Blueberry Leaf Research Articles

Inhibition of adult T-cell leukemia cell proliferation by polymerized proanthocyanidin from blueberry leaves through JAK proteolysis.

We have previously reported that the proanthocyanidin (PAC) fraction of blueberry leaf extract (BB‐PAC) inhibits the proliferation of HTLV‐1‐infected adult T‐cell leukemia (ATL) by inducing apoptosis. In the present study, we further analyzed the structure of BB‐PAC and elucidated the molecular mechanism underlying the inhibitory function of HTLV‐1‐infected and ATL cells. After hot water extraction with fractionation with methanol‐acetone, BB‐PAC was found to be concentrated in fractions 4 to 7 (Fr7). The strongest inhibition of ATL cell growth was observed with Fr7, which contained the highest BB‐PAC polymerization degree of 14. The basic structure of BB‐PAC is mainly B‐type bonds, with A‐type bonds (7.1%) and cinchonain I units as the terminal unit (6.1%). The molecular mechanism of cytotoxicity observed around Fr7 against ATL cells was the degradation of JAK1 to 3 and the dephosphorylation of STAT3/5, which occurs by proteasome‐dependent proteolysis, confirming that PAC directly binds to heat shock protein 90 (HSP90). JAK degradation was caused by proteasome‐dependent proteolysis, and we identified the direct binding of PAC to HSP90. In addition, the binding of cochaperone ATPase homolog 1 (AHA1) to HSP90, which is required for activation of the cofactor HSP90, was inhibited by BB‐PAC treatment. Therefore, BB‐PAC inhibited the formation of the HSP90/AHA1 complex and promoted the degradation of JAK protein due to HSP90 dysfunction. These results suggest that the highly polymerized PAC component from blueberry leaves has great potential as a preventive and therapeutic agent against HTLV‐1‐infected and ATL cells.

Blueberry leaf mottle virus

Blueberry leaf mottle virus

Network Pharmacology Exploration Reveals Anti-Apoptosis as a Common Therapeutic Mechanism for Non-Alcoholic Fatty Liver Disease Treated with Blueberry Leaf Polyphenols.

Non-alcoholic fatty liver disease (NAFLD) is the most common chronic liver disease characterized by excessive fat accumulation in the liver. The aim of this study is to elucidate the multi-target mechanism of polyphenols in blueberry leaves (PBL) on NAFLD by network pharmacology and to validate its results via biological experiments. Twenty constituents in PBL were preliminarily determined by liquid chromatography-tandem mass spectrometry. Subsequently, 141 predicted drug targets and 1226 targets associated with NAFLD were retrieved from public databases, respectively. The herb-compound-target network and the target protein–protein interaction network (PPI) were established through Cytoscape software, and four compounds and 53 corresponding targets were identified. Gene Ontology (GO) enrichment and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment were performed to explore the biological processes of the predicted genes. The results of cell experiments demonstrated that PBL could significantly improve the viability of the NAFLD cell model, and the protein expressions of caspase-3 and Bcl-2 were consistent with the expected mechanism of action of PBL. Those results systematically revealed that the multi-target mechanism of PBL against NAFLD was related to the apoptosis pathway, which could bring deeper reflections into the hepatoprotective effect of PBL.

Disease-resistant identification and analysis to transcriptome differences of blueberry leaf spot induced by beta-aminobutyric acid.

Leaf spot (Pestalotiopsis microspora) is one of the major fungal diseases in blueberry (Vaccinium corymbosum L.) production and if not treated promptly that can eventually lead to plant death. To prevent and control leaf spot effectively, we selected BABA (beta-aminobutyric acid) as an inducer, "Canlan" in blueberries of rabbit eyes varieties as experimental material and then induced and inoculated leaf spot on blueberries as an experimental group and used uninduced blueberries inoculated with leaf spot as the control group. A transcriptome sequencing library was built, allowing identification of disease resistance and transcriptome analysis. The results showed that the resistance of blueberry to leaf spot was significantly increased after induction by BABA, which can increase the activity of the enzymes PPO, POD, PAL and and β-1,3-glucanase in blueberry leaves, inducing disease resistance of blueberries to leaf spot. Transcriptome sequencing results showed that there are 3953 genes participating in the processing of disease in KEGG metabolic pathways. Among the transcripts annotated to diseases, 1115 were involved in plant-pathogen interactions and 35 were involved in anthocyanin synthesis. Differential expression results showed that there were 900 upregulated differential genes and 531 downregulated differential genes, there were 70 genes highly expressed in the library. The results of Blast2PHI database revealed that among the genes related to leaf spot disease in blueberry, there were 727 transcription factors, 200 involved in disease prevention, 45 associated with cell circulation, effector proteins and 7 pathogenic genes controlling the biosynthesis of a-(1,3)-glucan.

Identification and Pathogenicity of <i>Diaporthe</i> spp. from Blueberry Leaf in Gangwon Province

Identification and Pathogenicity of <i>Diaporthe</i> spp. from Blueberry Leaf in Gangwon Province

First report of Tobacco ringspot virus in highbush blueberry in Washington State.

Since 2015, several blueberry plants (Vaccinium corymbosum) of cvs. Draper and Top Shelf in an organic farm in eastern Washington State showed reduced growth with deformed leaves displaying chlorotic spots, rings, and red blotches and producing small and poorly ripened berries. The symptomatic plants showed gradual decline within 2 to 3 years post-planting. In ELISA using antibodies (Agdia, Inc., USA) to Blueberry leaf mottle virus, Cherry leaf roll virus, Peach rosette mosaic virus, Strawberry latent ringspot virus, Tomato black ring virus, Tomato ringspot virus, and Tobacco ringspot virus [TRSV]), leaf samples from six symptomatic plants tested positive only to TRSV (Secoviridae: Nepovirus). Subsequently, total RNA was isolated from leaves of a symptomatic plant using the Spectrum™ Plant Total RNA Kit (Sigma-Aldrich, USA). High quality RNA was subjected to high-throughput sequencing (HTS) on the Illumina© NovaSeq™ platform (Huntsman Cancer Institute, UT, USA). An average of ~28 million 150-base pair (bp) paired-end reads obtained were subjected to quality filtering followed by de novo assembly using CLC Genomics Workbench (v12.0) and BLASTn analysis (http://www.ncbi.nlm.nih.gov/blast). Two contigs of 2,778 bp (average coverage: 11,031.7) and 3,589 bp (average coverage: 11,882) showed, respectively, a maximum of 97.3 and 97.6% nucleotide (nt) identity with TRSV RNA1 of a South Korean isolate (KJ556849). Another contig of 3,615 bp (average coverage: 7072.1) showed a maximum of 92.8% nt identity with TRSV RNA2 of an isolate from Iowa (MT563079). The HTS data revealed no other viral sequences reported from blueberry plants (Martin and Tzanetakis 2018). To further confirm the presence of TRSV, extracts of leaf samples from seven symptomatic and ten asymptomatic plants collected randomly from cvs. Draper and Top Shelf were tested by RT-PCR using primers specific to a region of the helicase gene of TRSV RNA1 (Forward: GACTACTGAGCAACATTGCAACTTCC, Reverse: GTCCCCTAACAGCATTGACTACC) and the coat protein gene of TRSV RNA2 (Forward: GCTGATTGGCAGTGTATTGTTAC, Reverse: GTGTTCGCATCTGGTTTCAAATTGG). An approximately 360 bp fragment specific to RNA1 and ~640 bp fragment specific to RNA2 were amplified only from symptomatic samples. Sanger sequence analysis of amplicons specific to RNA1 and RNA2 showed 98.1% and 96.8% nt identity with corresponding sequences of TRSV isolates from South Korea (KJ556849) and Iowa (MT563079), respectively. These results confirmed the presence of TRSV in symptomatic blueberry plants. The complete sequence of RNA1 (7,512 nt, MW495243) and RNA2 (3,925 nt, MW495244) genome segments of the blueberry isolate determined in this study showed 95.9 and 93.2% nt sequence identity, respectively, with corresponding TRSV sequences from South Korea (KJ556849) and Iowa (MT563079). Based on previous reports (Converse and Ramsdell 1982, Martin et al. 2012, Martin and Tzanetakis, 2018), this study represents the first report of TRSV infecting highbush blueberry in Washington State. Since the State has emerged as the national leader in blueberry production, the results will strengthen plant health certification standards to provide virus-tested propagative materials for domestic growers and export to the European Union.

Study on the Extraction of Polyphenols from Blueberry Leaves and their antioxidant properties

Blueberry leaf as materials, ethanol ultrasonic assisted extraction of blueberry polyphenols, ethanol concentration and solid-liquid ratio on blueberry ultrasonic time leaves influence the yield of polyphenols were researched, and the orthogonal experiment to optimize the ethanol ultrasonic assisted extraction technological conditions of blueberry leaf polyphenol polyphenols was used. The results showed that the optimal extraction conditions of polyphenols from blueberry leaves were as follows, 9.06% with 4min ultrasonic time, 80% ethanol concentration and 1:45 (g/mL) ratio. Ultrasonic assisted extraction is a convenient and high yield method, which is suitable for the extraction of polyphenols from blueberry leaves.

Биологические эффекты и оценка острой токсичности антикоагулянтов растительного происхождения

The aim of the study – was to study the biological effects and assess acute toxicity in an in vivo experimental study when injecting plant-derived effectors with an anticoagulant effect to laboratory animals. Materials and methods. As the studied effectors, plant anticoagulants obtained from the leaves of blueberry (Vaccinium myrtillus) and peloid, which were obtained in the previous studies, were used. The biological effect of effectors was evaluated by indicators characterizing coagulation and platelet hemostasis when administered to laboratory animals. Acute toxicity was assessed by the survival rate of animals after administration of effectors. Results. Blueberry leaf extract demonstrated an inhibitory effect on the development of reactions of the internal pathway of plasma coagulation and ADP – induced platelet aggregation. The effector obtained from sapropel significantly inhibits both plasma coagulation and platelet reactions. None of the effectors showed acute toxicity. Conclusion. As a result of this study, we consider the most promising peptide for further study, derived from peloid, as a promising direct-acting anticoagulant that affects the final pathway of plasma coagulation. The anticoagulant from blueberry leaves did not demonstrate the expected activity in the in vivo experiment, presumably due to the presence of impurities that neutralize its anticoagulant effect, and needs additional purification and evaluation.

Altitude Variation in Volatile Composition of Blueberry Leaf Analyzed by SPME GC-MS

Background: The present work was aimed to carry out volatile component analyzes in Vaccinium arctostaphlyos L., V. uliginosum L., V. vitis-idaea L. and V. myrtillus L leaf growing at different altitudes of the East Blacksea Region of Turkey. Methods: The leaf of Vaccinium species were harvested from twenty-one different altitudes (748-3035 m) from six cities (Artvin- Ardahan-Rize-Trabzon-Gumushane-Giresun) of Turkey. The diversity of volatiles in the leaf was investigated by SPME GC-FID/MS. Results: The major constituents of the Vaccinium leaf showed variation with changes in altitudes. The identified volatile components of V. arctostaphlyos and V. uliginosum were represented mainly by aldehydes in all altitudes, whereas monoterpenes were found the major constituent of V. vitis-idaea at Posof-Ardahan (2376 m) and Artvin (2553 m) samples. In all altitudes, capronaldehyde (7.23-28.96%) and 2(E)-hexenal (8.90-53.59%) in the leaf of V. arctostaphlyos; capronaldehyde (17.04-37.09%) and limonene (16.50- 47.51%) in the leaf of V. vitis-idaea and capronaldehyde (4.55-39.90%), 2(E)-hexenal (25.08-80.99%) and hexadecane (2.97-11.32%) in the leaf of V. uliginosum; and capronaldehyde (14.66-37.26%) and 2(E)-hexenal (18.18-37.59%) at the altitudes of 1912m, 2533 m and 2565 m in the leaf of V. myrtillus were the major constituents with the different percentages, respectively. 2-Bornanone (32.86%) at the altitude of 2613 m and 3-penten- 2-one (93.60%) at the altitude of 2811m in the leaf of V. myrtillus were found to be the major compounds. Conclusion: Comparisons of the volatile components of V. arctostaphlyos, V. uliginosum, V. vitis-idaea and V. myrtillus in different sites showed significant differences among populations at different altitudes.

Effects of phenolic compounds from blueberry leaves on the thermal decomposition of trimethylamine oxide in squid extract

Abstract The effects of chlorogenic acid and quercetin-3-D-galactoside on the decomposition of trimethylamine oxide (TMAO) in squid extract and the main mechanism of inhibition of thermal decomposition were studied. The results indicated that chlorogenic acid and quercetin-3-D-galactoside could inhibit decomposition of TMAO in squid extract. The amount of TMAO was increased by 11.79 and 15.76% in squid extract treated with chlorogenic acid and quercetin-3-D-galactoside from 0 and 2.5 g/L, respectively. The contents of trimethylamine (TMA), dimethylamine (DMA), and formaldehyde (FA) were significantly decreased with increasing contents of chlorogenic acid and quercetin-3-D-galactoside. There were many free radicals in squid extract at high temperatures; however, the free radical signals were weakened after the addition of chlorogenic acid and quercetin-3-D-galactoside therein. This implied that chlorogenic acid and quercetin-3-D-galactoside could inhibit the thermal decomposition of TMAO in squid extract, which was associated with the scavenging of their free radicals. This result provides a theoretical basis for the development and utilization of blueberry leaf extract as an efficient FA inhibitor for aquatic products.

First Report of Blueberry Leaf Rust Caused by Thekopsora minima on Vaccinium corymbosum in Peru

First Report of Blueberry Leaf Rust Caused by <i>Thekopsora minima</i> on <i>Vaccinium corymbosum</i> in Peru

Predicting the Pharmacologic Activity of Natural Materials Based on Metabolomics

Natural materials such as crude drugs and foods are mixtures composed of various metabolites. Metabolic profiling is often used to identify possible correlations between a compound's metabolic profile and pharmacologic activity. Direct-injection electron ionization-mass spectrometry (DI-EI-MS) is a novel metabolomics method useful for characterizing biological materials. This review demonstrates the establishment of a DI-EI-MS method for metabolic profiling using several closely related lichen species: Cladonia krempelhuberi, C. gracilis, C. pseudogymnopoda, and C. ramulosa. The qualitative DI-EI-MS method was used to profile major and/or minor constituents in extracts of lichen samples. Each lichen sample could be distinguished by altering the DI-EI-MS electron energy and examining the resulting data using one-way analysis of variance. We also attempted to predict pharmacologic activity using DI-EI-MS metabolomics. Blueberry leaf extracts inhibited the proliferation of adult T-cell leukemia (ATL) cells. Blueberry leaf extracts could be distinguished by principal component analysis based on the absolute intensity of characteristic fragment ions. Twenty cultivars were categorized into four species, and the most appropriate discriminative marker m/z value for identifying each cultivar was selected statistically. Components extracted based on DI-EI-MS analyses could be used to construct a model to predict ATL cell bioactivity. These data suggest that the novel DI-EI-MS metabolomics method is suitable for identifying species of natural materials and predicting their pharmacologic activity. This approach could enhance public health by facilitating evaluations of pharmacologic activity and functionality, leading to the elimination of counterfeit products.

Noni (Morinda citrifolia) fruit polysaccharide films containing blueberry (Vaccinium corymbosum) leaf extract as an antioxidant packaging material

Novel biodegradable noni (Morinda citrifolia) fruit polysaccharide (NPS) films containing blueberry (Vaccinium corymbosum) leaf extract (BLE) at various concentrations (0.4, 0.7, and 1.0%) were prepared and characterized. The prepared NPS films had good tensile strength and Young's modulus, whereas the incorporation of BLE into the films as an antioxidant decreased both the values. The addition of BLE effectively enhanced the antioxidant activities of the NPS films, which was the result of phenolic compounds present in BLE. Moreover, the NPS films with BLE had greater water vapor permeability than that of the neat NPS films, which was closely related to microstructural changes in the films. Increased surface roughness of the films following the addition of BLE was also observed in micrographs of the film surface and average roughness. These results suggest that NPS films containing BLE have the potential to serve as antioxidant packaging material.

Combination of beneficial bacteria improves blueberry production and soil quality.

Blueberry is an important agricultural crop with high nutritional, health, and economic value. Despite the well‐studied blueberry cultivation methods and soil requirements, little is known about how beneficial bacteria function in organic blueberry cultivation systems and their effects on acidic soils. In this study, a single bacteria Bacillus amyloliquefaciens JC65 and three biocontrol bacteria consortiums containing JC65 were applied to organic system. The effect of bacteria to blueberry growth, yield, fruit quality, and soil quality was investigated. A consortium of three mixed Bacillus (B. amyloliquefaciens JC65, B. licheniforims HS10 and B. subtilis 7ze3) showed the highest growth improvement efficiency. The bacterial inoculation increased blueberry leaf chlorophyll content, net photosynthetic rate by 21.50%, 13.21% at 30 days, and increased average plant height by 2.72% at 69 days. Compared with the control, the inoculated plants showed an increased yield of 14.56%. Interestingly, blueberry fruit quality was also improved with supplement of the bacterial consortium. Fruit anthocyanin, soluble sugar, vitamin C, soluble solids, and soluble protein content were increased by 5.99%, 4.21%, 17.31%, 2.41%, and 21.65%, respectively. Besides, beneficial bacterial consortium also enables sustainable agriculture by improving soil ammonium nitrogen and organic matter by 3.77% and 2.96% after blueberry planting. In conclusion, the combination of beneficial bacteria showed a synergistic activity in organic system to promote the blueberry yield, fruit quality, and soil nutrient preservation.

The Chemical and Biological Profiles of Leaves from Commercial Blueberry Varieties.

Blueberries have seen an ascending production line boosted by World Health Organization (WHO) approvals for their contributions to a healthy diet and the evidence that they act against different diseases. This increase resulted in significant amounts of discarded leaves, which could be a valuable source of bioactive compounds. In the present study, ultrasound-assisted extraction technology was used to determine and compare the chemical and biological profiles of leaves from six commercial blueberry (Vaccinium corymbosum L.) varieties. Feruloylquinic acid was the major compound identified, ranging from 19.23 ± 0.18 mg/g (at the lowest level, registered in the Spartan variety) to 49.62 ± 0.41 mg/g (at the highest level, registered in the Nelson variety). Rutin was the second major compound identified, for which Toro, Nelson, and Elliot leaves registered the highest values, with 35.77 ± 0.19 mg/g, 32.50 ± 0.20 mg/g, and 31.53 ± 0.1 mg/g, respectively. Even though analogous polyphenols were detected in the six cultivars, their concentrations and amounts were different. The leaf extracts of the cultivars Toro, Elliot, and Nelson appear to be good sources of antioxidants, registering high percentage inhibitions of DPPH radicals, of 70.41%, 68.42%, and 58.69%, respectively. The blueberry leaf extracts had a strong antibacterial activity and a low antifungal capacity, and a low-to-moderate antimutagenic capacity towards Salmonella typhimurium TA98 and TA100 strains, with Toro leaf being the best candidate. All of these biological activities indicate health-related benefits, recommending them as suitable candidates for medical and pharmaceutical applications. The present paper adds significant knowledge to the field of blueberry leaves via chemical and biological profiles, supporting the ultrasound-assisted extraction technique as a useful and green method to provide alternative sources of bioactive compounds.

Определение технологических свойств листьев и плодов голубики

Определение технологических свойств листьев и плодов голубики

Pest survey card on Thekopsora minima

This pest survey card was prepared in the context of the EFSA mandate on plant pest surveillance (M-2017-0137) at the request of the European Commission. Its purpose is to guide the Member States in preparing data and information for Thekopsora minima surveys. These are required to design statistically sound and risk-based pest surveys, in line with current international standards.Thekopsoraminimais not regulated in the EUbut is included in theEPPO A2 list of pests recommended for regulationas a quarantine pest. It is the causal agent of blueberry leaf rust on the American highbush blueberry (Vacciniumcorymbosum). In the EU, the pathogen has been reported in Belgium, Germany, the Netherlands, Portugal and Spain. Host availability seems to be the only limit to the spread of the pest due to its broad climatic tolerance.Surveys should be performed mainly in spring or autumn (in regions with a Mediterranean climate) or late summer and the beginning of autumn (in temperate climates). Detection surveys should mainly target Vaccinium corymbosumin nurseries, plantations and naturalised plants, whereas for delimiting surveys Tsuga and Rhododendron spp.should also be monitored.Surveillance of Thekopsora minima in the EU should focus onthe visible symptoms on Vacciniumplants caused bythe uredinialstage of the fungus that can be identified morphologically by experts. However, reliable identification of T. minima requires molecular methods and DNA sequence analysis.

Wild Strawberry, Blackberry, and Blueberry Leaf Extracts Alleviate Starch-Induced Hyperglycemia in Prediabetic and Diabetic Mice

Intestinal α-glucosidase and α-amylase break down nutritional poly- and oligosaccharides to monosaccharides and their activity significantly contributes to postprandial hyperglycemia. Competitive inhibitors of these enzymes, such as acarbose, are effective antidiabetic drugs, but have unpleasant side effects. In our ethnopharmacology inspired investigations, we found that wild strawberry (Fragaria vesca), blackberry (Rubus fruticosus), and European blueberry (Vaccinium myrtillus) leaf extracts inhibit α-glucosidase and α-amylase enzyme activity in vitro and are effective in preventing postprandial hyperglycemia in vivo. Toxicology tests on H9c2 rat embryonic cardiac muscle cells demonstrated that berry leaf extracts have no cytotoxic effects. Oral administration of these leaf extracts alone or as a mixture to normal (control), obese, prediabetic, and streptozotocin-induced diabetic mice attenuated the starch-induced rise of blood glucose levels. The efficiency was similar to that of acarbose on blood glucose. These results highlight berry leaf extracts as candidates for testing in clinical trials in order to assess the clinical significance of their effects on glycemic control.

Phytotherapy using blueberry leaf polyphenols to alleviate non-alcoholic fatty liver disease through improving mitochondrial function and oxidative defense

BackgroundSince non-alcoholic fatty liver disease (NAFLD) pathogenesis is multi-factorial, pharmacotherapy with a specific target commonly exhibits limited efficacy. Phytotherapy, whose therapeutic efficacy is based on the combined action of several active compounds, offers new treatment opportunity for NAFLD. As a representative, many natural polyphenols could be utilized in phytotherapy for NAFLD. PurposeIn present work, we aimed to investigate the therapeutic effects and underlying mechanism of polyphenols in blueberry leaves (PBL) on NAFLD from a mitochondria-centric perspective since mitochondrial dysfunction could play a dominant role in NAFLD. MethodsIdentification and quantification of PBL were performed using liquid chromatography coupled with tandem mass spectrometry. The beneficial effects, especially improving mitochondrial function, and potential mechanism of PBL on NAFLD were studied by in vitro and in vivo study. ResultsPolyphenols were abundant in blueberry leaves making it advantaged in NAFLD phytotherapy. PBL effectively alleviated hepatic steatosis, oxidative stress and inflammation as indicated by both in vitro and in vivo study. Furthermore, PBL mediated improvement of mitochondrial dysfunction and antioxidant capability through activation of AMPK/PGC-1α/SIRT3 signaling axis. ConclusionConsidering that mitochondrial dysfunction takes precedence over hepatic steatosis and induces NAFLD development, we conclude that PBL improve mitochondrial dysfunction and oxidative defense, subsequently alleviate hepatic steatosis, oxidative stress and inflammation, and eventually alleviate NAFLD.

The Anti-Proliferative and Anti-Invasive Effect of Leaf Extracts of Blueberry Plants Treated with Methyl Jasmonate on Human Gastric Cancer In Vitro Is Related to Their Antioxidant Properties.

Gastric cancer is the third main cause of cancerous tumors in humans in Chile. It is well-accepted that a diet rich in antioxidant plants could help in fighting cancer. Blueberry is a fruit crop with a high content of antioxidants. Methyl jasmonate (MeJA) is a phytohormone involved in plant defenses under stress conditions. The exogenous application of MeJA can improve the antioxidant properties in plants. We studied in vitro and in vivo anticancer action on human gastric cancer (cell line AGS) and the antioxidant properties of extracts from blueberry plants untreated and treated with MeJA. The results demonstrated that leaf extracts displayed a higher inhibition of cancer cell viability as well as greater antioxidant properties compared to fruit extracts. Besides, MeJA applications to plants improved the antioxidant properties of leaf extracts (mainly anthocyanins), increasing their inhibition levels on cell viability and migration. It is noteworthy that leaf extract from MeJA-treated plants significantly decreased cancer cell migration and expression of gastric cancer-related proteins, mainly related to the mitogen-activating protein kinase (MAPK) pathway. Interestingly, in all cases the anticancer and antioxidant properties of leaf extracts were strongly related. Despite highlighted outcomes, in vivo results did not indicate significant differences in Helicobacter pylori colonization nor inflammation levels in Mongolian gerbils unfed and fed with blueberry leaf extract. Our findings demonstrated that MeJA increased antioxidant compounds, mainly anthocyanins, and decreased the viability and migration capacity of AGS cells. In addition, leaf extracts from MeJA-treated plants were also able to decrease the expression of gastric cancer-related proteins. Our outcomes also revealed that the anthocyanin-rich fraction of blueberry leaf extracts showed higher in vitro antiproliferative and anti-invasive effects than the crude leaf extracts. However, it is still uncertain whether the leaf extracts rich in anthocyanins of blueberry plants are capable of exerting a chemopreventive or chemoprotective effect against gastric cancer on an in vivo model.