Cochliobolus Carbonum Research Articles

Total Synthesis and Anticancer Evaluation of BZR-cotoxin IV

Anticancer peptides (ACPs) is a potential alternative for future cancer therapy. ACPs specifically inhibit cancer cells through a non-enzymatic membranolysis mechanism. One potential anticancer peptide worthy of investigation is BZR-cotoxin IV. Currently, research on BZR-cotoxin IV is limited to isolation, making it an interesting area for further development. One approach to developing BZR-cotoxin IV is through chemical synthesis techniques. This compound belongs to the group of cyclodepsipeptides that are naturally produced by the fungus Bipolaris zeicola Race 3. The synthesis of BZR cotoxin IV involves 3 steps: (1) Synthesis of the hydroxy acid precursor by conversion of L-valine amino acid to (2R)-hydroxyisovaleric acid, (2) synthesis of the linear depsipeptide using solid-phase peptide synthesis on 2-chlorotrityl chloride resin and (3) cyclization of the linear depsipeptide using solution phase synthesis to produce the BZR cotoxin IV compound with a purity of 11.7 %. BZR-cotoxin IV was characterized using HR-TOF-MS and 1H and 13C-NMR to validate the desired product. Anticancer activity testing was performed using the Resazurin assay on the HeLa cancer cell line, resulting in an IC50 of 187.50 μg/mL (214.014 μM) categorized as moderate. HIGHLIGHTS The chemical synthesis of BZR-cotoxin IV compounds has not been firstly reported. The synthesis of BZR-cotoxin IV was accomplished through a combination of solid-phase and solution-phase peptide synthesis. The objective was to synthesize and evaluate BZR-cotoxin IV for its cancer properties. GRAPHICAL ABSTRACT

Function of ZmBT2a gene in resistance to pathogen infection in maize

The BTB-TAZ protein is a subfamily of the BTB protein family and plays a crucial regulatory role in plant resistance to pathogen infection. However, the function of the maize BTB-TAZ protein ZmBT2a in maize resistance to pathogens has not been reported. Here, we investigate the role of ZmBT2a in maize resistance to pathogen infection by examining its expression characteristics. The results showed that the expression level of ZmBT2a changed significantly in response to biotic and abiotic stresses in maize. Moreover, ZmBT2a-OE exhibited enhanced resistance to Botrytis cinerea and Pseudomonas syringae pv. tomato DC3000, while the maize ZmBT2a mutants Zmbt2a-1 and Zmbt2a-2 showed increased sensitivity to Fusarium graminearum and Cochliobolus carbonum infections. Notably, the expression of the key synthetic genes ZmLOXs and pathogenesis-related genes ZmPRs in the JA synthesis pathway was significantly down-regulated during F. graminearum infection. Additionally, yeast two-hybrid assays confirmed the direct interaction between ZmBT2a and E3 ubiquitinated proteins ZmCUL3a and ZmCUL3b. These findings suggest that the ZmBT2a gene is crucial in maize resistance to pathogen infection. It is hypothesized that ZmBT2a binds to ZmCUL3 and, through ubiquitination, affects the transcriptional regulation of ZmLOXs and ZmPRs by downstream transcription factors, thus participating in the disease resistance process of maize.

Streptomyces silvisoli sp. nov., a polyene producer, and Streptomyces tropicalis sp. nov., two novel actinobacterial species from peat swamp forests in Thailand.

Two novel actinobacterial strains, designated RB6PN23T and K1PA1T, were isolated from peat swamp soil samples in Thailand and characterized using a polyphasic taxonomic approach. The strains were filamentous Gram-stain-positive bacteria containing ll-diaminopimelic acid in their whole-cell hydrolysates. Phylogenetic analysis of their 16S rRNA gene sequences revealed that strain RB6PN23T was most closely related to Streptomyces rubrisoli (99.1 % sequence similarity) and Streptomyces ferralitis (98.5%), while strain K1PA1T showed 98.8 and 98.7% sequence similarities to Streptomyces coacervatus and Streptomyces griseoruber, respectively. However, the average nucleotide identity (ANI) and digital DNA-DNA hybridization (dDDH) values were below the species-level thresholds (95-96 % ANI and 70 % dDDH). The genomes of strains RB6PN23T and K1PA1T were estimated to be 7.88 Mbp and 7.39 Mbp in size, respectively, with DNA G+C contents of 70.2 and 73.2 mol%. Moreover, strains RB6PN23T and K1PA1T encode 37 and 24 putative biosynthetic gene clusters, respectively, and in silico analysis revealed that these new species have a high potential to produce unique natural products. Genotypic and phenotypic characteristics confirmed that strains RB6PN23T and K1PA1T represented two novel species in the genus Streptomyces. The names proposed for these strains are Streptomyces silvisoli sp. nov. (type strain RB6PN23T=TBRC 17040T=NBRC 116113T) and Streptomyces tropicalis sp. nov. (type strain K1PA1T=TBRC 17041T=NBRC 116114T). Additionally, a giant linear polyene compound, neotetrafibricin A, exhibiting antifungal activity in strain RB6PN23T, was identified through HPLC and quadrupole time-of-flight MS analysis. The crude extract from the culture broth of strain RB6PN23T exhibited strong antifungal activity against Fusarium verticillioides, Fusarium fujikuroi and Bipolaris zeicola. This finding suggests that strain RB6PN23T could be a promising candidate for biological control of fungal diseases.

Wheat dihydroflavonol-4-reductase like gene confers disease resistance by modulating NADPH pool and lignin biosynthesis

Hm1 is the first cloned disease resistance gene (R) from maize which encodes an enzyme that detoxifies Helminthosporium carbonum (HC) toxin from the fungal pathogen Cochliobolus carbonum. The homologous genes for Hm1 have been mined in various crop plants and their sequences are showed similar to dihydroflavonol-4-reductase (DFR), a key enzyme in flavonoid biosynthesis, therefore they are collectively named dihydroflavonol-4-reductase like (DFRL). The biological functions of DFRL are largely elusive. In the present study, DFRL gene was cloned from wheat, namely TaDFRL. TaDFRL was barely expressed in leaf, stem and root tissues; however, its expression level was rapidly increased following rust infection. Biochemical analysis showed that TaDFRL had the broad spectrum of substrate preference, including dihydroflavonol, flavonol and flavone, and could use both NAD and NADP as co-enzyme, which was quite distinct from DFR. Overexpressing TaDFRL in tobacco altered NAD(H) and NADP(H) pools towards to high NADPH levels. Subsequently, the gene expression of cinnamyl alcohol dehydrogenase (CAD) was up-regulated and lignin accumulation was increased. These brought about to enhance resistance to wildfire disease in tobacco plants. This research provides novel insights into DFRL mechanism, which boost host defense responses by elevating NADPH level and lignin biosynthesis.

The Potency of Graphitic Carbon Nitride (gC3N4) and Bismuth Sulphide Nanoparticles (Bi2S3) in the Management of Foliar Fungal Pathogens of Maize

Maize (Zea mays L.) is the most significant grain crop in South Africa. Despite its importance, the cereal is ravaged by several foliar fungal pathogens, which reduce maize quality and quantity at harvest. Hence, this study investigates the fungi associated with foliar diseases of maize in Molelwane, North-West Province, South Africa. The fungi were isolated, characterized and subjected to in vitro nanoparticle control. Samples of diseased maize leaves were aseptically collected from two maize-growing farms. Fungi associated with the samples were isolated and characterized using standard procedures. Bi2S3 (metal-containing) and gC3N4 (non-metallic carbon-based) nanoparticles were synthesized and used to challenge the pathogens using standard procedures. Foliar fungal pathogens isolated from the diseased maize leaves in this study were characterized as Bipolaris zeicola, Phoma herbarum, Epicoccum nigrum, Alternaria alternata and Fusarium brachygibbosum. Phoma herbarium > A. alternata > B. zeicola > F. brachygibbosum > E. nigrum was the order of percentage fungal inhibition by the nanoparticles. Bi2S3 was more effective against the pathogens at lower concentrations and gC3N4 at higher concentration levels. The two nanoparticle types evaluated in vitro shows potential for managing the foliar fungal pathogens, and this needs to be further validated in field studies.

Identification of Pathogens and Evaluation of Resistance and Genetic Diversity of Maize Inbred Lines to Stalk Rot in Heilongjiang Province, China.

Maize stalk rot, caused by multiple pathogens, is a serious soilborne disease worldwide. Composition of pathogens causing maize stalk rot and resistance of maize inbred lines in Heilongjiang Province, China, are not well understood. In this study, 138 fungal isolates were collected from different maize-producing areas in Heilongjiang Province, which were identified as Fusarium graminearum (23.2%), F. subglutinans (18.9%), F. cerealis (18.9%), Bipolaris zeicola (13.0%), F. brachygibbosum (13.0%), F. temperatum (7.2%), and F. proliferatum (5.8%). Among them, F. graminearum (>20%) was the predominant species among the isolates causing maize stalk rot. B. zeicola had not previously been reported causing maize stalk rot in China. Resistance of 67 maize inbred lines to maize stalk rot was assessed, and 24 lines (35.8% of them) were highly resistant or resistant, indicating that approximately 65% of these lines were susceptible to maize stalk rot. Maize inbred lines were analyzed using simple sequence repeat markers and divided into five genetic groups with 12 pairs of primers. Additionally, analysis of molecular variance indicated that 44.2% of the genetic variation in disease resistance was distributed among populations. This study provides insight into the genetic diversity of inbred maize and may contribute useful information for breeding stalk rot disease-resistant hybrids, and facilitates development of effective strategies for managing this destructive disease complex.

The Chromosome-Scale Genomes of Exserohilum rostratum and Bipolaris zeicola Pathogenic Fungi Causing Rice Spikelet Rot Disease

Rice spikelet rot disease occurs mainly in the late stages of rice growth. Pathogenicity and biological characteristics of the pathogenic fungus and the infestation site have been the primary focus of research on the disease. To learn more about the disease, we performed whole-genome sequencing of Exserohilum rostratum and Bipolaris zeicola for predicting potentially pathogenic genes. The fungus B. zeicola was only recently identified in rice.We obtained 16 and 15 scaffolds down to the chromosome level for E. rostratum LWI and B. zeicola LWII, respectively. The length of LWI strain was approximately 34.05 Mb, and the G + C content of the whole genome was 50.56%. The length of the LWII strain was approximately 32.21 Mb, and the G + C content of the whole genome was 50.66%. After the prediction and annotation of E. rostratum LWI and B. zeicola LWII, we predicted that the LWI strain and LWII strain contain 8 and 13 potential pathogenic genes, respectively, which may be related to rice infection. These results improve our understanding of the genomes of E. rostratum and B. zeicola and update the genomic databases of these two species. It benefits subsequent studies on the mechanisms of E. rostratum and B. zeicola interactions with rice and helps to develop efficient control measures against rice spikelet rot disease.

Identification and expression analysis of sugar transporter family genes reveal the role of ZmSTP2 and ZmSTP20 in maize disease resistance

Sugar is an indispensable source of energy for plant growth and development, and it requires the participation of sugar transporter proteins (STPs) for crossing the hydrophobic barrier in plants. Here, we systematically identified the genes encoding sugar transporters in the genome of maize (Zea mays L.), analyzed their expression patterns under different conditions, and determined their functions in disease resistance. The results showed that the mazie sugar transporter family contained 24 members, all of which were predicted to be distributed on the cell membrane and had a highly conserved transmembrane transport domain. The tissue-specific expression of the maize sugar transporter genes was analyzed, and the expression level of these genes was found to be significantly different in different tissues. The analysis of biotic and abiotic stress data showed that the expression levels of the sugar transporter genes changed significantly under different stress factors. The expression levels of ZmSTP2 and ZmSTP20 continued to increase following Fusarium graminearum infection. By performing disease resistance analysis of zmstp2 and zmstp20 mutants, we found that after inoculation with Cochliobolus carbonum, Setosphaeria turcica, Cochliobolus heterostrophus, and F. graminearum, the lesion area of the mutants was significantly higher than that of the wild-type B73 plant. In this study, the genes encoding sugar transporters in maize were systematically identified and analyzed at the whole genome level. The expression patterns of the sugar transporter-encoding genes in different tissues of maize and under biotic and abiotic stresses were revealed, which laid an important theoretical foundation for further elucidation of their functions.

Epicoccum spp. Causing Maize Leaf Spot in Heilongjiang Province, China.

Maize leaf spot occurs worldwide and affects maize production. Maize can be infected by several pathogens causing leaf spot, such as Bipolaris zeicola, Bipolaris maydis, Curvularia species, Alternaria species, etc. In the current study, 30 Epicoccum isolates recovered from symptomatic maize leaves were identified based on morphological characteristics, pathogenicity, and multilocus sequence analyses of nuLSU, ITS, tub2, and rpb2. These maize isolates were grouped into five Epicoccum species, including E. nigrum, E. layuense, E. sorghinum, E. latusicollum, and E. pneumoniae. Pathogenicity tests showed that all five Epicoccum species could produce small ellipse- and spindle-shaped spots on maize leaves. The lesion center was grayish yellow to dark gray and surrounded by a chlorotic area. Furthermore, the Epicoccum isolates exhibited high pathogenicity to 20 main maize varieties of Heilongjiang Province but showed different sensitivities to the commonly used fungicides carbendazim and tebuconazole. In addition, these Epicoccum isolates showed different production capacity of pectinase, cellulase, protease, amylase, laccase, and gelatinase, but all showed high lipase activity. This is the first report globally of E. layuense, E. latusicollum, and E. pneumoniae as causal agents of maize leaf spot. E. pneumoniae was first reported as a plant pathogen.

Influence of the medium on production of trichoderma agent for biocontrol of maize fungal diseases

Maize is important agricultural crop that is susceptible to infections by various phytopathogenic fungi. Maize grain as a rich source of nutrients represents a very good medium for the development of toxic fungi from the different genera. Synthetic fungicides are generally used to protect plants from various pathogenic fungi. However, this practice increases the risk of fungicide resistance and environmental degradation of agroecosystems. The use of Trichoderma isolates in biological control is an alternative strategy, particularly for the problems of resistance and environmental pollution, thus improving the economic and biological sustainability of agroecosystems. In this paper, the effect of medium composition on the production of Trichoderma harzianum biocontrol agent effective against maize pathogens, Helminthosporium carbonum and Penicillium sp., was examined. Results of Scheffe multiple range test showed that the best medium for production of T. harzianum bioagent effective against H. carbonum and Penicillium sp. contains soluble starch as carbon source and soybean meal as nitrogen source. By applying this medium formulation, maximal inhibition zone diameters of 54.33 mm and 24.67 mm was registered in vitro for H. carbonum and Penicillium sp., respectively. Production of Trichoderma bioagent was further tested on the selected medium in a ten times larger volume, Woulff bottle, in which the success of this bioprocess was confirmed. The results obtained in an increased volume on a selected medium showed that this bioprocess can be shortened to 84 h, which contributes to the economy of the bioprocess.

Fungal Species Causing Maize Leaf Blight in Different Agro-Ecologies in India.

Foliar diseases of maize cause severe economic losses in India and around the world. The increasing severity of maize leaf blight (MLB) over the past ten years necessitates rigorous identification and characterization of MLB-causing pathogens from different maize production zones to ensure the success of resistance breeding programs and the selection of appropriate disease management strategies. Although Bipolaris maydis is the primary pathogen causing MLB in India, other related genera such as Curvularia, Drechslera, and Exserohilum, and a taxonomically distant genus, Alternaria, are known to infect maize in other countries. To investigate the diversity of pathogens associated with MLB in India, 350 symptomatic leaf samples were collected between 2016 and 2018, from 20 MLB hotspots in nine states representing six ecological zones where maize is grown in India. Twenty representative fungal isolates causing MLB symptoms were characterized based on cultural, pathogenic, and molecular variability. Internal Transcribed Spacer (ITS) and glyceraldehyde-3-phosphate dehydrogenase (GADPH) gene sequence-based phylogenies showed that the majority of isolates (13/20) were Bipolaris maydis. There were also two Curvularia papendorfii isolates, and one isolate each of Bipolaris zeicola, Curvularia siddiquii, Curvularia sporobolicola, an unknown Curvularia sp. isolate phylogenetically close to C. graminicola, and an Alternaria sp. isolate. The B. zeicola, the aforesaid four Curvularia species, and the Alternaria sp. are the first reports of these fungi causing MLB in India. Pathogenicity tests on maize plants showed that isolates identified as Curvularia spp. and Alternaria sp. generally caused more severe MLB symptoms than those identified as Bipolaris spp. The diversity of fungi causing MLB, types of lesions, and variation in disease severity by different isolates described in this study provide baseline information for further investigations on MLB disease distribution, diagnosis, and management in India.

Phytopathogenic fungi with potential as biocontrol agents for weeds of importance in crops of Antioquia, Colombia

BackgroundUse of phytopathogenic fungi for the biocontrol of weeds represents a promising path in the search for new management alternatives that allow reducing negative effects on the environment and the generation of biotypes having resistance to herbicides. The first step in developing weed biological control programs is to determine the plants and their natural enemies with the highest affinity and potential to achieve effective biocontrol. The objective of the present study was to evaluate the phytopathogenic potential of fungal isolates on four economically important weeds including: Rumex crispus L., Digitaria horizontalis Willd, Persicaria nepalensis (Meisn.) Miyabe, and Thunbergia alata Bojer ex Sims, as a possible biocontrol agent.ResultsMorphological and molecular identification of nine phytopathogenic isolates of weeds was achieved, according to the sequencing of the ITS, β-Tub2, and TEF1-α regions. Pathogenicity of the following species on original hosts was confirmed: Colletotrichum cigarro, Epicoccum draconis, and Didymella rumicicola on R. crispus; Bipolaris sp., on D. horizontalis; Bipolaris zeicola, Phialemoniopsis curvata, and Stemphylium beticola on P. nepalensis and, Alternaria thunbergiae and Nigrospora sphaerica on T. alata. These could be, fairly, considered the first worldwide reports of such interactions, except for A. thunbergiae and Bipolaris sp. The most virulent interactions according to the AUDPC value corresponded to (R. crispus × D. rumicicola), (D. horizontalis × Bipolaris sp.), (P. nepalensis × S. beticola) and (T. alata × A. thunbergiae), with an incidence of 100%.ConclusionThese strains were proposed for future research as potential biocontrol agents, which represented a great resource for the possible generation of new bio-herbicides.

Bipolaquinones A-J, Immunosuppressive Meroterpenoids from a Soil-Derived Bipolaris zeicola.

Ten new meroterpenoids, bipolaquinones A-J (1-10), and one known congener, isocochlioquinone F (11), were isolated and identified from the fermented rice cultures of a soil-derived fungus, Bipolaris zeicola. The planar structures of 1-10 were elucidated based on extensive spectroscopic analyses (including HRESIMS and 1D and 2D NMR data), and their absolute configurations were determined by single-crystal X-ray diffraction analyses, comparison of experimental electronic circular dichroism (ECD) data, ECD calculations, and hydrolysis reaction. The immunosuppressive activity assay revealed that compounds 2, 3, and 7-10 showed significant inhibitory activity against concanavalin A (ConA)-induced T lymphocyte proliferation with IC50 values ranging from 4.1 to 9.4 μM, which furnished potential lead molecules for the design and development of new immunosuppressants for treating autoimmune-associated diseases.

Meroterpenoids with Potent Immunosuppressive Activity from Fungus Bipolaris zeicola

Main observation and conclusionSix new meroterpenoids, bipolarinoids A—F (1—6), and two known congeners (7—8) were isolated from a soil‐derived fungus Bipolaris zeicola. Their structures were elucidated based on extensive spectroscopic techniques (including HRESIMS and 1D and 2D NMR data), and the absolute configurations of 1—4 were further confirmed via single‐crystal X‐ray diffraction analysis and comparison of experimental electronic circular dichroism (ECD) data. Structurally, compound 1 represents the first case of cochlioquinone derivatives featuring a formaldehyde group at C‐11, and compound 3 features a rare amino group at C‐11. In the immunosuppressive activity assay, compounds 5—8 showed potent inhibitory activity against concanavalin A (ConA)‐induced T lymphocyte proliferation with IC50 values of 78.3, 81.1, 48.3, and 48.0 nmol/L, respectively, which provided promising leads for designing and developing new immunosuppressive agents to treat auto‐immunological diseases.

Evaluating the biocontrol potential of Canadian strain Bacillus velezensis 1B-23 via its surfactin production at various pHs and temperatures

BackgroundMicroorganisms, including Bacillus species are used to help control plant pathogens, thereby reducing reliance on synthetic pesticides in agriculture. Bacillus velezensis strain 1B-23 has been shown to reduce symptoms of bacterial disease caused by Clavibacter michiganensis subsp. michiganensis in greenhouse-grown tomatoes, with in vitro studies implicating the lipopeptide surfactin as a key antimicrobial. While surfactin is known to be effective against many bacterial pathogens, it is inhibitory to a smaller proportion of fungi which nonetheless cause the majority of crop diseases. In addition, knowledge of optimal conditions for surfactin production in B. velezensis is lacking.ResultsHere, B. velezensis 1B-23 was shown to inhibit in vitro growth of 10 fungal strains including Candida albicans, Cochliobolus carbonum, Cryptococcus neoformans, Cylindrocarpon destructans Fusarium oxysporum, Fusarium solani, Monilinia fructicola, and Rhizoctonia solani, as well as two strains of C. michiganensis michiganensis. Three of the fungal strains (C. carbonum, C. neoformans, and M. fructicola) and the bacterial strains were also inhibited by purified surfactin (surfactin C, or [Leu7] surfactin C15) from B. velezensis 1B-23. Optimal surfactin production occurred in vitro at a relatively low temperature (16 °C) and a slightly acidic pH of 6.0. In addition to surfactin, B. velenzensis also produced macrolactins, cyclic dipeptides and minor amounts of iturins which could be responsible for the bioactivity against fungal strains which were not inhibited by purified surfactin C.ConclusionsOur study indicates that B. velezensis 1B-23 has potential as a biocontrol agent against both bacterial and fungal pathogens, and may be particularly useful in slightly acidic soils of cooler climates.

Isolation, identification, and characterization of cadmium-tolerant endophytic fungi isolated from barley (Hordeum vulgare L.) roots and their role in enhancing phytoremediation.

Four hundred endophytic fungi isolates with different colony morphologies were isolated from roots of Hordeum vulgare L. collected from un-engineered landfills (the measured cadmium was 0.9 mg kg-1) of Kermanshah province in West Iran. Based on morphology and phylogeny of DNA sequence data for the internal transcribed spacer (ITS) rDNA and comparing the sequences with that available in NCBI database, 11 isolates are identified as dark septate endophytes (DSE) including Alternaria alternata, Microdochium bolleyi, Bipolaris zeicola, Alternaria sp., and Pleosporales sp., and the other nine are not dark septate endophytes (non-DSE) including Fusarium redolens, Fusarium tricinctum, Fusarium monliforme, Clonostachys rosea, and Epicoccum nigrum. Tolerance of DSE and non-DSE strains for Cd were investigated in potato dextrose agar medium. Minimum inhibitory concentrations (MIC) of Cd from nitrate salt source (Cd (NO3)2) and EC50 were determined. The means of MIC and EC50 values for DSE fungi species were 1254.5 and 209.74 mg/kg, compared to 800 and 150.3 mg/kg for non-DSEs. Among the endophytic fungi isolated, Alternaria sp. (TBR5) and Bipolaris zeicola (Tw26) showed the highest tolerance to Cd with a MIC value of 2000 mg/L and 1800 mg/L, respectively. Barley plants were inoculated with TBR5 and Tw26 in Cd-added sands (0, 10, 30, 60 mg Cd/kg sand). In terms of Cd accumulation, our results showed that TBR5 and Tw26 inoculation increased the amount of Cd in the barley roots. TBR5 and Tw26 significantly improved (p < 0.05) plant growth in the presence of Cd by enhancing plant growth attributes such as chlorophyll content, root weight, plant length, fresh weight, and dry weight of plants. This is the first study on the abundance and identification of endophytic root fungi of barley in a cadmium-contaminated soil in Iran. The results of this study showed that DSE and non-DSE have the potential to improve the efficiency of phytoremediation.

First Report of Root Rot Caused by Bipolaris zeicola on Maize in Hebei Province.

Maize (Zea mays L.) is one of the most important cereal crops in China, and the planting area reached 41.3 million hectares in 2019. Root rot is a widespread disease that occurs at the seedling stage of maize, resulting in leaf wilting, root rot and even plant death, and consequently yield and quality losses. During an investigation of spring maize in 2020, seedlings with wilted leaves and dark brown necrotic spots on root were observed in the fields in Kuancheng Manchu Autonomous County, Hebei Province, China. Symptomatic plants were collected for pathogen isolation and identification. The soil on roots was washed off with running water. Then, 2-3 mm necrotic root segments were sampled and surface sterilized with 75% ethanol for 2 min, rinsed three times with sterile distilled water, air-dried on sterile filter paper, and plated on potato dextrose agar (PDA). Plates were incubated at 28℃ in darkness for 3 days. A nonsporulating, dematiaceous fungus growing from root segments was transferred to fresh PDA plates. The colonies were round or irregular round, black, villiform with dense grayish white mycelia. Water agar amended with wheat straw was used for sporulation. Conidiophores were single, light brown, multiseptate, geniculate. Conidia were 38.68 x 10.69 to 71.98 x 20.57 μm, brown, oval, slightly curved, with 2 to 8 septa, and an obviously flattened hilum on the basal cell. Conidia germinated from both poles. The causal agent was identified as Bipolaris zeicola (G.L. Stout) Shoemaker (teleomorph = Cochliobolus carbonum R. R. Nelson) based on its morphological features. For molecular identification, genomic DNA was extracted from fresh mycelia cultured on PDA plates. Partial sequences of ITS-rDNA region and Brn1 reductase melanin biosynthesis gene were amplified using primers ITS1/ ITS4 (TCCGTAGGTGAACCTGCGG/ TCCTCCGCTTATTGATATGC) (White et al. 1990) and Brn01/ Brn02 (GCCAACATCGAGCAAACATGG/ GCAAGCAGCACCGTCAATACCAAT) (Shimizu et al. 1998), respectively. A DNA fragment of 532 bp was obtained from ITS-rDNA region and the sequence (GenBank Accession No. MW407046) was 100% identical to sequence of B. zeicola (GenBank Accession MH864760). The sequence of Brn1 gene was 816 bp (GenBank Accession No. MW415899) and was 99.75% identical to sequence of C. carbonum (GenBank Accession No. AB011658). The morphological and molecular evidence proved that the causal agent isolated from maize roots in Hebei province was B. zeicola. Pathogenicity assays were conducted with one week old (V1 stage) maize seedlings grown from the surface-sterilized seed of cv. Zhengdan 958. The mesocotyl and radicle of each plant (N=3) were inoculated with a 5 mm fungal disk of B. zeicola. Mock-inoculated plants (N=3) with sterile PDA disk served as the negative control. After 7 days, plants inoculated with B. zeicola were wilted with dark brown necrotic spots on mesocotyl and radicle. Meanwhile, the negative controls did not present any symptoms. Koch's postulate was proved with successful re-isolation of the same fungus from the inoculated maize plants. These results confirmed the pathogenicity of B. zeicola on maize root. B. zeicola mainly causes an important foliar disease in many regions of the world, known as Northern corn leaf spot, in addition, it can also cause ear rot and stalk rot of maize (Liu et al. 2015). To our knowledge, this is the first report of root rot caused by B. zeicola on maize in China, which extends the known agents of maize root rot. Therefore, it is necessary to explore effective seed-applied fungicides for disease control. Also, more attention should be paid to develop hybrids with resistance to this disease.

Bioactive Polyketide-Terpenoid Hybrids from a Soil-Derived Fungus Bipolaris zeicola.

Nine novel polyketide-terpenoid hybrids (1-9), characterized by a 1-alkylated-3,5-dihydroxyphenyl derivative coupled with a modified farnesyl pyrophosphate (FPP) unit, were isolated from a soil-derived fungus Bipolaris zeicola. Their structures were determined by comprehensive spectroscopic data, single-crystal X-ray diffraction analyses, and electronic circular dichroism calculations. Structurally, compounds 1, 2, 5, and 6 possess a rare thiazole moiety; compounds 3 and 4 are the first examples of meroterpenoids featuring an undescribed 6/6/6/6/5 pentacyclic system and bearing a tetrahydrofuran ring fused to a polyketide and a sesquiterpenoid subunit; compounds 7 and 8 possess a rare 2H-1,4-thiazin-3(4H)-one moiety; and compound 9 represents the first example of meroterpenoid having an unusual thiazol-2(3H)-one moiety. The bioactivity assays revealed that compounds 1, 2, 5, 6, and 9 exhibited a significant immunosuppressive effect against concanavalin A (ConA)-induced T lymphocyte proliferation with IC50 values ranging from 5.6 to 8.8 μM, and compounds 1, 2, and 4 exhibited moderate cytotoxic activities with IC50 values ranging from 18.4 to 29.4 μM.

First report of brown leaf spot of rice caused by Bipolaris zeicola in Pakistan.

Rice (Oryza sativa L.) is one of the highly consumed cereal grain crops in Pakistan. In September 2017, leaf samples of cultivar Basmati-385 showing brown to dark brown spots (5 to 9 mm in diameter) that were oval or cylindrical in shape with a chlorotic yellow halo and grayish tan centers were collected from fields near the University of Agriculture, Faisalabad (31.43633 N 73.05981 E). Average disease incidence was 69% in six rice fields that were sampled for diseased plants with visible symptoms. To isolate the pathogen, from 20 diseased leaves, 5 mm2 segments from the margins of lesions were cut, rinsed with sterile distilled water (SDW), surface disinfected by 70% ethanol and again rinsed with SDW. The samples were dried on sterilized filter paper discs, plated on potato dextrose agar (PDA) and incubated at 27°C for 5 to 7 days. Twelve isolates were sub-cultured and single-sporing was performed to obtain pure cultures. Fungal isolates with light to dark gray in color, thick or fluffy aerial mycelium, circular and smooth margins were obtained after 7 days of incubation. Conidia were 47-83 μm × 10-17 μm (n=100), with 4 to 10 distosepta, dark or olivaceous brown, straight or moderately curved, and the cells at the ends occasionally looked paler than those in the middle. Conidiophore of the fungus were simple, smooth, cylindrical, septate, and straight to flexuous. These characteristics resembled those of Bipolaris zeicola (Stout) Shoemaker (Manamgoda et al. 2014). For molecular identification, genomic DNA (isolate SU-11) was extracted and the internal transcribed spacer (ITS) region, large subunit (LSU) of ribosomal DNA, translation elongation factor (tef), glyceraldehyde 3-phosphate dehydrogenase (gpd), and RNA polymerase II second largest subunit (rpb2) genes were amplified and sequenced by using the primers ITS1-F/ITS4-R (White et al. 1990), LROR-F/LR5-R (Schoch et al. 2012), EF1-983F/EF1-2218R (Rehner and Buckley 2005), GPD1F/GPD2R (Berbee et al. 1999), and 5F2/7CR (O'Donnell et al. 2007), respectively. BLASTn searches showed 100% homology with the LSU and rpb2 sequences of B. zeicola (GenBank Accession Nos. MH876201 and HF934842) and 98-99% similarity with ITS, tef, and gpd sequences of B. zeicola (GenBank Accession Nos. KM230398, KM093752 and KM034815). The sequences of ITS, LSU, tef, gpd, and rpb2 were deposited in GenBank with accession numbers MN871712, MN877767, MN867685, MN904511 and MT349837, respectively. To fulfill Koch's postulates, 25 greenhouse-grown rice plants (cv. Basmati-385) at 2- to 3-leaf stage were spray inoculated with a spore suspension (105 spores/ml; isolate SU-11) prepared in SDW. Plants were covered with plastic wraps to maintain humid conditions for 24 hours and incubated at 27°C for one week. Similarly, ten non-inoculated plants sprayed with SDW served as controls. After one week, observed symptoms were similar to those from natural infections and no disease symptoms were observed on the non-inoculated plants. The experiment was repeated twice and the pathogen was re-isolated from the infected leaves and characterized morphologically. Globally, B. zeicola has also been reported to cause the leaf spot of rice and maize plants (Sivanesan 1987; Kang et al. 2018). To our information, this is the first report of B. zeicola causing brown leaf spot of rice in Pakistan. The increasing risk of this fungal pathogen in the rice-growing areas of Pakistan need a rigorous exploration and outreach effort to develop effective management practices.

First report of Bipolaris zeicola on barley worldwide

During the conduction of health tests of barley seeds belonging to crops in Argentina, we observed colonies with the appearance of species in the genus Bipolaris. The organism was subsequently keyed to the specie Bipolaris zeicola based on morphological characteristics. This preliminary identification was confirmed by molecular characterization through an amplification of the internal transcriber spacer and glyceraldehyde-3-phosphate dehydrogenase. The fungal isolate was inoculated onto barley and maize seedlings and produced foliar symptoms in both cereals, producing typical symptoms on maize. The present identification constitutes the first report of Bipolaris zeicola on barley worldwide and the first citation of the presence of this pathogen on any host in Argentina.