Blepharophimosis-ptosis-epicanthus Inversus Syndrome Research Articles

Deletion of cis-regulatory Element in FOXL2 Promoter in a Chinese Family of Type II Blepharophimosis-ptosis-epicanthus Inversus Syndrome with Polydactyly.

Blepharophimosis-ptosis-epicanthus inversus syndrome (BPES) is a relatively uncommon autosomal-dominant genetic disorder, primarily attributed to mutations in the forkhead box L2 (FOXL2) gene. Albeit the involvement of protein-coding regions of FOXL2 has been observed in the majority of BPES cases, whether deficiencies in regulatory elements lead to the pathogenesis remains poorly understood. Herein, an autosomal-dominant BPES type II family was included. Peripheral venous blood has been collected, and genomic DNA has been extracted from leukocytes. A whole exome sequencing analysis has been performed and analyzed (Deposited in NODE database: OER422653). The promoter region of FOXL2 was amplified using polymerase chain reaction (PCR). The luciferase reporter assay was performed to identify the activity of this region. In this study, we present a Chinese family diagnosed with type II BPES, characterized by the presence of small palpebral fissures, ptosis, telecanthus, and epicanthus inversus. Notably, all male individuals within the family display polydactyly. A 225-bp deletion in the 556-bp 5'-upstream to transcription start site of FOXL2 , decorated by multiple histone modifications, was identified in affected members of the family. This deletion significantly decreased FOXL2 promoter activity, as measured by the luciferase assay. Conclusively, a novel 255-bp-deletion of the FOXL2 promoter was identified in Chinese families with BPES. Our results expand the spectrum of known FOXL2 mutations and provide additional insight into the genotype-phenotype relationships of the BPES pathogenesis. In addition, this study indicates the important role of genetic screening of cis-regulatory elements in testing heritable diseases.

Improvement of one-stage comprehensive operation technique for blepharophimosis-ptosis-epicanthus inversus syndrome.

This retrospective case series aimed to evaluate the clinical effect of a modified one-stage comprehensive surgical method for blepharophimosis-ptosis-epicanthus inversus syndrome (BPES). Twenty-five patients with BPES underwent a modified reverse Z-plastic surgery method to change the Epicanthus into two unequal V-shaped flaps and suture them alternately. The medial canthus ligament was partially incised, shortened, and sutured; the outer canthus was opened with a "V-Y" flap. The gray line of the outer canthus was cut to extend the eyelid margin length. Ptosis was corrected using the orbicularis oculi-frontalis cross-flap technique. We studied the internal canthal distance (IICD), interpupillary distance (IPD), horizontal palpebral fissure length (HPFL), marginal reflex distance-1 (MRD-1), IICD/IPD ratio, IICD/HPLF ratio, Vancouver Scar Scale (VSS), and overall postoperative satisfaction. The 25 patients included 12 females and 13 males (8.3±6.8 years), 19 of whom had a family history of BPES. The mean value of IPD was 50.15±7.43 mm. IICD decreased from 39.38±2.39 mm preoperatively to 31.64±2.37 mm postoperatively, IICD/IPD from 0.80±0.12 preoperatively to 0.64±0.07 postoperatively (p<0.05), and IICD/HPLF from 1.98±0.33 preoperatively to 1.22±0.10 postoperatively (p<0.01). HPLF increased from 20.08±3.53 mm preoperatively to 26.04±1.36 mm postoperatively (p<0.01) and MRD-1 from -1.12±0.71 mm preoperatively to 3.24±0.47 mm postoperatively (p<0.01). The postoperative VSS score was 3.68 ±1.07. The patients' satisfaction was 8.8±1.08, with a relatively high overall satisfaction. The corrective effect on patients with BPES was noticeable, improving the IICD/HLFL and IICD/IPD ratios. Postoperative scars were not evident, and patient satisfaction was high.

A rare association of blepharophimosis–ptosis–epicanthus inversus syndrome with unilateral posterior persistent fetal vasculature

Blepharophimosis–ptosis–epicanthus inversus syndrome (BPES) is a rare genetic syndrome characterized by dysmorphism of ocular adnexa. We report a rare presentation of BPES and posterior persistent fetal vasculature (PFV) in a 10-year-old male child. A thorough evaluation showed all the classical features of BPES, calcified cataract in the left eye, and an echogenic mass arising from the optic disc with blood flow characteristic consistent with PFV. The coexistence of BPES and posterior PFV has never been reported in the literature before, and their co-occurrence poses a unique surgical challenge.

A Rare Case of Blepharophimosis, Ptosis, Epicanthus Inversus Syndrome with Antimongloid Slant: Case Report

Blepharophimosis, ptosis, epicanthus inversus syndrome (BPES) is a rare genetic condition caused by a mutation in the FOXL2 gene and it is inherited in an autosomal dominant pattern. Identification and diagnosis of BPES syndrome by an ophthalmologist are relatively easy, based on the characteristic ocular manifestations. The most common age group at the time of diagnosis is 4 to 8 years. Here, we present a case of BPES in a patient who presented to our OPD side with the syndrome at the age of 20 years. There is a need for increased awareness about this condition among ophthalmologists, as early diagnosis is the key factor in preventing long-term complications.

Bilateral cataract in a child with blepharophimosis-ptosis-epicanthus inversus syndrome: A surgical challenge

IntroductionBlepharophimosis-ptosis-epicanthus inversus syndrome (BPES) is a rare autosomal dominant genetic disorder characterized by complex orbito-palpebral anomalies. We report a rare case of BPES associated with bilateral congenital cataract.ObservationThis study reports the case of a 6-month-old infant with BPES in whom a bilateral congenital cataract was diagnosed, after the parents noticed leukocoria and signs of poor vision in their child. No other ophthalmologic manifestations commonly associated with this syndrome were found. The infant underwent cataract surgery first, with lens phacoaspiration and posterior capsulotomy coupled with anterior vitrectomy and placement of a 3-piece foldable hydrophobic posterior chamber lens in the capsular bag. The surgery was a real challenge due to the orbito-palpebral anomalies that limited a small surgical space, and the placement of the IOL was a matter of discussion.DiscussionPublications on the association of congenital cataract with BPES are very rare. The link between these two anomalies is difficult to establish since different genes on different chromosomes code for the two diseases. A lateral canthotomy can be considered to overcome the surgical difficulties due to the reduced working space. The surgical management of pediatric cataract varies in the literature.ConclusionThis case highlights the difficulty of cataract surgery in children, even more so when associated with BPES, and the challenge of improving vision in these children given the high risk of amblyopia.

Planned oocyte cryopreservation in women with blepharophimosis-ptosis-epicanthus inversus syndrome: a case series

ObjectiveTo describe the experiences of three women with blepharophimosis-ptosis-epicanthus inversus syndrome (BPES) who desired to pursue planned oocyte cryopreservation.DesignCase series.SettingAn academic institution and a private clinic.Patient(s)Three nulligravid women aged 23, 25, and 34 years who desired to pursue planned oocyte cryopreservation. Two women had BPES diagnosed when they were infants and one had BPES diagnosed after presenting to discuss oocyte cryopreservation.Intervention(s)All three women underwent ovarian stimulation. One woman underwent three oocyte retrievals.Main Outcomes Measure(s)Vitrification of metaphase II oocytes.Result(s)One woman had a total of eight metaphase II oocytes vitrified. In addition, she underwent genetic testing that confirmed type 1 BPES. The other two women, who had BPES diagnosed when they were newborns, each underwent two cycles of ovarian stimulation. Neither of these two women responded to ovarian stimulation and both cycles were cancelled before oocyte retrieval.Conclusion(s)BPES is a rare condition that can lead to primary ovarian insufficiency. Early identification of this condition is important to allow for timely reproductive counseling so that oocyte cryopreservation can be offered at a young age before oocyte depletion. Careful counseling is critical for these patients, because this case series demonstrated that not all women with BPES will respond to stimulation. Further, outcomes with cryopreserved oocytes have not yet been described in women with BPES.

"Blepharophimosis-plus" syndromes: Frequency of systemic genetic disorders that also include blepharophimosis.

To determine the frequency of isolated blepharophimosis-ptosis-epicanthus inversus syndrome (BPES) versus systemic genetic disorders in patients presenting with blepharophimosis. Retrospective clinical records review. The records of all patients with blepharophimosis seen in the Division of Ophthalmology at the Children's Hospital of Philadelphia during a 12-year-period (2009-2020) were reviewed for medical history, clinical examination findings and results of genetic analyses. The 135 patients identified with blepharophimosis included 72 females (53%) and 63 males (47%) whose mean ± standard deviation age at first visit was 3.5 ± 6.4 years (range 0-39.8 years). Sixty-seven of the patients (50%) had undergone genetic testing for FOXL2 gene mutation. Fifty-four (81%) harboured FOXL2 gene mutations and 13 (19%) did not. Altogether, 126 patients (93%) had a final diagnosis of isolated BPES. The remaining nine (7%) had syndromic diagnoses ("blepharophimosis-plus"), including Dubowitz syndrome (n=2), Ohdo syndrome (n=1), 22q11.2 duplication (n=1) and 3q22 deletion (n=2). Three patients with multiple congenital anomalies remain undiagnosed. Blepharophimosis is an eyelid feature occurring most commonly in isolation due to FOXL2 gene mutation, but can also be a harbinger of multisystem disease not exclusive to isolated BPES, as observed in 7% of cases in this series. The ophthalmologist is often the first to recognise these unique features, and must consider and rule out non-BPES syndromes before establishing a diagnosed classic BPES. A comprehensive genetic evaluation is, therefore, indicated in all cases.

Identification of a novel FOXL2 mutation in a fourth-generation Chinese family with blepharophimosis-ptosis-epicanthus inversus syndrome.

To characterize the genetic causes and clinical features in a four-generation Chinese family with blepharophimosis-ptosis-epicanthus inversus syndrome (BPES). Thirteen patients with BPES and eight healthy family members were included in this study. All participants received routine ophthalmic examinations. The target next-generation sequencing (NGS) was performed to determine the causative mutation for this family. The silico analysis was also applied to predict the pathogenesis of identified mutations. All patients had severe ptosis, normal intelligence, female patients have normal fertility. Genetic assessments revealed a heterozygous insertion variation in FOXL2 gene, c.672_701insGCGGCTGCCGC CGCAGCTGCTG CAGGCGCT (p.Ala234_Gly235linsAAAAAAAAGA), carried by 13 patient but absent in all unaffected members. In silico analysis supported the pathogenic nature of this highly conserved variant. This mutation resulted in the insertion of 10 amino acids into the encoded polyala nine chain, which increased the number of original polyalanine chains from 14 to 24, resulting in an extended protein. A novel FOXL2 mutation c.672_701ins GCGGCTGCCGCCGCAGCTGCTGC AGGCGCT (p.Ala234_Gly235linsAAAAAAAAGA) was identified in a large Chinese family with BPES. This study amplified the genotypic spectrum of FOXL2-BPES and better illustrates its genotype-phenotype correlations, which provided a basis for elucidating the pathogenesis of BPES and genetic counseling.

Functional Studies of Novel FOXL2 Variants in Chinese Families With Blepharophimosis-Ptosis-Epicanthus Inversus Syndrome.

The blepharophimosis–ptosis–epicanthus inversus syndrome (BPES) is a rare autosomal dominant disease mainly caused by FOXL2 variants. This genetic disorder is usually characterized by eyelid malformation and ovarian dysfunction. However, no reliable genotype/phenotype correlations have been established considering the ovarian phenotype. Here, we detected 15 FOXL2 variants including nine novel ones from 7 families and 8 sporadic cases, which expanded the spectrum of FOXL2 variants and identified a potential clinical cause. Functional studies, with respect to the effect of FOXL2 on the StAR promoter, showed that non-sense variants that lead to protein truncation before the polyalanine tract and missense variants [c.307C > T; p.(Arg103Cys), c.311A > C; p.(His104Pro), c.320G > A; p.(Ser107Asn), and c.335T > A; p.(Phe112Tyr)] within the central portion of the FOXL2 forkhead domain significantly affect its suppressor activity. Such changes may explain the mechanism underlying a more severe phenotype, more likely to result in BPES type I. Furthermore, the missenses variants c.307C > T; p.(Arg103Cys), c.311A > C; p.(His104Pro), and c.320G > A; p.(Ser107Asn) were not able to transactivate OSR2, which is consistent with the eyelid malformation in these patients. The results from our cohort have expanded the spectrum of FOXL2 variants and have provided insights into genotype/phenotype correlations.

Triple trouble: Congenital nasolacrimal duct obstruction, cleft palate, and sensorineural hearing loss - A rare association of blepharophimosis-ptosis-epicanthus inversus syndrome

Blepharophimosis-ptosis-epicanthus inversus syndrome (BPES) is autosomal dominant disorder affecting 200 families worldwide. It is marked by bilateral ptosis with poor levator function, shortened horizontal palpebral fissures, and epicanthus inversus. We report a case of 7-month-old female child who presented to us with watering of both eyes since birth and failure to thrive. Examination revealed peculiarities of BPES with bilateral congenital nasolacrimal duct obstruction (CNLDO) and associated findings of bilateral sensorineural hearing loss (SNHL) and cleft palate. Initially, conservative management followed by probing, cleft palate correction, and V-Y plasty was advised and ptosis correction planned at later age. There are several ocular and nonocular associations with BPES, but CNLDO, cleft palate, and SNHL together have never been reported to the best of our knowledge.

Prise en charge du syndrome de blépharophimosis ptôsis épicanthus inversus (SBPE) dans un centre de référence en Tunisie

Blepharophimosis ptosis epicanthus inversus syndrome (BPES) is a rare congenital hereditary abnormality. It includes complex orbital-palpebral malformations, causing aesthetic and functional ramifications. Management of BPES requires two steps: diagnosis and treatment. We performed a retrospective descriptive study of 44 patients (88 eyelids) with blepharophimosis-ptosis-epicanthus inversus syndrome (BPES). In our series, we opted for two-stage surgery in 28 cases: epicanthus-telecanthus surgery followed by ptosis surgery. Simultaneous surgery was performed in 5 cases. The mean age at the first visit was 6 years (6.1±6.4). The mean age of our patients at the time of the first surgery was 6.6 years. Epicanthus surgery was performed in 35 cases. The two techniques used to correct epicanthus were Y-V plasty in 30 cases (85.7%, n=35) and Y-V+double Z plasty in 5 cases (14.3%, n=35). Correction of the telecanthus was performed at the same time by a medial canthal tendon plication in 31 cases (88.6%, n=35) or transnasal canthopexy in 4 cases (11.4%, n=35). The mean age at the time of ptosis surgery was 7.23 years (±6.25), ranging from 8 months to 27 years. Ptosis surgery was performed in 41 cases (79 eyelids), of which 3 patients underwent unilateral ptosis surgery due to asymmetrical ptosis. The techniques used were levator resection in 64 eyelids and frontal suspension in 15 eyelids. BPES is often clinically diagnosed. The difficulty in management lies in the complex surgery required. There is no established consensus regarding surgical techniques or the timing of the surgeries.

Мутации гена FOXL2 при синдроме «Блефарофимоз-птоз-обратный эпикант»

Синдром «Блефарофимоз-птоз-обратный эпикант» (БПЭС) - заболевание, характеризующееся пороками развития век: птозом, блефарофимозом и наличием обратного эпиканта или телеканта. БПЭС у женщин может сопровождаться синдромом преж-девременного истощения яичников и связанным с ним бесплодием. В настоящей работе суммированы результаты генетического исследования 24 больных из 19 неродственных семей с направительным диагнозом БПЭС. В результате анализа всей кодирующей последовательности гена FOXL2 мутации выявлены в 10 неродственных семьях Blepharophimosis-Ptosis-Epicanthus inversus syndrome (BPES) is a disease characterized by malformations of the eyelids: ptosis, blepharophimosis and the presence of a reverse epicant or telecant (BPES). This syndrome in women can be accompanied by a premature ovarian exhaustion syndrome and related infertility. This work summarizes the results of FOXL2 gene analysis for 24 patients from 19 unrelated families with an incoming diagnosis. Mutations were detected in 10 unrelated families

Premature ovarian insufficiency as a variable feature of blepharophimosis, ptosis, and epicanthus inversus syndrome associated with c.223C\u2009>\u2009T p.(Leu75Phe) FOXL2 mutation: a case report

BackgroundFOXL2 gene mutations cause blepharophimosis-ptosis-epicanthus inversus syndrome (BPES) and may be associated with premature ovarian insufficiency (POI). Two types of BPES were described in the literature. BPES type 2 is a simple association of inherited developmental defects of the eyelid area, while in type 1 female patients additionally suffer from POI. The following case study is the first report of endocrine impairments typical for menopausal transition in young female with NG_012454.1:g.138665342G > A, c.223C > T p.(Leu75Phe), mutation in FOXL2 gene. This mutation has been reported in the literature before, however until now, it was never linked to BPES type 1.Case presentationAn 18-year-old nulliparous woman suspected of secondary amenorrhea was referred to our Endocrinology Outpatient Clinic. Blood tests revealed decreased levels of AMH (anti-Mullerian hormone) and increased levels of gonadotropins, suggesting menopausal transition. Her past medical history was remarkable for several ophthalmic defects that has required surgical interventions. BPES syndrome had not been suspected before, although the patient had reported a similar phenotype occurring in her father, sister and half-sister. Venous blood samples were collected from the female proband and from her three family members. Whole-exome sequencing and deep amplicon sequencing were performed. A potential pathogenic variant in the FOXL2 gene was revealed. Namely, the c.223C > T p.(Leu75Phe) missense variant was detected.ConclusionsThe authors found mutations, c.223C > T p.(Leu75Phe) in the FOXL2 gene in a young woman with hormonal disorders suggesting menopausal transition. These results indicate that the possibility of different phenotypes should be considered in patients with a similar genetic mutation.

New STAT3-FOXL2 pathway and its function in cancer cells

BackgroundThe forkhead transcription factor (FOXL2) plays a crucial role in blepharophimosis-ptosis-epicanthus inversus syndrome (BPES), sex determination, ovary growth and development, and cell cycle regulation. Emerging investigations have focused on the downstream targets of FOXL2, while little is known about its upstream regulation.ResultsIn this study, we show that FOXL2 could be regulated by STAT3 in cancer cells and that STAT3 binds to FOXL2 at the 5′- GCCTGATGTTTGTCTTCCCAGTCTGTGGCAA-3′ site using EMSA and ChIP. We further found that knockdown of STAT3 or FOXL2 could significantly induce cancer cell apoptosis, indicating the importance of these two genes in cancer cell growth and apoptosis. Our data also indicated that the increased apoptotic cell rate may be caused by changes in apoptosis-related genes, such as TNF, TRAIL and GnRHR.ConclusionThis study presents a new upstream regulator of FOXL2 and demonstrats that this new STAT3-FOXL2 pathway has an important function in HeLaHeLa cell apoptosis, providing new insights regarding the targeting of FOXL2 for cancer prevention and treatment.

Clinical characterization and identification of five novel FOXL2 pathogenic variants in a cohort of 12 Mexican subjects with the syndrome of blepharophimosis-ptosis-epicanthus inversus

Blepharophimosis-ptosis-epicanthus inversus syndrome (BPES) is an autosomal dominant entity characterized by eyelid malformations and caused by mutations in the forkhead box L2 (FOXL2) gene. Clinical and genetic analyses of large cohorts of BPES patients from different ethnic origins are important for a better characterization of FOXL2 mutational landscape. The purpose of this study is to describe the phenotypic features and the causal FOXL2 variants in a Mexican cohort of BPES patients. A total of 12 individuals with typical facial findings were included. Clinical evaluation included palpebral measurements and levator function assessment. The complete coding sequence of FOXL2 was amplified by PCR and subsequently analyzed by Sanger sequencing. A total of 11 distinct FOXL2 pathogenic variants were identified in our cohort (molecular diagnostic rate of 92%), including 5 novel mutations. Our results broaden the BPES-related mutational spectrum and supports considerable FOXL2 allelic heterogeneity in our population.

MON-235 Bone Morphogenic Protein Receptor Variants: A New Cause of Primary Ovarian Insufficiency

Primary ovarian insufficiency (POI) is a major cause of infertility. This disease is characterized by amenorrhea with an increase in gonadotropin levels and affects 1% of women before the age of 40. POI may be the result of a broad spectrum of disorders caused by two main mechanisms: abnormal follicular development and follicle depletion due to a defect in their formation or an aberrantly rapid depletion of the stock. Although the majority of cases are idiopathic, POI can be trigged by autoimmune disease, infectious agents, iatrogenic effects, or genetic causes. It may also be part of syndromic diseases such as Turner, Fragile-X or Blepharophimosis Ptosis Epicanthus Inversus syndrome. However, in the majority of cases, the cause of POI is unknown suggesting that new causative genes are yet to be discovered. We conducted a Whole Exome Sequencing on 69 Caucasian women with sporadic POI and performed a bioinformatics analysis on a specific subset of 420 coherent candidate genes1. We identified variations in about fifty genes potentially linked to POI, including new genes never described to be associated with the diseases aetiology, such as AuTophagy related Genes (ATG)2, KHDRBS1 gene encoding an RNA-binding protein3, NOTCH2 gene4... We also found variants in genes encoding Bone Morphogenetic Protein Receptors (BMPR1A and BMPR1B) in three patients. These receptors bind ligands of TGFβ superfamily. Mutations of members of this family (e.g. BMP15, GDF9) are known to be involved in the etiology of POI. BMPR encode transmembrane receptors with serine-threonine kinase activity expressed in the granulosa cells of growing follicles. Missense variations, located in the kinase domain of both receptors 1A and 1B, are predicted to be deleterious in silico. We studied the signaling pathway of these receptors: SMAD proteins phosphorylation, measurement of their transcriptional activity and expression of specific target genes and showed that they are deleterious. Bmpr1a -/- and Bmpr1b-/- mouse models develop infertility due to a reduced spontaneous ovulation and compromised cumulus expansion respectively, indicating that both genes play a crucial role in fertility. Altogether, our study describes the first BMPR1A and 1B mutations associated with POI and increases the number of genes formally implicated as being responsible for this condition. 1Patiño LC, Beau I, Carlosama C, Buitrago JC, González R, Suárez CF, Patarroyo MA, Delemer B, Young J, Binart N, Laissue P. Hum Reprod. 2017; 32(7):1512-1520. 2Delcour C, Amazit L, Patino L, Magnin F, Fagart J, Delemer B, Young J, Laissue P, Binart N, Beau I. Genet Med. 2018 (in press) 3Carlosama C, Patiño L, Beau I, Morel A, Delemer B, Young J, Binart N, Laissue P. Clin Endocrinol (Oxf). 2018 (in press) 4Patiño LC, Beau I, Morel A, Delemer B, Young J, Binart N, Laissue P. Hum Mutat. 2018 (in press)

A YAC contig spanning the blepharophimosis-ptosis-epicanthus inversus syndrome and propionic acidemia loci.

Blepharophimosis-ptosis-epicanthus inversus syndrome (BPES) is an autosomal dominant condition consisting of congenital dysplasia of the eyelids with a reduced horizontal diameter of the palpebral fissures, droopy eyelids and epicanthus inversus. Two clinical entities have been described: type I and type II. The former is distinguished by female infertility, whereas the latter presents without other symptoms. Both type I and type II were recently mapped on the long arm of chromosome 3 (3q22-q23), suggesting a common gene may be affected. The centromeric and the telomeric limits of this region are well defined between loci D3S1316 and D3S1615, which reside approximately 5 cM apart. Here, we present the construction of a YAC contig spanning the entire BPES locus using 17 polymorphic markers, 2 STS and 28 ESTs. This region of approximately 5 Mb was covered by 31 YACs, and was supported by detailed FISH analysis. In addition, we have precisely mapped the propionyl-CoA carboxylase beta polypeptide (PCCB), the gene mutated in propionic acidemia, within this contig. Apart from providing a framework for the identification of the BPES gene, this contig will also be useful for the future identification of defects and genes mapped to this region, and for developing template resources for genomic sequencing.

Analysis of FOXL2 gene mutation and genotype-phenotype correlation in a Chinese pedigree affected with blepharophimosis-ptosis-epicanthus inversus syndrome

To detect FOXL2 gene mutation in a Chinese pedigree affected with blepharophimosis-ptosis-epicanthus inversus syndrome (BPES) type I, and to explore its genotype-phenotype correlation. Peripheral blood samples were obtained from 3 patients and 19 healthy members from the pedigree for the isolation of genomic DNA. All exons and flanking sequences of the FOXL2 gene were amplified by PCR with 7 pairs of overlapping primers and sequenced. DNA sequencing indicated that the BPES phenotype in this pedigree was caused by a hotspot c.843_859dup17 mutation. The same mutation was not found among the healthy members of the pedigree. The c.843_859dup17 frameshift mutation probably underlies the BPES type I in this Chinese pedigree, which may manifest as either BEPS type I or type II.

Effectiveness of levator muscle resection combined with Mustarde's double Z-plasty for blepharophimosis-ptosis-epicanthus inversus syndrome

To investigate the effectiveness of levator muscle resection combined with Mustarde's double Z-plasty to correct blepharophimosis-ptosis-epicanthus inversus syndrome (BPES). Between March 2015 and June 2017, one-stage operation of levator muscle resection combined with Mustarde's double Z-plasty were performed on 26 children with bilateral BPES. There were 16 boys and 10 girls with an average age of 7 years (range, 4-14 years). All patients marked the four typical signs of BPES. There were 7 cases accompanied with a low nasal bridge, and 20 cases with amblyopia and strabismus. The length of eye fissure was (19.5±4.5) mm, the width of eye fissure was (2.5±1.6) mm, the diameter of inner canthus was (42.1±6.5) mm, and the muscular strength of levator palpebrae superioris was (5.5±1.3) mm. All the incisions healed by first intention. Twenty-three patients were followed up 2-12 months, with an average of 10 months. Among which, 2 cases were less corrected, 3 cases were over corrected, 6 cases had poor curvature of the eyelid. No eyelid internal and external pronation or keratitis occurred. Amelioration of blepharoptosis and epicanthus was achieved in the other patients, and the double eyelid fold was naturally smooth. At 7 days after operation, the length of eye fissure was (27.2±1.9) mm, the width of eye fissure was (12.5±1.3) mm, and diameter of inner canthus was (29.4±2.6) mm, which were superior to preoperative values ( t=0.127, P=0.042; t=0.341, P=0.029; t=0.258, P=0.038). There was no angular deformity caused by the width and length regressions of eye fissures. The levator muscle resection combined with Mustarde's double Z-plasty can effectively correct BPES and obtain good effectiveness.

Abstract QS43: Blepharophimosis Ptosis Epicanthus Inversus Syndrome Caused by a ZC3H13 Gene Mutation

PURPOSE: Blepharophimosis Ptosis Epicanthus Inversus Syndrome (BPES) is a rare craniofacial autosomal dominant disorder characterized by severe bilateral ptosis, telecanthus, epicanthus inverses, belpharophimosis and orbital dysmorphology. BPES type 1 is accompanied by ovarian failure and attendant infertility, while type 2 manifests only eyelid and orbital involvement. While BPES is often associated with a dominantly inherited mutation in the forkhead transcription factor FOXL2 (3q23), we sought to capitalize on next generation whole exome sequencing to decipher the cause of BPES in a pedigree lacking a FOXL2 mutation. METHODS: A male patient with BPES was identified at the Yale-New Haven Hospital. Following informed consent, clinical data and blood samples from both affected and unaffected family members were obtained. Genomic DNA was extracted from whole blood samples and subjected to exome capture followed by next generation sequencing. Sequence reads were mapped to the human reference genome. Variants with minor allele frequencies in reference databases were selected and annotated for impact on the encoded protein and for conservation of the reference base and amino acid residue among orthologs across phylogeny. Sanger sequencing was employed to verify candidate mutations. In addition, all FOXL2 exons were subjected to Sanger sequencing to verify sequence status. RESULTS: A four-generation BPES pedigree was identified demonstrating autosomal dominant inheritance. In affected individuals, next generation whole exome sequencing identified a common non-sense mutation in ZC3H13 (13q14.13), which was confirmed by Sanger sequencing. A cytosine to thymine (C>T) alteration resulted in the conversion of arginine 1513 to a premature stop codon (R1513X). The variant 13:46538114 C / T was not found in dbSNP with an ExAC allele frequency of 1.651e-05. The amino acid residue arginine 1513 is evolutionarily conserved from Neurospora crassa (red bread mold) to Homo sapiens. All FOXL2 exons lacked disease-causing alterations. Conclusions: ZC3H13 is a putative tumor suppressor gene encoding a zinc finger CCCH-type containing protein. It localizes to nuclear speckles and is predicted to play a role in mRNA splicing and cell cycle progression. Our data suggest that ZC3H13 mutations represent an additional dominant subtype of BPES and point to a novel role for ZC3H13 in craniofacial development and disease pathogenesis. D.M. Balkin: None. C. Nelson-Williams: None. B.J. Sumpio: None. D.A. Scott: None. P. Le Pabic: None. T.F. Schilling: None. R.P. Lifton: None. D. Narayan: None.