Black Yeast Exophiala Dermatitidis Research Articles

Transcriptomic and genomic effects of gamma-radiation exposure on strains of the black yeast Exophiala dermatitidis evolved to display increased ionizing radiation resistance.

Ionizing radiation poses a significant threat to living organisms and human health, given its destructive nature and widespread use in fields such as medicine and the potential for nuclear disasters. Melanized fungi exhibit remarkable survival capabilities, enduring doses up to 1,000-fold higher than mammals. Through adaptive laboratory evolution, we validated the protective role of constitutive upregulation of DNA repair genes in the black yeast Exophiala dermatitidis, enhancing survival after radiation exposure. Surprisingly, we found that evolved strains lacking melanin still achieved high levels of radioresistance. Our study unveiled the significance of robust activation and enhancement of redox homeostasis, as evidenced by the profound transcriptional changes and increased accumulation of mutations, in substantially improving ionizing radiation resistance in the absence of melanin. These findings underscore the delicate balance between DNA repair and redox homeostasis for an organism's ability to endure and recover from radiation exposure.

In host evolution of Exophiala dermatitidis in cystic fibrosis lung micro-environment.

Individuals with cystic fibrosis (CF) are susceptible to chronic lung infections that lead to inflammation and irreversible lung damage. While most respiratory infections that occur in CF are caused by bacteria, some are dominated by fungi such as the slow-growing black yeast Exophiala dermatitidis. Here, we analyze isolates of E. dermatitidis cultured from two samples, collected from a single subject 2 years apart. One isolate genome was sequenced using long-read Nanopore technology as an in-population reference to use in comparative single nucleotide polymorphism and insertion-deletion variant analyses of 23 isolates. We then used population genomics and phylo-genomics to compare the isolates to each other as well as the reference genome strain E. dermatitidis NIH/UT8656. Within the CF lung population, three E. dermatitidis clades were detected, each with varying mutation rates. Overall, the isolates were highly similar suggesting that they were recently diverged. All isolates were MAT 1-1, which was consistent with their high relatedness and the absence of evidence for mating or recombination between isolates. Phylogenetic analysis grouped sets of isolates into clades that contained isolates from both early and late time points indicating there are multiple persistent lineages. Functional assessment of variants unique to each clade identified alleles in genes that encode transporters, cytochrome P450 oxidoreductases, iron acquisition, and DNA repair processes. Consistent with the genomic heterogeneity, isolates showed some stable phenotype heterogeneity in melanin production, subtle differences in antifungal minimum inhibitory concentrations, and growth on different substrates. The persistent population heterogeneity identified in lung-derived isolates is an important factor to consider in the study of chronic fungal infections, and the analysis of changes in fungal pathogens over time may provide important insights into the physiology of black yeasts and other slow-growing fungi in vivo.

P007 Fumaric reductase analog regulates sensitivity of pyrvinium pamoate and voriconazoole against Exophiala Dermatiti dis

Poster session 1, September 21, 2022, 12:30 PM - 1:30 PM ObjectivesThe black yeast Exophiala dermatitidis is an opportunistic pathogen that causes phaeohyphomycosis in both immunocompetent individuals and immunosuppressed patients, resulting in localized cutaneous and subcutaneous infections to more severe systemic forms such as neurotropic infections. Besides, E. dermatitidis was frequently found as a colonizer of pulmonary of cystic fibrosis patients, which appears to be associated with more advanced disease. Infections of E. dermatitidis are often chronic and recalcitrant. Previously, we have demonstrated that pyrvinium pamoate (PP) exerted antifungal activity alone (MIC 2 μg/ml) and favorable synergy with azoles against E. dermatitidis in vitro, which was confirmed in vivo via Galleria mellonella model. Further investigation revealed pyrvinium resulted in significant growth restriction of E. dermatitidis, reduction of biofilm formation, and significantly (P <.05) decrease of the efflux of Rhodamine 6 G. However, the underlying mechanism and probable target of PP are still unknown. The aim of this study is to investigate the role of fumaric reductase analog in the effect of PP against E. dermatitidis.MethodsThe knockout strain named △Exfr was constituted via polyethyleneglycol (PEG)-mediated transformation of protoplasts. A gene replacement cassette was generated as described. E. dermatitidis wild-type strain ATCC34100 DNA was used for molecular cloning. The pan7-1 plasmid vector, which contained the genetic markers hygromycin B phosphotransferase, was applied as a selection marker provider. DNA manipulation was performed according to standard laboratory procedures. The 5′ and 3′ flanking regions of fumaric reductase analog coding gene Exfr (Genbank geneID 20312383) were amplified using the primers ExfruF, ExfruR, and ExfrdF, ExfrdR, respectively. The selection maker Hph was amplified from pan7-1 by using primers hphF and hphR. These three fragments are subsequently fused via PCR with primers ExfuF and ExfuR. The protoplasts of wild-type strain ATCC34100 were prepared as described. Further, the fused gene fragment and PEG was mixed with protoplast to complete transformation, and the transformants were transferred to SDA solid culture base (containing a final concentration of 50 μg/ml hygromycin). DNA extracted from the transformants that could grow stably on HPH medium was sent for sequencing to verify that the target gene had been introduced into the location. The growth, morphology, and in vitro susceptibility of ATCC34100 and △Exfr were further investigated.ResultsThere was no significant difference in the colony or conidial morphology. However, the growth rate of △Exfr was slightly slower than that of the wild-type strain. In addition, the MICs of pyrvinium pamoate (PP) and voriconazole against △Exfr were 2-fold higher (16 ug/ml and 0.5ug/ml, respectively), compared with that of the wild-type strain.ConclusionThe preliminary results suggested that fumaric reductase analog may play an important role in drug sensitivity of E. dermatitidis, especially the sensitivity to PP and voriconazole. In addition, △Exfr is currently the only E. dermatitidis strain that was successfully knocked out by protoplast procedure, which provides reference for subsequent researches on E. dermatitidis gene knockout.Table 1.Primers used in this study.Primer nameSequence (5′ → 3’)ExfruFATCAGTAGTACTGTACGTCGTGTGCExfruRGATCTTGCCGATCCCCGTCGATCGCExfrdFGTGTTGTTCAAGTTGGGTGCATGTGExfrdRTCTTGAAGGCGAGTAGACGGACTCAExfuFGTTCAACTTTGGTTTTGTGGAGGAGExfuRCCTTCTCCCTCTTCCTACCGTCCTChphFCTCCGGAGTTGAGACAAATGGhphRCATCCACTGCACCTCAGAGC

S2.5c Exophiala spp.

S2.5 Rare yeasts, September 21, 2022, 3:00 PM - 4:30 PMThe black yeast Exophiala dermatitidis is an opportunistic pathogen, causing phaeohyphomycosis in immunosuppressed patients, chromoblastomycosis, and fatal infections of the central nervous system in otherwise healthy Asian patients. In addition, it is also regularly isolated from respiratory samples from cystic fibrosis patients, with rates varying between 1% and 19%. Melanin, as part of the cell wall of black yeasts, is one major factor known to contribute to the pathogenicity of E. dermatitidis and increased resistance against host defense and anti-infective therapeutics. Further virulence factors, e.g., the capability to adhere to surfaces and to form biofilm were reported.

Isolation of Exophiala dermatitidis is not associated with worse clinical outcomes during acute pulmonary exacerbations in cystic fibrosis.

Introduction. The black yeast Exophiala dermatitidis has been isolated in respiratory samples from people with cystic fibrosis (CF). However, adequate detection may require longer incubation periods than the current UK national standard for CF respiratory samples. Furthermore, it is unclear whether isolation of E. dermatitidis is associated with poorer clinical outcomes in CF.Hypothesis/gap statement. E. dermatitidis does not cause clinically significant lung disease in CF adults.Aim. To evaluate differences in clinical outcomes over a 12 month period and during acute pulmonary exacerbations between CF adults with and without untreated E. dermatitidis.Methodology. Incubation times for respiratory samples on Sabouraud dextrose agar with chloramphenicol (SABC) plates at a large regional adult CF centre were extended from 2 to 7 days over a 1 month period. The number of patients from whom E. dermatitidis was isolated, and the length of incubation time prior to isolation, were recorded. Outcomes of treatment of exacerbations with intravenous antibiotics but in the absence of concomitant antifungal therapy were compared between those with and without E. dermatitidis, as were changes in lung function and body mass index (BMI) over a 12 month period.Results. Extended incubation unmasked the presence of E. dermatitidis in 22 of 132 patients; all isolations occurred after >48 h of incubation. Patients who isolated E. dermatitidis had lower rates of Pseudomonas aeruginosa isolation (P=0.02) and higher rates of non-tuberculous mycobacteria isolation (P=0.03), and were more likely to be prescribed a long-term antifungal medication (P=0.03), but had no differences in age, sex, baseline lung function or body mass index (BMI). There were no differences in response to treatment of acute exacerbations between patients with and without E. dermatitidis, or in change in forced expiratory volume in 1 s (FEV1), BMI and number of exacerbations over 12 months of follow-up.Conclusion. E. dermatitidis is not associated with worse clinical outcomes in CF. Given potential side effects and drug interactions, routine targeting of E. dermatitidis with antifungals during acute exacerbations is not advised.

Phenotypic Characterization and Comparative Genomics of the Melanin-Producing Yeast Exophiala lecanii-corni Reveals a Distinct Stress Tolerance Profile and Reduced Ribosomal Genetic Content.

The black yeast Exophiala lecanii-corni of the order Chaetothyriales is notable for its ability to produce abundant quantities of DHN-melanin. While many other Exophiala species are frequent causal agents of human infection, E. lecanii-corni CBS 102400 lacks the thermotolerance requirements that enable pathogenicity, making it appealing for use in targeted functional studies and biotechnological applications. Here, we report the stress tolerance characteristics of E. lecanii-corni, with an emphasis on the influence of melanin on its resistance to various forms of stress. We find that E. lecanii-corni has a distinct stress tolerance profile that includes variation in resistance to temperature, osmotic, and oxidative stress relative to the extremophilic and pathogenic black yeast Exophiala dermatitidis. Notably, the presence of melanin substantially impacts stress resistance in E. lecanii-corni, while this was not found to be the case in E. dermatitidis. The cellular context, therefore, influences the role of melanin in stress protection. In addition, we present a detailed analysis of the E. lecanii-corni genome, revealing key differences in functional genetic content relative to other ascomycetous species, including a significant decrease in abundance of genes encoding ribosomal proteins. In all, this study provides insight into how genetics and physiology may underlie stress tolerance and enhances understanding of the genetic diversity of black yeasts.

Mucormycosis: A black fungus – post covid complication, clinical and pathogenic approaches and isolation and characterization of black fungus with correlate its current perspectives of biomedical waste management

The clinically relevant black yeasts and their relatives, i.e., members of the Ascomycete order Chaetothyriales. In order to understand the pathology of these fungi it is essential to know their natural ecological niche. From a relatively low degree of molecular variability of the black yeast Exophiala dermatitidis, potential agent of brain infections in patients from East Asia, it is concluded that this species is an emerging pathogen, currently going through a process of active speciation. It is found to be an oligotrophic fungus in hot, moist environments, such as steam baths. Cladophialophora-Fonsecaea- and Ramichloridium-like strains, known in humans as agents of chromoblastomycosis, are frequently found on rotten plant material, but the fungal molecular diversity in the environment is much higher than that on the human patient, so that it is difficult to trace the etiological agents of the disease with precision, Human to human transmitted disease is the game of corona virus disease (COVID-19) transmission and it had been declared an emergency global pandemic that caused major disastrous in respiratory system to more than five million people and killing more than half a billion deaths across the globe. Besides lower acute respiratory syndrome, there is damage to alveolar with severe inflammatory exudation. COVID-19 patients often have lower immunosuppressive CD4+ T and CD8+ T cells and most patients in intensive care units (ICU) need mechanical ventilation, hence longer stay in hospitals. These patients have been discovered to develop fungal co-infections. COVID-19 patients develop what is known as mucormycosis a black fungal infection which is deadly leading to loss of sight and hearing and eventually death. This chapter will focus on mucormycosis, black fungus caused during post covid complication. This approach has been successful with Cladophialophora carrionii, of which cells resembling muriform cells, the tissue form of chromoblastomycosis, were found to occur in drying spines of cacti. Phagocytosis assays provide a method to distinguish between pathogens and non-pathogens, as the killing rates of strict saprobes proved to be consistently higher than of those species frequently known as agents of disease. therapeutic possibilities for patient chromoblastomycosis. Covid-19 waste is like any other infectious waste and the guidelines for its management are required to be followed in addition to existing practices under regulation. BMWM in context of COVID-19 is a public health concern and is both a legal and social responsibility.

Adaptive evolution of a melanized fungus reveals robust augmentation of radiation resistance by abrogating non‐homologous end‐joining

Fungi have been observed to exhibit resistance to high levels of ionizing radiation despite sharing most DNA repair mechanisms with other eukaryotes. Radioresistance, in fact, is such a common feature in fungi that it is difficult to identify species that exhibit widely different radiosensitivities, which in turn has hampered the identification of genetic elements responsible for this resistance phenotype. Due to the inherent mutagenic properties of radiation exposure, however, this can be addressed through adaptive laboratory evolution for increased ionizing radiation resistance. Here, using the black yeast Exophiala dermatitidis, we demonstrate that resistance to γ-radiation can be greatly increased through repeated rounds of irradiation and outgrowth. Moreover, we find that the small genome size of fungi situates them as a relatively simple functional genomics platform for identification of mutations associated with ionizing radiation resistance. This enabled the identification of genetic mutations in genes encoding proteins with a broad range of functions from 10 evolved strains. Specifically, we find that greatly increased resistance to γ-radiation is achieved in E. dermatitidis through disruption of the non-homologous end-joining pathway, with three individual evolutionary paths converging to abolish this DNA repair process. This result suggests that non-homologous end-joining, even in haploid cells where homologous chromosomes are not present during much of the cell cycle, is an impediment to repair of radiation-induced lesions in this organism, and that the relative levels of homologous and non-homologous repair in a given fungal species may play a major role in its radiation resistance.

Proteomics Reveals Distinct Changes Associated with Increased Gamma Radiation Resistance in the Black Yeast Exophiala dermatitidis.

The yeast Exophiala dermatitidis exhibits high resistance to γ-radiation in comparison to many other fungi. Several aspects of this phenotype have been characterized, including its dependence on homologous recombination for the repair of radiation-induced DNA damage, and the transcriptomic response invoked by acute γ-radiation exposure in this organism. However, these findings have yet to identify unique γ-radiation exposure survival strategies—many genes that are induced by γ-radiation exposure do not appear to be important for recovery, and the homologous recombination machinery of this organism is not unique compared to more sensitive species. To identify features associated with γ-radiation resistance, here we characterized the proteomes of two E. dermatitidis strains—the wild type and a hyper-resistant strain developed through adaptive laboratory evolution—before and after γ-radiation exposure. The results demonstrate that protein intensities do not change substantially in response to this stress. Rather, the increased resistance exhibited by the evolved strain may be due in part to increased basal levels of single-stranded binding proteins and a large increase in ribosomal content, possibly allowing for a more robust, induced response during recovery. This experiment provides evidence enabling us to focus on DNA replication, protein production, and ribosome levels for further studies into the mechanism of γ-radiation resistance in E. dermatitidis and other fungi.

The Neurotropic Black Yeast Exophiala dermatitidis Induces Neurocytotoxicity in Neuroblastoma Cells and Progressive Cell Death.

The neurotropic and extremophilic black yeast Exophiala dermatitidis (Herpotrichellaceae) inhabits diverse indoor environments, in particular bathrooms, steam baths, and dishwashers. Here, we show that the selected strain, EXF-10123, is polymorphic, can grow at 37 °C, is able to assimilate aromatic hydrocarbons (toluene, mineral oil, n-hexadecane), and shows abundant growth with selected neurotransmitters (acetylcholine, gamma-aminobutyric acid, glycine, glutamate, and dopamine) as sole carbon sources. We have for the first time demonstrated the effect of E. dermatitidis on neuroblastoma cell model SH-SY5Y. Aqueous and organic extracts of E. dermatitidis biomass reduced SH-SY5Y viability by 51% and 37%, respectively. Melanized extracellular vesicles (EVs) prepared from this strain reduced viability of the SH-SY5Y to 21%, while non-melanized EVs were considerably less neurotoxic (79% viability). We also demonstrated direct interactions of E. dermatitidis with SH-SY5Y by scanning electron and confocal fluorescence microscopy. The observed invasion and penetration of neuroblastoma cells by E. dermatitidis hyphae presumably causes the degradation of most neuroblastoma cells in only three days. This may represent a so far unknown indirect or direct cause for the development of some neurodegenerative diseases such as Alzheimer’s.

Phenotypical Characteristics of the Black Yeast Exophiala dermatitidis Are Affected by Pseudomonas aeruginosa in an Artificial Sputum Medium Mimicking Cystic Fibrosis-Like Conditions.

Research into the cooperative pathogenicity of microbes in cystic fibrosis (CF) lungs is crucial for an understanding of the pathophysiology of infections and the development of novel treatment strategies. This study investigated the impact of the common CF-associated bacterial pathogen Pseudomonas aeruginosa on the black yeast Exophiala dermatitidis. It evaluated the planktonic growth, biofilm formation, morphology, and virulence of the fungus in the presence or absence of P. aeruginosa. It also determined the role of P. aeruginosa quorum-sensing (QS) molecules within these interactions, e.g., by using sterile culture filtrate and QS-deficient mutants. P. aeruginosa is known to inhibit the planktonic growth of E. dermatitidis. We found that fungal biofilm formation increased in the presence of P. aeruginosa after 24 h but is decreased significantly after 48 h. This effect was reversed when, instead of QS wild-type strains, ΔlasR, and ΔrhlR mutants were added to E. dermatitidis biofilm formation. The number and length of hyphae were substantially reduced when E. dermatitidis was co-cultivated with P. aeruginosa, but not when it was co-cultivated with the mutants. Experiments testing the virulence of E. dermatitidis in the greater wax moth Galleria mellonella showed a synergetic effect on larval killing when E. dermatitidis was injected together with P. aeruginosa culture filtrate. Survival rates were decreased when biofilm culture filtrate was added but not when planktonic culture filtrate was added. In summary, P. aeruginosa affects the growth, morphology, biofilm formation, and virulence of E. dermatitidis. N-acyl-L-homoserine lactone (AHL) QS molecules regulated factors that have been shown to contribute to the inhibition of the ability of E. dermatitidis to form filaments and biofilm.

Computation-Driven Analysis of Model Polyextremo-tolerant Fungus Exophiala dermatitidis: Defensive Pigment Metabolic Costs and Human Applications.

SummaryThe polyextremotolerant black yeast Exophiala dermatitidis is a tractable model system for investigation of adaptations that support growth under extreme conditions. Foremost among these adaptations are melanogenesis and carotenogenesis. A particularly important question is their metabolic production cost. However, investigation of this issue has been hindered by a relatively poor systems-level understanding of E. dermatitidis metabolism. To address this challenge, a genome-scale model (iEde2091) was developed. Using iEde2091, carotenoids were found to be more expensive to produce than melanins. Given their overlapping protective functions, this suggests that carotenoids have an underexplored yet important role in photo-protection. Furthermore, multiple defensive pigments with overlapping functions might allow E. dermatitidis to minimize cost. Because iEde2091 revealed that E. dermatitidis synthesizes the same melanins as humans and the active sites of the key tyrosinase enzyme are highly conserved this model may enable a broader understanding of melanin production across kingdoms.

Computation-Driven Mechanistic Understanding of the Cellular Cost and Role of Defensive Pigment Production in a Polyextremotolerant Fungus

The polyextremotolerant black yeast Exophiala dermatitidis is a tractable model system for investigation of adaptations under extreme conditions. Foremost amongst these adaptations is production of the defensive pigments melanins and carotenoids. A particularly important question is their metabolic production cost. However, this investigation has been hindered by a relatively poor systems-level understanding of E. dermatitidis metabolism. To address this challenge, a genome-scale model (iEde2091) was developed. Using iEde2091, carotenoids were found to be more expensive to produce than melanins. Given their overlapping protective functions, this suggests that carotenoids have an underexplored yet important role of photo-protection under high-energy visible light. Furthermore, multiple defensive pigments with overlapping functions might allow E. dermatitidis to minimize cost. Because iEde2091 revealed that E. dermatitidis synthesizes the same melanins as humans and the active sites of the key tyrosinase enzyme are highly conserved, this model may enable a broader understanding of melanin production across kingdoms.

Transcriptome Study of an Exophiala dermatitidis PKS1 Mutant on an ex Vivo Skin Model: Is Melanin Important for Infection?

The black yeast Exophiala dermatitidis is a polyextremophilic human pathogen, especially known for growing in man-made extreme environments. Reported diseases caused by this fungus range from benign cutaneous to systemic infections with 40% fatality rate. While the number of cases steadily increases in both immunocompromised and immunocompetent people, detailed knowledge about infection mechanisms, virulence factors and host response are scarce. To understand the impact of the putative virulence factor melanin on the infection, we generated a polyketide synthase (PKS1) mutant using CRISPR/Cas9 resulting in a melanin deficient strain. The mutant and the wild-type fungus were inoculated onto skin explants using an ex vivo skin organ culture model to simulate in vivo cutaneous infection. The difference between the mutant and wild-type transcriptional landscapes, as assessed by whole RNA-sequencing, were small and were observed in pathways related to the copper homeostasis, cell wall genes and proteases. Seven days after inoculation the wild-type fungus completely colonized the stratum corneum, invaded the skin and infected keratinocytes while the mutant had only partially covered the skin and showed no invasiveness. Our results suggest that melanin dramatically improves the invasiveness and virulence of E. dermatitidis during the first days of the skin infection.

The Transcriptome of Exophiala dermatitidis during Ex-vivo Skin Model Infection.

The black yeast Exophiala dermatitidis is a widespread polyextremophile and human pathogen, that is found in extreme natural habitats and man-made environments such as dishwashers. It can cause various diseases ranging from phaeohyphomycosis and systemic infections, with fatality rates reaching 40%. While the number of cases in immunocompromised patients are increasing, knowledge of the infections, virulence factors and host response is still scarce. In this study, for the first time, an artificial infection of an ex-vivo skin model with Exophiala dermatitidis was monitored microscopically and transcriptomically. Results show that Exophiala dermatitidis is able to actively grow and penetrate the skin. The analysis of the genomic and RNA-sequencing data delivers a rich and complex transcriptome where circular RNAs, fusion transcripts, long non-coding RNAs and antisense transcripts are found. Changes in transcription strongly affect pathways related to nutrients acquisition, energy metabolism, cell wall, morphological switch, and known virulence factors. The L-Tyrosine melanin pathway is specifically upregulated during infection. Moreover the production of secondary metabolites, especially alkaloids, is increased. Our study is the first that gives an insight into the complexity of the transcriptome of Exophiala dermatitidis during artificial skin infections and reveals new virulence factors.

The Black Yeast Exophiala dermatitidis and Other Selected Opportunistic Human Fungal Pathogens Spread from Dishwashers to Kitchens.

We investigated the diversity and distribution of fungi in nine different sites inside 30 residential dishwashers. In total, 503 fungal strains were isolated, which belong to 10 genera and 84 species. Irrespective of the sampled site, 83% of the dishwashers were positive for fungi. The most frequent opportunistic pathogenic species were Exophiala dermatitidis, Candida parapsilosis sensu stricto, Exophiala phaeomuriformis, Fusarium dimerum, and the Saprochaete/Magnusiomyces clade. The black yeast E. dermatitidis was detected in 47% of the dishwashers, primarily at the dishwasher rubber seals, at up to 106 CFU/cm2; the other fungi detected were in the range of 102 to 105 CFU/cm2. The other most heavily contaminated dishwasher sites were side nozzles, doors and drains. Only F. dimerum was isolated from washed dishes, while dishwasher waste water contained E. dermatitidis, Exophiala oligosperma and Sarocladium killiense. Plumbing systems supplying water to household appliances represent the most probable route for contamination of dishwashers, as the fungi that represented the core dishwasher mycobiota were also detected in the tap water. Hot aerosols from dishwashers contained the human opportunistic yeast C. parapsilosis, Rhodotorula mucilaginosa and E. dermatitidis (as well as common air-borne genera such as Aspergillus, Penicillium, Trichoderma and Cladosporium). Comparison of fungal contamination of kitchens without and with dishwashers revealed that virtually all were contaminated with fungi. In both cases, the most contaminated sites were the kitchen drain and the dish drying rack. The most important difference was higher prevalence of black yeasts (E. dermatitidis in particular) in kitchens with dishwashers. In kitchens without dishwashers, C. parapsilosis strongly prevailed with negligible occurrence of E. dermatitidis. F. dimerum was isolated only from kitchens with dishwashers, while Saprochaete/Magnusiomyces isolates were only found within dishwashers. We conclude that dishwashers represent a reservoir of enriched opportunistic pathogenic species that can spread from the dishwasher into the indoor biome.

Protein functional analysis data in support of comparative proteomics of the pathogenic black yeast Exophiala dermatitidis under different temperature conditions.

In the current study a comparative proteomic approach was used to investigate the response of the human pathogen black yeast Exophiala dermatitidis toward temperature treatment. Protein functional analysis – based on cellular process GO terms – was performed on the 32 temperature-responsive identified proteins. The bioinformatics analyses and data presented here provided novel insights into the cellular pathways at the base of the fungus temperature tolerance. A detailed analysis and interpretation of the data can be found in “Proteome of tolerance fine-tuning in the human pathogen black yeast Exophiala dermatitidis” by Tesei et al. (2015) [1].

Proteome of tolerance fine-tuning in the human pathogen black yeast Exophiala dermatitidis

The black yeast Exophiala dermatitidis is a worldwide distributed agent of primary and secondary diseases in both immunocompromised and healthy humans, with a high prevalence in human-made environments. Since thermo-tolerance has a crucial role in the fungus persistence in man-dominated habitat and in its pathogenicity, three incubation temperatures (37, 45, 1°C) and two time spans (1h, 1week) were selected to simulate different environmental conditions and to investigate the effect of temperature on the proteome of E. dermatitidis CBS 525.76. Using a novel protocol for protein extraction from black yeasts, 2-D DIGE could be applied for characterization of changes in total protein spot abundance among the experimental conditions. A total of 32 variable proteins were identified by mass spectrometry. Data about protein functions, localization and pathways were also obtained. A typical stress response under non-optimal temperature could not be observed at the proteome level, whereas a reduction of the metabolic activity, mostly concerning processes as the general carbon metabolism, was detected after exposure to cold. These results suggest that a fine protein modulation takes place following temperature treatment and a repertoire of stable protein might be at the base of E. dermatitidis adaptation to altered growth conditions. SignificanceE. dermatitidis is a pathogenic black yeast causing neurotropic infections, systemic and subcutaneous disease in a wide range of hosts, including humans. The discovery of the fungus high prevalence in man-made habitats, including sauna facilities, drinking water and dishwashers, generated concern and raised questions about the infection route. In the present work — which is the first contribution on E. dermatitidis proteome — the effect of different temperature conditions on the fungus protein pattern have been analyzed by using a gel-based approach and the temperature responsive proteins have been identified.The absence of a typical stress response following the exposure to non-optimal temperature was detected at the proteome level, along with a general reduction of the metabolic activity after exposure to cold. These results suggest that a very fine regulation of the protein expression as well as adaptations involving a basic set of stable proteins may be at the base of E. dermatitidis enormous ecological plasticity, which plays a role in the fungus distribution, also enabling the transition from natural to human habitat and to the human host.

Molecular typing and antifungal susceptibility of Exophiala isolates from patients with cystic fibrosis

The black yeast Exophiala dermatitidis is a frequent agent of colonization of the lungs of patients with cystic fibrosis (CF). A total of 71 clinical isolates of Exophiala from 13 patients were identified at the species level by sequencing the internal transcribed spacer (ITS) regions 1 and 2 of the rDNA genes and typed by random amplification of polymorphic DNA (RAPD), using two different primers, BG-2 and ERIC-1. In vitro susceptibility of these isolates to some systemic antifungal drugs was investigated using the CLSI method. Almost all the isolates were identified as E. dermatitidis, but long-term colonization with the closely related species E. phaeomuriformis was observed in one patient. No clustering was found according to the geographical origin of the isolates, the isolation date or the antifungal susceptibility. Variations were seen in the susceptibility of studied isolates to antifungals but most of them exhibited low susceptibility to amphotericin B and although some patients were successively colonized by two distinct genotypes, most of the isolates were distributed in patient-specific clusters. This phenomenon may be due to genomic variations of E. dermatitidis in the lung environment of CF patients. These results are typical of colonization of the airways of patients by a poorly distributed environmental fungus, which occupies particular reservoirs that need to be defined.

Antifungal Activity of Antifungal Drugs, as Well as Drug Combinations Against Exophiala dermatitidis

To evaluate the invitro efficacy of common antifungal drugs, as well as the interactions of caspofungin with voriconazole, amphotericin B, or itraconazole against the pathogenic black yeast Exophiala dermatitidis from China, the minimal inhibitory concentrations (MICs) of terbinafine, voriconazole, itraconazole, amphotericin B, fluconazole, and caspofungin against 16 strains of E. dermatitidis were determined by using CLSI broth microdilution method (M38-A2). The minimal fungicidal concentrations (MFCs) were also determined. Additionally, the interactions of caspofungin with voriconazole, amphotericin B, itraconazole or fluconazole, that of terbinafine with itraconazole, or that of fluconazole with amphotericin B were assessed by using the checkerboard technique. The fractional inhibitory concentration index (FICI) was used to categorize drug interactions as following, synergy, FICI≤0.5; indifference, FICI>0.5 and ≤4.0; or antagonism, FICI>4.0. The MIC ranges of terbinafine, voriconazole, itraconazole, amphotericin B, fluconazole, and caspofungin against E. dermatitidis were 0.06-0.125mg/l, 0.25-1.0mg/l, 1.0-2.0mg/l, 1.0-2.0mg/l, 16-64mg/l, and 32-64mg/l, respectively. The invitro interactions of caspofungin with voriconazole, amphotericin B, and itraconazole showed synergic effect against 10/16(62.5%), 15/16(93.75%), and 16/16(100%) isolates, while that of caspofungin with fluconazole showed indifference. Besides, the interaction of terbinafine with itraconazole as well as that of fluconazole with amphotericin B showed indifference. Terbinafine, voriconazole, itraconazole, and amphotericin B have good activity against E. dermatitidis. The combinations of caspofungin with voriconazole, amphotericin B or itraconazole present synergic activity against E. dermatitidis. These results provide the basis for novel options in treating various E. dermatitidis infections.