Bovine Prion Gene Research Articles

Genetics of Prion Disease in Cattle.

Bovine spongiform encephalopathy (BSE) is a prion disease that is invariably fatal in cattle and has been implicated as a significant human health risk. As a transmissible disease of livestock, it has impacted food safety, production practices, global trade, and profitability. Genetic polymorphisms that alter the prion protein in humans and sheep are associated with transmissible spongiform encephalopathy susceptibility or resistance. In contrast, there is no strong evidence that nonsynonymous mutations in the bovine prion gene (PRNP) are associated with classical BSE (C-BSE) disease susceptibility, though two bovine PRNP insertion/deletion polymorphisms, in the putative region, are associated with susceptibility to C-BSE. However, these associations do not explain the full extent of BSE susceptibility, and loci outside of PRNP appear to be associated with disease incidence in some cattle populations. This article provides a review of the current state of genetic knowledge regarding prion diseases in cattle.

PRNP and SPRN genes polymorphism in atypical bovine spongiform encephalopathy cases diagnosed in Polish cattle

Polymorphisms in the coding region of the prion protein gene (PRNP) have been associated with the susceptibility and incubation period of prion diseases in humans and sheep. However, polymorphisms in this part of the bovine PRNP gene do not affect the classical bovine spongiform encephalopathy (BSE) susceptibility in cattle. Studies carried out in Germany have shown that insertion/deletion-type polymorphisms located in the promoter region of the bovine prion gene are possible genetic factors modulating BSE susceptibility by changing the level of PRNP expression. No such association was observed for atypical BSE cases; however, due to the rare nature of the disease, these results should be confirmed. Additionally, a single nonsynonymous mutation in PRNP codon 211 (E211K) was described in one H-type BSE case in the USA; however, it was not found in any other cases. Here, we performed genetic characterization of PRNP promoter indel variations and determined the polymorphism of open reading frames (ORFs) of PRNP and bovine prion-like Shadoo (SPRN) genes in six Polish atypical BSE cases and compared these results to the population of clinically healthy Polish Holstein cattle. No potentially pathogenic mutations were found in the PRNP ORF in atypical BSE-affected cattle, but our study showed a high frequency of deletions at the indel loci of PRNP promoter in these animals. Additionally, a rare sequence variation in the SPRN protein-coding sequence was found in one L-type atypical BSE-affected animal.

PRNP Haplotype Associated with Classical BSE Incidence in European Holstein Cattle

BackgroundClassical bovine spongiform encephalopathy (BSE) is an acquired prion disease of cattle. The bovine prion gene (PRNP) contains regions of both high and low linkage disequilibrium (LD) that appear to be conserved across Bos taurus populations. The region of high LD, which spans the promoter and part of intron 2, contains polymorphic loci that have been associated with classical BSE status. However, the complex genetic architecture of PRNP has not been systematically tested for an association with classical BSE.Methodology/Principal FindingsIn this study, haplotype tagging single nucleotide polymorphisms (htSNPs) within PRNP were used to test for association between PRNP haplotypes and BSE disease. A combination of Illumina goldengate assay, sequencing and PCR amplification was used to genotype 18 htSNPs and 2 indels in 95 BSE case and 134 control animals. A haplotype within the region of high LD was found to be associated with BSE unaffected animals (p-value = 0.000114).Conclusion/SignificanceA PRNP haplotype association with classical BSE incidence has been identified. This result suggests that a genetic determinant in or near PRNP may influence classical BSE incidence in cattle.

A 2cM genome-wide scan of European Holstein cattle affected by classical BSE

BackgroundClassical bovine spongiform encephalopathy (BSE) is an acquired prion disease that is invariably fatal in cattle and has been implicated as a significant human health risk. Polymorphisms that alter the prion protein of sheep or humans have been associated with variations in transmissible spongiform encephalopathy susceptibility or resistance. In contrast, there is no strong evidence that non-synonymous mutations in the bovine prion gene (PRNP) are associated with classical BSE disease susceptibility. However, two bovine PRNP insertion/deletion polymorphisms, one within the promoter region and the other in intron 1, have been associated with susceptibility to classical BSE. These associations do not explain the full extent of BSE susceptibility, and loci outside of PRNP appear to be associated with disease incidence in some cattle populations. To test for associations with BSE susceptibility, we conducted a genome wide scan using a panel of 3,072 single nucleotide polymorphism (SNP) markers on 814 animals representing cases and control Holstein cattle from the United Kingdom BSE epidemic.ResultsTwo sets of BSE affected Holstein cattle were analyzed in this study, one set with known family relationships and the second set of paired cases with controls. The family set comprises half-sibling progeny from six sires. The progeny from four of these sires had previously been scanned with microsatellite markers. The results obtained from the current analysis of the family set yielded both some supporting and new results compared with those obtained in the earlier study. The results revealed 27 SNPs representing 18 chromosomes associated with incidence of BSE disease. These results confirm a region previously reported on chromosome 20, and identify additional regions on chromosomes 2, 14, 16, 21 and 28. This study did not identify a significant association near the PRNP in the family sample set. The only association found in the PRNP region was in the case-control sample set and this was not significant after multiple test correction. The genome scan of the case-control animals did not identify any associations that passed a stringent genome-wide significance threshold.ConclusionsSeveral regions of the genome are statistically associated with the incidence of classical BSE in European Holstein cattle. Further investigation of loci on chromosomes 2, 14, 16, 20, 21 and 28 will be required to uncover any biological significance underlying these marker associations.

Identification of a Heritable Polymorphism in Bovine PRNP Associated with Genetic Transmissible Spongiform Encephalopathy: Evidence of Heritable BSE

BackgroundBovine spongiform encephalopathy (BSE) is a transmissible spongiform encephalopathy (TSE) of cattle. Classical BSE is associated with ingestion of BSE-contaminated feedstuffs. H- and L-type BSE, collectively known as atypical BSE, differ from classical BSE by displaying a different disease phenotype and they have not been linked to the consumption of contaminated feed. Interestingly, the 2006 US H-type atypical BSE animal had a polymorphism at codon 211 of the bovine prion gene resulting in a glutamic acid to lysine substitution (E211K). This substitution is analogous a human polymorphism associated with the most prevalent form of heritable TSE in humans, and it is considered to have caused BSE in the 2006 US atypical BSE animal. In order to determine if this amino acid change is a heritable trait in cattle, we sequenced the prion alleles of the only known offspring of this animal, a 2-year-old heifer.Principal FindingsSequence analysis revealed that both the 2006 US atypical BSE animal and its 2-year-old heifer were heterozygous at bovine prion gene nucleotides 631 through 633 for GAA (glutamic acid) and AAA (lysine). Both animals carry the E211K polymorphism, indicating that the allele is heritable and may persist within the cattle population.ConclusionsThis is the first evidence that the E211K polymorphism is a germline polymorphism, not a somatic mutation, suggesting BSE may be transmitted genetically in cattle. In the event that E211K proves to result in a genetic form of BSE, this would be the first indication that all 3 etiologic forms of TSEs (spontaneous, hereditary, and infectious) are present in a non-human species. Atypical BSE arising as both genetic and spontaneous disease, in the context of reports that at least some forms of atypical BSE can convert to classical BSE in mice, suggests a cattle origin for classical BSE.

Association of a Bovine Prion Gene Haplotype with Atypical BSE

BackgroundAtypical bovine spongiform encephalopathies (BSEs) are recently recognized prion diseases of cattle. Atypical BSEs are rare; approximately 30 cases have been identified worldwide. We tested prion gene (PRNP) haplotypes for an association with atypical BSE.Methodology/Principle FindingsHaplotype tagging polymorphisms that characterize PRNP haplotypes from the promoter region through the three prime untranslated region of exon 3 (25.2 kb) were used to determine PRNP haplotypes of six available atypical BSE cases from Canada, France and the United States. One or two copies of a distinct PRNP haplotype were identified in five of the six cases (p = 1.3×10−4, two-tailed Fisher's exact test; CI95% 0.263–0.901, difference between proportions). The haplotype spans a portion of PRNP that includes part of intron 2, the entire coding region of exon 3 and part of the three prime untranslated region of exon 3 (13 kb).Conclusions/SignificanceThis result suggests that a genetic determinant in or near PRNP may influence susceptibility of cattle to atypical BSE.

Short Communication: Allele, Genotype, and Haplotype Data for Bovine Spongiform Encephalopathy-Resistance Polymorphisms from Healthy US Holstein Cattle

Bovine spongiform encephalopathy (BSE) is a neurodegenerative disease of cattle caused by abnormally folded prion proteins. Two regulatory region polymorphisms in the bovine prion gene are associated with resistance to classical BSE disease: a 23-bp region in the promoter that contains a binding site for the repressor protein RP58, and a 12-bp region in intron 1 that has a binding site for the transcription factor SP1. The presence of these binding sites enhances BSE resistance in cattle, whereas cattle that lack these regions are more susceptible to the disease. The present study examined the allele, genotype, and haplotype frequencies for the 23-bp and 12-bp polymorphisms in Holstein cattle from 9 different US states, and these frequencies were compared with data previously established for Holstein cattle from the United Kingdom, Germany, and Japan. Additionally, the coding region of the prion gene was sequenced from the US samples. Finally, archival samples from US Holstein sires born between 1953 and 1957 were analyzed. We found that the resistant allele and genotype frequencies for the US Holstein cattle were as high, or higher, relative to that observed in other countries. Furthermore, the current US frequencies were comparable to those determined in the archival samples from the 1950s. Based on the frequencies of these regulatory region polymorphisms, the US Holstein population is not at a greater risk for BSE than Holsteins worldwide.

A sequencing strategy for identifying variation throughout the prion gene of BSE-affected cattle

BackgroundClassical and atypical bovine spongiform encephalopathies (BSEs) are cattle prion diseases. Distinct bovine prion gene (PRNP) alleles have been associated with classical and atypical BSE susceptibility. However, the full extent of PRNP allele association with BSE susceptibility is not known. A systematic sequence-based genotyping method that detects variation throughout PRNP would be useful for: 1) detecting rare PRNP alleles that may be present in BSE-affected animals and 2) testing PRNP alleles for an association with either classical or atypical BSE susceptibility.FindingsWe improved a Sanger-based sequencing strategy for detecting bovine PRNP variation through all exons, introns, and part of the promoter (25.2 kb). Our current method can detect 389 known and other potentially unknown PRNP polymorphisms that may be present in BSE-affected cattle. We determined PRNP genotypes for the first U.S. BSE case and her sire. Previously unknown PRNP polymorphisms were not detected in either animal and all PRNP genotypes support the sire-daughter relationship.ConclusionThe methodologies described here characterize variation throughout PRNP. Consequently, rare PRNP alleles that may be present in BSE-affected cattle can be detected.

Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology

BackgroundSince prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs.ResultsFour siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting.ConclusionFour siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.

Prion gene haplotypes of U.S. cattle

BackgroundBovine spongiform encephalopathy (BSE) is a fatal neurological disorder characterized by abnormal deposits of a protease-resistant isoform of the prion protein. Characterizing linkage disequilibrium (LD) and haplotype networks within the bovine prion gene (PRNP) is important for 1) testing rare or common PRNP variation for an association with BSE and 2) interpreting any association of PRNP alleles with BSE susceptibility. The objective of this study was to identify polymorphisms and haplotypes within PRNP from the promoter region through the 3'UTR in a diverse sample of U.S. cattle genomes.ResultsA 25.2-kb genomic region containing PRNP was sequenced from 192 diverse U.S. beef and dairy cattle. Sequence analyses identified 388 total polymorphisms, of which 287 have not previously been reported. The polymorphism alleles define PRNP by regions of high and low LD. High LD is present between alleles in the promoter region through exon 2 (6.7 kb). PRNP alleles within the majority of intron 2, the entire coding sequence and the untranslated region of exon 3 are in low LD (18.0 kb). Two haplotype networks, one representing the region of high LD and the other the region of low LD yielded nineteen different combinations that represent haplotypes spanning PRNP. The haplotype combinations are tagged by 19 polymorphisms (htSNPS) which characterize variation within and across PRNP.ConclusionThe number of polymorphisms in the prion gene region of U.S. cattle is nearly four times greater than previously described. These polymorphisms define PRNP haplotypes that may influence BSE susceptibility in cattle.

Frequencies of bovine PrP gene polymorphisms in Holstein and Japanese Black bulls in Japan

ABSTRACTWe screened for Japanese Black and Holstein bull sire samples to detect single nucleotide polymorphisms (SNPs) involving animo‐acid substitutions in the bovine prion gene in the entire coding region of the PRNP gene. Although three silent SNPs were found, we could not detect any SNP with animo‐acid substitution. We also examined the polymorphism of the octapeptide repeat number in these samples. There was no homozygous bull with repeat number 5. The frequency of heterozygous (6/5) bulls was 8% in the Japanese Black bull and 4% in the Holstein bull, respectively. The bull samples used in this study contain popular elite sires, so it appears that the polymorphisms of prion protein (PrP) are rather difficult to find in these two breeds in Japan, except for polymorphism of the octapeptide repeat number.

Complete genomic sequence of the bovine prion gene (PRNP) and polymorphism in its promoter region

Animal GeneticsVolume 32, Issue 4 p. 231-232 Complete genomic sequence of the bovine prion gene (PRNP) and polymorphism in its promoter region D. Hills, D. Hills Division of Genomics and Bioinformatics, Roslin Institute (Edinburgh), Roslin, Midlothian EH25 9PS, UK.Search for more papers by this authorS. Comincini, S. Comincini Dipartimento di Genetica e Microbiologia, Universita’ di Pavia, via Ferrata 1, 27100 Pavia, Italy.Search for more papers by this authorJ. Schlaepfer, J. Schlaepfer Institute of Animal Breeding, University of Berne, Bremgartenstrasse 109a, 3012 Berne, SwitzerlandSearch for more papers by this authorG. Dolf, G. Dolf Institute of Animal Breeding, University of Berne, Bremgartenstrasse 109a, 3012 Berne, SwitzerlandSearch for more papers by this authorL. Ferretti, L. Ferretti Dipartimento di Genetica e Microbiologia, Universita’ di Pavia, via Ferrata 1, 27100 Pavia, Italy.Search for more papers by this authorJ. L. Williams, J. L. Williams Division of Genomics and Bioinformatics, Roslin Institute (Edinburgh), Roslin, Midlothian EH25 9PS, UK.Search for more papers by this author D. Hills, D. Hills Division of Genomics and Bioinformatics, Roslin Institute (Edinburgh), Roslin, Midlothian EH25 9PS, UK.Search for more papers by this authorS. Comincini, S. Comincini Dipartimento di Genetica e Microbiologia, Universita’ di Pavia, via Ferrata 1, 27100 Pavia, Italy.Search for more papers by this authorJ. Schlaepfer, J. Schlaepfer Institute of Animal Breeding, University of Berne, Bremgartenstrasse 109a, 3012 Berne, SwitzerlandSearch for more papers by this authorG. Dolf, G. Dolf Institute of Animal Breeding, University of Berne, Bremgartenstrasse 109a, 3012 Berne, SwitzerlandSearch for more papers by this authorL. Ferretti, L. Ferretti Dipartimento di Genetica e Microbiologia, Universita’ di Pavia, via Ferrata 1, 27100 Pavia, Italy.Search for more papers by this authorJ. L. Williams, J. L. Williams Division of Genomics and Bioinformatics, Roslin Institute (Edinburgh), Roslin, Midlothian EH25 9PS, UK.Search for more papers by this author First published: 20 December 2001 https://doi.org/10.1046/j.1365-2052.2001.0769a.xCitations: 47 D. Hills, (e-mail: david.hills@bbsrc.ac.uk) Read the full textAboutPDF ToolsRequest permissionExport citationAdd to favoritesTrack citation ShareShare Give accessShare full text accessShare full-text accessPlease review our Terms and Conditions of Use and check box below to share full-text version of article.I have read and accept the Wiley Online Library Terms and Conditions of UseShareable LinkUse the link below to share a full-text version of this article with your friends and colleagues. Learn more.Copy URL Share a linkShare onFacebookTwitterLinked InRedditWechat No abstract is available for this article.Citing Literature Volume32, Issue4August 2001Pages 231-232 RelatedInformation

Isolation and molecular characterization of rasfadin, a novel gene in the vicinity of the bovine prion gene.

A novel gene, rasfadin (RASSF2) was identified close to the bovine prion gene, and its genomic structure was derived with a combination of exon trapping and RACE. The gene covers at least 28 kb and maps to the same chromosomal region as the prion gene in cattle, sheep, and human. The RASSF2 ORF is composed of 987 base pairs divided into nine exons and shows a high nucleotide (88%) and amino acid similarity (95%) with a previously described human cDNA, KIAA0168. The bovine 3'UTR region is significantly shorter than the human counterpart, but shares with it two highly conserved nucleotide blocks. The expression of the gene was investigated in brain, liver, and spleen. Alternative splicing yields a shorter product in the liver composed of only four exons. Computer analysis showed a highly significant similarity of the rasfadin protein with the Ras association (Ral-GDS/AF-6) domain family 2 and with the afadin family, respectively, for the longer brain/spleen and the shorter liver variants.

Structure and Comparative Analysis of the Bovine Prion Gene Locus

Structure and Comparative Analysis of the Bovine Prion Gene Locus

PCR-based setup for high-throughput cDNA library sequencing on the ABI 3700 automated DNA sequencer.

BioTechniquesVol. 29, No. 4 BenchmarksOpen AccessPCR-Based Setup for High-Throughput cDNA Library Sequencing on the ABI 3700™Automated DNA SequencerTimothy P.L. Smith, Renée A. Godtel & Robert T. LeeTimothy P.L. Smith*Address correspondence to Dr. Timothy P.L. Smith, USDA, ARS, U.S. Meat Animal Research Center, Spur 18D, PO Box 166, Clay Center, NE 68933, USA. e-mail: E-mail Address: smith@email.marc.usda.govUSDA, ARS, U.S. Meat Animal Research Center, Clay Center, NE, USASearch for more papers by this author, Renée A. GodtelUSDA, ARS, U.S. Meat Animal Research Center, Clay Center, NE, USASearch for more papers by this author & Robert T. LeeUSDA, ARS, U.S. Meat Animal Research Center, Clay Center, NE, USASearch for more papers by this authorPublished Online:29 Aug 2018https://doi.org/10.2144/00294bm05AboutSectionsPDF/EPUB ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinkedInReddit "PCR-Based Setup for High-Throughput cDNA Library Sequencing on the ABI 3700™Automated DNA Sequencer." , 29(4), pp. 698–700FiguresReferencesRelatedDetailsCited BySmall ruminant lentivirus genetic subgroups associate with sheep TMEM154 genotypes29 July 2013 | Veterinary Research, Vol. 44, No. 1Association of Nucleotide Polymorphisms within the O-Antigen Gene Cluster of Escherichia coli O26, O45, O103, O111, O121, and O145 with Serogroups and Genetic SubtypesApplied and Environmental Microbiology, Vol. 78, No. 18Comparison of bacterial communities in faeces of beef cattle fed diets containing corn and wet distillers’ grain with solubles13 June 2012 | Letters in Applied Microbiology, Vol. 55, No. 2A simple, rapid, efficient and inexpensive strategy for sequencing clones from cDNA libraries9 November 2010 | Biotechnology and Bioprocess Engineering, Vol. 15, No. 5Animal-to-Animal Variation in Fecal Microbial Diversity among Beef CattleApplied and Environmental Microbiology, Vol. 76, No. 14Association of a Bovine Prion Gene Haplotype with Atypical BSE19 March 2008 | PLoS ONE, Vol. 3, No. 3Molecular serotyping of Escherichia coli O111:H8Journal of Microbiological Methods, Vol. 69, No. 2Influence of anode pretreatment on its microbial colonizationJournal of Applied Microbiology, Vol. 102, No. 1Prion gene haplotypes of U.S. cattle8 November 2006 | BMC Genetics, Vol. 7, No. 1CHARACTERIZATION OF A NORMALIZED CDNA LIBRARY FROM BOVINE INTESTINAL MUSCLE AND EPITHELIAL TISSUES1 February 2007 | Animal Biotechnology, Vol. 16, No. 1Midgut and salivary gland transcriptomes of the arbovirus vector Culicoides sonorensis (Diptera: Ceratopogonidae)Insect Molecular Biology, Vol. 14, No. 2Transcriptome characterization elucidates signaling networks that control human ES cell growth and differentiation16 May 2004 | Nature Biotechnology, Vol. 22, No. 6Resistance gene homologues in Theobroma cacao as useful genetic markers21 March 2003 | Theoretical and Applied Genetics, Vol. 107, No. 2Evaluation of single-nucleotide polymorphisms in CAPN1 for association with meat tenderness in cattle1,2Journal of Animal Science, Vol. 80, No. 12Mapping microsatellite markers identified in porcine EST sequences 130 September 2002 | Animal Genetics, Vol. 33, No. 5Identification of the Single Base Change Causing the Callipyge Muscle Hypertrophy Phenotype, the Only Known Example of Polar Overdominance in Mammals13 September 2002 | Genome Research, Vol. 12, No. 10Sequence Evaluation of Four Pooled-Tissue Normalized Bovine cDNA Libraries and Construction of a Gene Index for Cattle1 April 2001 | Genome Research, Vol. 11, No. 4Current Awareness on Comparative and Functional GenomicsComparative and Functional Genomics, Vol. 2, No. 3 Vol. 29, No. 4 Follow us on social media for the latest updates Metrics Downloaded 154 times History Published online 29 August 2018 Published in print October 2000 Information© 2018 Author(s)PDF download

Polymorphism analysis of the prion gene in BSE‐affected and unaffected cattle

Polymerase chain reaction (PCR) primers designed to amplify the octapeptide repeat region of the bovine prion gene were used to test the association of genotypes with bovine spongiform encephalitis (BSE) in 56 BSE-affected and 177 unaffected animals. Three alleles (A,B,C) were detected as single-strand conformation polymorphisms (SSCPs) and two alleles (1,2--representing six or five copies of the octapeptide repeat respectively) were detected as amplified double-strand fragment length polymorphisms (AMFLPs). Observed genotypes of SSCPs and AMFLPs were analysed by chi-square. The SSCP genotypes of nuclear family members of animals with BSE and BSE-affected animals were different (P < 0.001, P < 0.01) from unrelated animals of the same breed without BSE. No genotypic differences were found between the BSE-affected animals and their relatives (P > 0.469). No AMFLP genotypic differences were detected between BSE-affected animals, their relatives, unrelated animals of the same breed or animals of different breeds (P > 0.05). These data suggest that BSE-affected animals and their relatives are more likely to have the AA SSCP genotype than unrelated animals of the same breed or animals of different breeds.

Bovine prion gene allele frequencies determined by ANFLP and RFLP analysis

Abstract Genetic resistance to bovine spongiform encephalopathy (BSE) may be determined in part by alleles of the prion gene. The frequencies of prion allelic structural variants and a silent marker were determined by nucleic acid analysis in selected United States bulls. The frequency of a variant of the prion gene reported in BSE‐affected British bulls was 0.97 in 210 U.S. Holstein bulls and 0.99 in 46 U.S. Hereford bulls examined in the present study. Near uniformity of the U.S. cattle population for this allele may constitute a risk factor if an association of prion genotype with BSE susceptibility is established in the future.