Blackberry Yellow Vein Associated Virus Research Articles

Comparing RT-PCR of individual samples with high throughput sequencing of pooled plant samples for field-level surveillance of viruses in blackberry and wild Rubus.

Blackberry production is increasing in the southeastern U.S. with the availability of new cultivars. In addition to high production costs, growers are challenged by virus diseases. Blackberry yellow vein disease (BVYD) significantly limits blackberry production. BYVD is associated with the crinivirus blackberry yellow vein-associated virus (BYVaV) in mixed infections with other viruses. The specific disease etiology and ecological factors underlying BYVD are not well understood and rely on the effective diagnosis of several viruses involved in the complex. In 2021, we collected samples from blackberry plants showing BYVD symptoms, asymptomatic blackberry plants, and wild Rosaceae spp. from nine farms across South Carolina, for a total of 372 individual plant samples. RNA from individual samples was isolated and pooled into sample groups (i.e., symptomatic, asymptomatic, and wild) from each farm for a total of 24 pooled samples. We sequenced the pooled RNA using Illumina and analyzed sequence profiles using the Virtool bioinformatics application. We also tested each plant for six viruses by RT-PCR or RT-qPCR and compared plant (PCR)-level and field (high throughput sequencing (HTS))-level data. Virtool detected 17 known viruses in the pooled samples, including 11 blackberry viruses. PCR testing was mostly consistent with HTS, with some notable disagreements for specific viruses. Our study demonstrates that HTS could be used as an efficient tool to detect viruses in bulked samples in blackberry fields, though limitations to using HTS for field-level surveillance are also discussed here.

Pest categorisation of non-EU viruses of Rubus L.

The Panel on Plant Health of EFSA conducted a pest categorisation of 17 viruses of Rubus L. that were previously classified as either non‐EU or of undetermined standing in a previous opinion. These infectious agents belong to different genera and are heterogeneous in their biology. Blackberry virus X, blackberry virus Z and wineberry latent virus were not categorised because of lack of information while grapevine red blotch virus was excluded because it does not infect Rubus. All 17 viruses are efficiently transmitted by vegetative propagation, with plants for planting representing the major pathway for entry and spread. For some viruses, additional pathway(s) are Rubus seeds, pollen and/or vector(s). Most of the viruses categorised here infect only one or few plant genera, but some of them have a wide host range, thus extending the possible entry pathways. Cherry rasp leaf virus, raspberry latent virus, raspberry leaf curl virus, strawberry necrotic shock virus, tobacco ringspot virus and tomato ringspot virus meet all the criteria to qualify as potential Union quarantine pests (QPs). With the exception of impact in the EU territory, on which the Panel was unable to conclude, blackberry chlorotic ringspot virus, blackberry leaf mottle‐associated virus, blackberry vein banding‐associated virus, blackberry virus E, blackberry virus F, blackberry virus S, blackberry virus Y and blackberry yellow vein‐associated virus satisfy all the other criteria to be considered as potential QPs. Black raspberry cryptic virus, blackberry calico virus and Rubus canadensis virus 1 do not meet the criterion of having a potential negative impact in the EU. For several viruses, the categorisation is associated with high uncertainties, mainly because of the absence of data on biology, distribution and impact. Since the opinion addresses non‐EU viruses, they do not meet the criteria to qualify as potential Union regulated non‐quarantine pests.

Incidence of Viruses in Two Large-Scale Plantings of Blackberry in South Carolina as Detected Through the Use of Sentinel Plants and RT-PCR

Some plants in two large-scale blackberry plantings established from virus-indexed planting material displayed symptoms typical of virus infection in the early days of the growing season immediately after planting. Groups of sentinel plants exposed within the plantings for 30-day periods over additional growing seasons, and subsequently screened for the presence of five viruses by reverse transcription PCR, detected Blackberry yellow vein-associated virus (BYVaV), Blackberry virus Y (BVY), Blackberry chlorotic ringspot virus (BCRV), Blackberry virus E (BVE), and Blackberry leaf mottle-associated virus (BLMaV). Because these viruses are thought to be transmitted through the actions of arthropods, and bearing in mind that the plantings had been established with virus-indexed material, it seems that the viruses must be moving into the new crops from adjacent native vegetation and once established moving freely within the crops. BYVaV has been reported from South Carolina previously. A recent publication reports the detection of BLMaV in samples originating from South Carolina and demonstrates transmission of the virus by mites. This is the first report of the detection of BCRV, BVY, and BVE within the state and provides support for the movement of the latter two viruses (BVY and BVE) within established plantings of blackberry as a result of vector activity.

Epidemiology of Blackberry yellow vein associated virus.

Blackberry yellow vein disease is one of the most important diseases of blackberry in the United States. Several viruses are found associated with the symptomology but Blackberry yellow vein associated virus (BYVaV) appears to be the most prevalent of all, leading to the need for a better understanding of its epidemiology. Efficient detection protocols were developed using end-point and quantitative reverse-transcription polymerase chain reaction. A multi-state survey was performed on wild and cultivated blackberry to assess the geographical distribution of the virus. Two whitefly species, Trialeurodes abutilonea and T. vaporariorum, were identified as vectors and 25 plant species were tested as potential BYVaV hosts. The information obtained in this study can be used at multiple levels to better understand and control blackberry yellow vein disease.

Population structure of Blackberry yellow vein associated virus, an emerging crinivirus

Blackberry yellow vein disease (BYVD), a disorder caused by virus complexes, has become a major threat to fresh market blackberry production in the United States. Blackberry yellow vein associated virus (BYVaV) is the most prevalent virus in the BYVD complexes; detected in about 50% of samples exhibiting typical disease symptoms. Thirty-four virus isolates infecting wild and cultivated blackberries were collected from several areas with high BYVD incidence. Sequence variability and virus evolution predictions were calculated for four genomic regions coding for six proteins and accounting for about 30% of the virus genome. Nucleotide diversity ranged between 7 and 12%, and all proteins studied were under negative selection. Several isolates were identified as potential recombinants suggesting that recombination might be a driving force behind BYVaV evolution.

First Report of Impatiens necrotic spot virus in Blackberry in the Southeastern United States.

Blackberry yellow vein disease (BYVD) has emerged as an important disease of blackberry (Rubus spp.) in the south and southeastern United States (2,3). In an effort to characterize viruses that may be involved in the disease, double-stranded RNA extracted from a symptomatic 'Apache' blackberry from South Carolina was used for shotgun cDNA cloning (4). Sequence analysis showed that in addition to Blackberry yellow vein associated virus (BYVaV) (2), a constant component of BYVD, sequences of Impatiens necrotic spot virus (INSV) also were obtained. The 623-nt fragment of INSV (Genbank Accession No. EU287930) shared 98% nucleotide and amino acid sequence identity with GenBank Accession No. NC003616. Confirmation of the results of the initial shotgun cloning was done by reverse transcription-PCR with primers INSVF (5' GATCTGTCCTGGGATTGTTC 3') and INSVR (5' GTCTCCTTCTGGTTCTATAATCAT 3') that amplify a 460 base fragment of the M RNA of INSV. Amplicons obtained from single-stranded and dsRNA templates were sequenced and found to be identical with EU287930. The identity of INSV by PCR was also supported by positive results with a commercially available INSV-ELISA kit (AC Diagnostics, Fayetteville, AR). Earlier, more than 400 plants from North Carolina, South Carolina, and Virginia with BYVD and other virus-like symptoms were tested for INSV by ELISA and approximately 33% were found to be infected with the virus (1). Thus, INSV appears to be one of the major viruses infecting blackberry in the southeastern United States, and it remains to be seen if INSV acts synergistically with BYVaV and other viruses to contribute to the severity of BYDV. To our knowledge, this is the first report of INSV infecting Rubus spp.

Viral Interactions Lead to Decline of Blackberry Plants.

Blackberry yellow vein disease (BYVD) poses a new threat to the blackberry industry in the United States. Blackberry yellow vein associated virus (BYVaV) was originally thought to be the sole cause of this disease. However, BYVaV has been found in several asymptomatic blackberry cultivars. An unusual member of the family Potyviridae was identified recently from symptomatic plants and named Blackberry virus Y (BVY). BVY has been shown to spread in the field and cause BYVD when co-infected with BYVaV. Both viruses are asymptomatic in single infections but are readily detectable in asymptomatic plants by reverse transcription-polymerase chain reaction (RT-PCR). However, in mixed infections, the titer of BYVaV is repressed, sometimes to levels undetectable by RT-PCR, while the concentration of BVY is increased several fold. Electron microscopy revealed a variety of viral inclusions in symptomatic leaf samples, but none could be found in single infections with either BVY or BYVaV. Although BYVaV has been consistently associated with BYVD in different geographical regions, the detection of BVY has thus far been restricted to northwest Arkansas. It has been hypothesized that BYVaV is the synergistic determinant of BYVD that causes symptoms in different cultivars at various locations during co-infection with other viruses.

A member of a new genus in the Potyviridae infects Rubus

Blackberry yellow vein disease causes devastating losses on blackberry in the south and southeastern United States. Blackberry yellow vein associated virus (BYVaV) was identified as the putative causal agent of the disease but the identification of latent infections of BYVaV led to the investigation of additional agents being involved in symptomatology. A potyvirus, designated as Blackberry virus Y (BVY), has been identified in plants with blackberry yellow vein disease symptoms also infected with BYVaV. BVY is the largest potyvirus sequenced to date and the first to encode an AlkB domain. The virus shows minimal sequence similarity with known members of the family and should be considered member of a novel genus in the Potyviridae. The relationship of BVY with Bramble yellow mosaic virus, the only other potyvirus known to infect Rubus was investigated. The presence of the BVY was verified in several blackberry plants, but it is not the causal agent of blackberry yellow vein disease since several symptomatic plants were not infected with the virus and BVY was also detected in asymptomatic plants.

Incidence and Ecology of Blackberry yellow vein associated virus.

Symptoms of leaf vein yellowing and bush decline in blackberry were attributed to infection by a novel crinivirus named Blackberry yellow vein associated virus (BYVaV). The disease is an emerging threat to blackberry production because it can cause substantial yield loss. The objective of this study was to identify the source and means of spread of BYVaV. A survey of blackberry plants for BYVaV from wild, cultivated, and nursery stocks was conducted. Insect traps and healthy blackberry sentinel plants were placed among symptomatic plants in a production field throughout two growing seasons to monitor the occurrence of potential vectors and virus spread. Virus indicator plants were grafted with BYVaV-infected blackberry because this virus was latent in some blackberry cultivars, but indicator plants failed to express symptoms when infected with BYVaV. Reverse-transcription polymerase chain reaction detection revealed the occurrence of BYVaV in blackberry nurseries in the United States, in production fields in Arkansas, South Carolina, and North Carolina, and in wild blackberry populations in Arkansas. Whiteflies (Trialeurodes packardii and T. ruborum), potential vectors of BYVaV, were observed on sticky traps placed in blackberry fields and were found colonizing blackberry plants; however, transmission studies failed to produce whitefly-mediated transmission of BYVaV. Further understanding of the disease etiology is needed to devise viable management strategies for this disease.

Yellow vein‐affected blackberries and the presence of a novel Crinivirus

During the last 5 years, blackberry plants in Arkansas and North and South Carolina exhibited virus‐like symptoms of vein yellowing and mosaic, followed in some cases by death. Diagnostic tests for known blackberry viruses failed to identify a causal agent. Double‐stranded RNA was extracted from affected plants and cloned. A new member of the Closteroviridae was identified and designated Blackberry yellow vein associated virus (BYVaV). Molecular and immunological assays have been developed for BYVaV, and examination of plants with symptoms revealed a close association of disease symptoms with the presence of BYVaV, although the virus was also found in symptomless plants. Molecular characterization of isolates from plants exhibiting different degrees of disease severity indicated that sequence diversity is probably not the cause of the observed phenotypic differences.

Nucleotide sequence of Blackberry yellow vein associated virus, a novel member of the Closteroviridae

The complete nucleotide sequence of a novel member of the genus Crinivirus (family Closteroviridae), isolated from blackberry and tentatively named Blackberry yellow vein associated virus, was determined. The virus possesses a bipartite genome. RNA 1 is 7801 nucleotides in length and papain-like protease, methyltransferase, RNA helicase and RNA-dependent RNA polymerase motifs have been identified in the proteins coded for by this molecule. The polymerase is probably expressed via a +1 ribosomal frameshift, a common feature among members of the Closteroviridae. RNA 2 is 7917 nucleotides long and encodes nine open reading frames, similar in size and position to orthologous genes of other criniviruses with the exception of a second hydrophobic peptide found near the 5′ terminus of the molecule. Phylogenetic analysis revealed a close relationship between Blackberry yellow vein associated virus and Beet pseudo yellows virus, another crinivirus that infects small fruit crops.

(367) Symptom Expression of Mixed Virus Infections in `Chickasaw' Blackberry

Latent infection of Blackberry yellow-vein associated virus (BYVaV) in `Chickasaw' blackberry has been reported. However, plants with characteristic leaf symptoms, such as vein yellowing, chlorotic mottling, and oak-leaf patterns, have tested positive for BYVaV using reverse-transcription polymerase chain reaction. Experiments were initiated to determine if the symptoms expressed in BYVaV infected `Chickasaw' were caused by mixed virus infections. BYVaV, a recently identified crinivirus, was evaluated for synergistic interactions with Tobacco ringspot virus (TRSV), Tomato ringspot virus (ToRSV), and Raspberry bushy dwarf virus (RBDV). `Chickasaw' blackberry plants infected with BYVaV (single infection) were used as receptor plants to establish mixed virus infections with TRSV and ToRSV transmitted by nematodes and RBDV transmitted by bottle grafts. Characteristic symptoms of multi-virus infection will be presented and discussed.

A SURVEY OF VIRUSES IN BLACKBERRY NURSERY STOCK

In 2004, two surveys were conducted to assess the presence of four viruses in marketable blackberry nursery stock. The U.S. survey consisted of dormant nursery stock received from 11 nurseries in the southern, southeastern, midwestern, northeastern, and Pacific northwestern regions of the U.S. The second survey was focused only on Arkansas licensed propagating nurseries with samples collected during the growing season. Samples were tested using reverse transcription–polymerase chain reaction or enzyme-linked immunosorbent assay for the presence of Blackberry yellow vein associated virus (BYVaV), Raspberry bushy dwarf virus (RBDV), Tomato ringspot virus (ToRSV), and Tobacco ringspot virus (TRSV). Of the total samples in the U.S. survey, there were 9% that tested positive for virus infection. Ninety percent of the positives were infected with BYVaV. Forty percent of these were detected in `Triple Crown', 40% in `Chickasaw', and 20% in `Apache'. The remaining 9% of the total positive virus samples were infected with TRSV and 100% of these were in `Triple Crown'. No viruses were found on any samples of `Chester Thornless'. In the Arkansas survey, 11% of the total samples tested positive for virus. Of these, 50% were infected with BYVaV. The percent infected with BYVaV was distributed evenly among `Apache', `Chickasaw', and `Kiowa'. The other 50% of the infected samples were positive for TRSV (67% `Apache', 33% `Chickasaw'). There was one mixed infection of BYVaV and TRSV detected in `Apache'. These findings indicate that BYVaV is the most prevalent virus found in nursery stock and that the occurrence of BYVaV is not restricted to a single region or cultivar.

BLACKBERRY YELLOW VEIN ASSOCIATED VIRUS: A NEW CRINIVIRUS FOUND IN BLACKBERRY

During the last three years blackberries in southern and southeastern U.S. have shown symptoms of vein clearing, yellow mottling and plant decline with considerable variation in symptoms with cultivars. We isolated dsRNA from symptomatic plants and identified high molecular weight bands similar to those isolated from plants infected with criniviruses. Paired extractions from virus-tested blackberries did not yield any dsRNA bands with molecular weight greater than 500 bp. Using degenerate primers developed against the crinivirus 1b protein in RTPCR resulted in an amplicon that when sequenced showed the virus was a member of the Crinivirus genus. We have also cloned the virus and sequenced clones containing regions of the minor coat protein of the virus. Phylogenetic analysis revealed that the new virus, designated as Blackberry yellow vein associated virus (BYVaV), is related most closely to Beet pseudo-yellows virus and Strawberry pallidosis associated virus, two criniviruses recently identified in strawberry. INTRODUCTION Symptoms of vein clearing, yellow mottling, ringspots and plant decline have been observed in blackberry in South Carolina, North Carolina and Arkansas over the past few years (Fig. 1). Initially the symptoms were thought to be caused by Tobacco ringspot virus (TRSV) as this virus is known to infect blackberry and similar symptoms attributed to TRSV infection have been reported (1). Symptomatic plants were tested for 14 viruses by ELISA including: Alfalfa mosaic, Arabis mosaic, Cucumber mosaic, Impatiens necrotic spot, Prunus necrotic ringspot, Raspberry bushy dwarf, Raspberry ringspot, Strawberry latent ringspot, Strawberry mild yellow edge, Tobacco ringspot, Tobacco streak, Tomato ringspot, and Tomato spotted wilt viruses as well as for Potyviruses using group specific antibodies. However, in ELISA tests very few plants that exhibited these symptoms tested positive for TRSV or any other virus. In this report we describe a crinivirus associated with the symptoms observed in blackberry and a reverse-transcritase polymerase chain reaction (RT-PCR) method for detecting this new virus. MATERIALS AND METHODS In an attempt to determine if there may be a new virus associated with these symptoms dsRNA was extracted from symptomatic and asymptomatic plants using a shortened version of the standard extraction method (2). After the dsRNA was bound to the cellulose powder in the presence of 16% ethanol in STE buffer, the samples were centrifuged for three minutes at 5,000 X g, the pellet was washed once with 50 ml of STE-EtOH and the cellulose repelleted by centrifugation. Two ml of STE was added to the final pellet and incubated at room temp for 5 min. The sample was then transferred to a microfuge tube and pellet at max rpm for 3 min. The supernatant was collected and nucleic acid precipitated by the addition of 2 ml of 95% EtOH with 5% 3 M sodium acetate. Samples were mixed then stored at -80C for 20 minutes before centrifugation in a microfuge at max speed for 30 minutes. Pellets were resuspend in 10 mM Tris-HCl containing 1 mM EDTA and analyzed by gel electrophoresis. Proc. X IS on Small Fruit Virus Diseases

First Report of Beet pseudo yellows virus in Blackberry in the United States.

Blackberry (Rubus sp.) plants in Arkansas, North Carolina, and South Carolina during the last 3 years have shown symptoms typical of virus infection, including vein yellowing, line pattern, and mottle, and in certain cases, decline and death. All of the symptomatic plants used in our studies were infected with Blackberry yellow vein associated virus (BYVaV) (1). We cloned cDNA derived from dsRNA extracted from a symptomatic plant from South Carolina and identified two cDNA clones (approximate size of 700 and 900 bp, in addition to those that corresponded to a sequence of BYVaV) with sequences identical to the sequence (GenBank Accession No. AY 268107) of Beet pseudo yellows virus (BPYV) heat shock protein 70 homolog gene. Total RNA extracts from the symptomatic plant were tested using reverse transcription-polymerase chain reaction (RT-PCR) with oligonucleotide primers BP CPm F (5' TTCATATTAAGGATGCGCAGA 3') and BP CPm R (5' TGAAAGATGTCCRCTAATGATA 3') that amplified a fragment of the minor coat protein (CPm) gene of BPYV. A PCR amplicon of the expected size (334 bp) was generated, and sequencing confirmed the results of the random cloning. We also detected the virus in a second blackberry plant from South Carolina with RT-PCR. To our knowledge, this is the first report of blackberry as a host of BPYV and the third new host of BPYV identified in the last few months (2,3). The naturalization of Trialeuroides vaporariorum, the greenhouse whitefly in the southern United States, and the broad host range of virus and vector make BPYV a potential threat for many crops in North America.