperatures, with a reagent ratio bp/CeCl3/nBuLi of 1:1:1.

Clustering infection of hepatitis B virus genotype B4 among residents in Vietnam, and its genomic characters both intra- and extra-family.

Vietnam has a high rate of hepatitis B virus (HBV) infection and a high mortality rate from hepatocellular carcinoma. We performed a detailed genetic analysis of 48 residents and four families from Binh Thuan Province, a southern coastal area of Vietnam. The route of infection and genomic characteristics related to hepatocellular carcinoma (HCC) were studied in HBV spread among carriers that we detected in our previous hepatitis survey. The HBV genotype was B4 in 91.7% and C1 in 8.3% of the cases. The intra-family’s HBV sequence homology was high at 96.8–99.4%. However, it was also high at 99.4–99.8% among residents of the same age and sex as family members. In addition, full genome analysis was performed in 21 cases. The core region of all 20 isolates with genotype B4 was a recombinant of genotype C, and pre-S deletion was found in 20% of cases. The promoter mutation G1613A was found in 13.6% of cases, and a 24 bp insertion from nt1673 in the X region was found in 6.3% of cases. The phylogenetic tree and homology analysis of the HBV full genome suggested the probability and its possibility of horizontal transmission not only within families nor vertical transmission but within cohorts of the same generation in the population. Moreover, the HBV genotype B4 isolates were found not only to be recombinants of genotype C, which results in a high cancer risk, but also to have other risk of HCC, pre-S deletions, the G1613A mutation, and X region insertions corresponding to the promoter. These genomic characters were suggested to be one of the factors to explain the high HCC mortality rate in Vietnam.

The HLA-G 14-bp polymorphism and recurrent implantation failure: a meta-analysis.

The human leucocyte antigen-G (HLA-G) 14-bp insertion/deletion polymorphism was implicated in recurrent implantation failure (RIF), but individual published studies showed inconclusive results. Thus, a meta-analysis was performed to clarify the effect of HLA-G 14-bp polymorphism on RIF risk. A comprehensive search for relevant articles was conducted. The odds ratios (ORs) and 95% confidence intervals (CIs) for HLA-G 14-bp polymorphism and RIF were calculated. A total of five studies were included. In studies conducted in RIF patients and controls who had at least one spontaneous pregnancy, meta-analysis revealed no statistically significant association between the HLA-G 14-bp polymorphism and RIF in allele contrast and all genetic models in the overall population, but significant association was found in the population of Caucasian origin under allele contrast (OR=1.73, 95% CI, 1.20, 2.50) and genetic models of +14bp/+14bp vs. -14bp/-14bp (OR=3.09, 95% CI, 1.43, 6.65). In studies conducted in RIF patients and controls who had successful pregnancy following IVF-ET, the meta-analysis showed that there was statistically significant association between the HLA-G 14bp polymorphism and RIF in allele contrast (OR=1.74, 95% CI, 1.13, 2.67) and genetic models of +14bp/+14bp vs. -14bp/-14bp (OR=10.20, 95% CI, 2.47, 42.14) and dominant model (OR=4.34, 95% CI, 1.72, 10.92). No publication bias was found in the present studies. This meta-analysis suggested that the HLA-G 14-bp insertion allele may increase the risk of RIF in Caucasians. Further studies with large sample size of different ethnic populations are necessary.

The polymorphic insertion of the luteinizing hormone receptor “insLQ” show a negative association to LHR gene expression and to the follicular fluid hormonal profile in human small antral follicles

The luteinizing hormone receptor (LHCGR) has a little studied polymorphic 6 bp insertion (rs4539842/insLQ). This study has evaluated the insLQ polymorphism in relation to potential associations with hormonal characteristics of human small antral follicles (hSAFs).In total, 310 hSAFs were collected from 86 women undergoing fertility preservation. Analysis included hormonal profile of 297 follicular fluid (FF) samples and 148 corresponding granulosa cells samples were evaluated by qPCR for selected genes.Significantly reduced and non-detectable mRNA levels of anti-Müllerian hormone receptor II (AMHR2) and LHCGR, respectively, were observed for insLQ/insLQ compared to –/insLQ and the −/− genotypes. Moreover, LHCGR and CYP19a1 together with oestradiol and inhibin-B were significantly increased in –/insLQ compared to the −/− genotype. The homozygous insLQ genotype showed strong significant associations to GC specific genes LHCGR and CYP19a1, which may translate into significant changes in FF hormone profiles and an altered LH signaling.