Binding Of Enantiomers Research Articles

Binding of licarbazepine enantiomers to mouse and human plasma proteins

Racemic licarbazepine (Lic) is the active metabolite of oxcarbazepine (OXC) and eslicarbazepine acetate (ESL), appearing in human plasma as S-licarbazepine (S-Lic) and R-licarbazepine (R-Lic). However, human metabolism of OXC and ESL to Lic differs in the S-Lic/R-Lic enantiomeric ratio observed in plasma. S-Lic appears in higher proportion after ESL administration than after OXC (95% versus 80%). Enantioselective pharmacokinetics of Lic enantiomers have been found in mice after their separate administration and in humans following OXC treatment. Since protein binding of drugs may be enantioselective and a determining factor of pharmacokinetics, the binding of S-Lic and R-Lic to mouse and human total plasma proteins and, specifically, to human serum albumin (HSA) and alpha(1)-acid glycoprotein (AGP) were herein investigated for the first time. Free and bound fractions of S-Lic and R-Lic were separated by ultrafiltration after previous in vitro incubation of spiked plasma samples and protein solutions with each enantiomer at 10, 25 and 50 microg/ml. The results revealed that the extent of binding of Lic enantiomers to total plasma proteins was 30% and independent of the drug concentration and species considered. The data also suggest that the binding of Lic enantiomers to HSA is greater than that to AGP. Moreover, absence of enantioselectivity in the binding of Lic enantiomers to mouse and human plasma proteins and to HSA and AGP is evident. In conclusion, these findings suggest that the enantioselectivity observed in vivo in the biodisposition of S-Lic and R-Lic is not dependent on their affinity to plasma proteins.

Stereoselective protein binding of tetrahydropalmatine enantiomers in human plasma, HSA, and AGP, but not in rat plasma

Tetrahydropalmatine (THP) is one of the active alkaloid ingredients of Rhizoma Corydalis. THP has a chiral center, and the stereoselective pharmacokinetics and tissue distribution have been reported. The aim of the present article is to study the stereoselective protein binding of THP using equilibrium dialysis followed by HPLC-UV analysis. The results showed that THP stereoselectively binds to human serum albumin (HSA), alpha(1)-acid glycoprotein (AGP), and proteins in human plasma. The fraction binding of (+)-THP was significantly higher than that of (-)-THP, whereas such stereoselectivity was not found in rat plasma. The affinity of HSA and AGP to (+)-THP, expressed as nK(A), were 9.0 x 10(3) M(-1) and 2.34 x 10(5) M(-1), respectively, which were notablely higher than to (-)-THP, with the nK(A) of 3.4 x 10(3) M(-1) and 1.44 x 10(5) M(-1), respectively. The binding site of HSA for (-)-THP was Site I, whereas for (+)-THP was both Site I and Site II. The F1/S variants of AGP were proved to be the key variants (-)- and (+)-THP binding to both. Finally, the AGP binding drugs, such as mifepristone, were demonstrated to reduce the fraction binding of (-)- and (+)-THP with pure AGP (1 mg/ml) but did not affect the fraction binding of both (-)- and (+)-THP with proteins in human plasma. It can be concluded that protein binding of THP is species dependent and stereoselective, both HSA and AGP contribute to the stereoselective binding to THP enatiomers, and AGP binding drugs may not cause the drug-drug interaction on THP in healthy human plasma.

About the role of enantioselective selector–selectand interactions and the mobilities of diastereomeric associates in enantiomer separations using CE

It is generally accepted that the selective binding of enantiomers of the chiral analyte to a chiral selector is necessary for enantioseparations in CE, whereas the role of mobility differences between the temporary diastereomeric associates formed between the enantiomers and the chiral selector has been commonly neglected. One of the authors of this study suggested in 1997 that the mobility difference between the diastereomeric associates of two enantiomers with the chiral selector may be solely responsible for a separation of enantiomers in CE and enantioselective selector-selectand binding may be not necessarily required. Several indirect confirmations of this hypothesis have been described in the literature within the last few years but a dedicated study proving this concept has not been published yet. The present data obtained for the two chiral antimycotic drugs ketoconazole and terconazole by CE and NMR spectroscopy unequivocally support this concept.

Enantioselective plasma protein binding of propafenone: Mechanism, drug interaction, and species difference

The interaction of propafenone (PPF) enantiomers with human plasma, human serum albumin (HSA), alpha(1)-acid glycoprotein (AGP), as well as with plasma from rat, rabbit, and cow was investigated using indirect chiral high performance liquid chromatography (HPLC) and ultrafiltration techniques. The stronger binding of the S-PPF found in human plasma was due to AGP. Two classes of binding sites in AGP were identified: one with high-affinity and small binding capacity (K(1(S)) = 7.65 x 10(6) M(-1), n(1(S)) = 0.50; K(1(R)) = 2.81 x 10(6) M(-1), n(1(R)) = 0.46), which revealed stereoselectivity; the other with low-affinity and high-binding capacity (n(2(S)) K(2(S)) = 9.95 x 10(3) M(-1); n(2(R)) K(2(R)) = 9.74 x 10(3) M(-1)). The binding to HSA was found to be weak and not enantioselective (nK(S) = 2.08 x 10(3) M(-1), nK(R) = 2.05 x 10(3) M(-1)). The interaction between enantiomers observed in human plasma was confirmed as a competitive type interacting at the high-affinity site in AGP. The binding mode of both enantiomers with AGP was mainly hydrophobic bond. PPF enantiomers had higher-binding affinity for the F-S variant of human AGP. Drug-drug binding interaction studies showed that verapamil, diazepam, nifedipine, furosemide, nitrendipine, and nimodipine did not affect the binding of PPF enantiomers except quinidine and aprindine at the therapeutic concentration. Comparative studies indicated considerable species-dependent binding stereoselectivity between plasma of the four species investigated.

Probing the Binding of Propranolol Enantiomers to α1-Acid Glycoprotein with Ligand-Detected NMR Experiments

Mapping the interactions of a small molecule ligand with a protein can provide information important for biochemical studies and for drug design and development. This information can be determined using the ligand-detected (1)H NMR experiments T(1rho)-NOESY, diffusion, and saturation transfer difference (STD). This work compares the results of these experiments and examines their ability to distinguish the binding epitopes of propranolol enantiomers with alpha 1-acid glycoprotein (AGP). The epitope maps for the propranolol enantiomers are fairly similar, as expected from their similar binding affinities; however, the STD epitope maps provide unique insights into the different orientations of the enantiomers with respect to the AGP binding pocket. Our results suggest that it is best to consider the data provided by several NMR epitope mapping experiments in drawing conclusions about ligand-protein binding interactions.

Stereoselective plasma protein binding and target tissue distribution of clausenamide enantiomers in rats

Stereoselective differences in pharmacokinetics between clausenamide (CLA) enantiomers have been found after intravenous and oral administration of each enantiomer to rats. The differences could be associated with protein binding of CLA enantiomers. By equilibrium dialysis methods, the binding of CLA enantiomers to rat plasma protein was investigated. The results showed that mean percentages of (-) and (+)CLA in the bound form were 28.5% and 38.0%, respectively, indicating that the unbound fraction of (-)CLA was higher than that of (+)CLA, which provided an explanation for stereoselective pharmacokinetics of CLA enantiomers in rats. The results also showed that there were species differences in plasma protein binding of (-)-isomer between rats (28.5%) and rabbits (47.2%). Furthermore, effects of plasma protein binding on the distribution of CLA enantiomers to their possible target tissues were observed. The amount of (-)CLA in brain was greater than that of (+)CLA 15 min after administration of each enantiomer to rats. But the results were reverse at 4 h postdose. Further studies in distributional kinetics showed that (-)CLA had a more rapid absorption and distribution to hippocampus, cortex, and cerebellum than (+) CLA. (+)CLA had greater values for T(max), t(1/2) (beta), and AUC(0) (-->infinity), and smaller ones for CL/F and V(d)/F than its antipode. The data indicated that the distribution of (-) and (+)CLA in their target tissues was stereoselective. The stereoselective distribution might be involved in the metabolism and transport of two enantiomers in the central nerve system.

Analysis of flurbiprofen, ketoprofen and etodolac enantiomers by pre-column derivatization RP-HPLC and application to drug–protein binding in human plasma

A stereoselective reversed-phase high-performance liquid chromatography (HPLC) assay to determine the enantiomers of flurbiprofen, ketoprofen and etodolac in human plasma was developed. Chiral drug enantiomers were extracted from human plasma with liquid–liquid extraction. Then flurbiprofen and ketoprofen enantiomers reacted with the acylation reagent thionyl chloride and pre-column chiral derivatization reagent ( S)-(−)-α-(1-naphthyl)ethylamine ( S-NEA), and etodolac enantiomers reacted with S-NEA using 1-(3-dimethylaminopropyl)-3-ethyl-carbodiimide (EDC) and 1-hydroxybenzotriazole (HOBT) as coupling agents. The derivatized products were separated on an Agilent Zorbax C 18 (4.6 mm × 250 mm, 5 μm) column with a mixture of acetonitrile–0.01 mol·L −1 phosphate buffer (pH 4.5) (70:30, v/v) for flurbiprofen enantiomers, acetonitrile–0.01 mol·L −1 phosphate buffer (pH 4.5) (60:40, v/v) for ketoprofen enantiomers and methonal–0.01 mol·L −1 potassium dihydrogen phosphate buffer (pH 4.5) (88:12, v/v) for etodolac enantiomers as mobile phase. The flow of mobile phase was set at 0.8 mL·min −1 and the detection wavelength of UV detector was set at 250 nm for flurbiprofen and ketoprofen enantiomers and 278 nm for etodolac enantiomers. The assay was linear from 0.5 to 50 μg·mL −1 for each enantiomer. The inter- and intra-day precision (R.S.D.) was less than 10% and the average extraction recovery was more than 87% for each enantiomer. The limit of quantification for the method was 0.5 μg·mL −1 (R.S.D. < 10%, n = 5). The method developed was used to study the drug–protein binding of flurbiprofen, ketoprofen and etodolac enantiomers in human plasma. The results showed that the stereoselective binding of etodolac enantiomer was observed and flurbiprofen and ketoprofen enantiomers were not.

Chiral recognition of dipeptides in bio-membrane models: the role of amphiphile hydrophobic chains

The influence of the hydrophobic chain length on the chiral recognition capabilities of sodium N-acylprolinate micellar aggregates, used as biomembrane models, was investigated by 1H NMR on the enantiomer couples of ditryptophan. The length of the hydrophobic portion of the surfactant is shown to influence the mode of enantiodiscrimination. Interestingly the hydrophobic chain length also affects the site of binding of heterochiral enantiomers as well as their conformation inside the aggregates.

Acetylation of β-Cyclodextrin Surface-Functionalized Cellulose Dialysis Membranes with Enhanced Chiral Separation

The enhanced enantiomeric separation of racemic phenylalanine solution has been demonstrated by the membrane-based chiral resolution method using an acetylated beta-cyclodextrin-immobilized cellulose dialysis membrane. Beta-cyclodextrin (CD) was first immobilized onto the surface of commercial cellulose dialysis membranes, followed by the acetylation reaction through the treatment of the membranes with acetic anhydride to form the chiral selective acetylated beta-cyclodextrin-immobilized cellulose dialysis membrane. The acetylated CD-immobilized membrane exhibits enantioselectivity in the range of 1.26-1.33 depending on the acetylation time. The improvement in enantioselectivity after acetylation was mainly attributed to the better discrimination ability of acetylated CD and the decrease in membrane pore size. Molecular modeling simulations indicate that the acetylation of hydroxyl groups would result in a CD conformation with torus distortions and would create higher steric hindrance for penetrants. As a result, compared to the original CD, the acetylated CD may have less effective binding but better discrimination of enantiomers. The energy drop is only 3 kcal/mol between different enantiomers before and after the binding of phenylalanine with an unmodified CD. The energy drop increases to 10 kcal/mol if acetylated CD is employed as the chiral selector, showing stronger characteristics for chiral selection.

Effect of Ethanol on the Binding of Warfarin Enantiomers to Human Serum Albumin

Ethanol is widely used as a pharmaceutical excipient for the solubilization of many hydrophobic drugs for injections. However, there are only few studies about drug interaction with pharmaceutical excipients in the body after injection. In this study, the effect of ethanol (500 mM) or several alcohols (500 mM) on the stereoselective binding of warfarin enantiomers to fatty acid-free human serum albumin (HSA) or proteins of commercial albumin preparations was investigated. An ultrafiltration method was used for the separation of unbound warfarin enantiomers. By the addition of ethanol or 1-propanol, the unbound fraction of the S-enantiomer was decreased. On the other hand, the unbound fraction of the R-enantiomer was increased by the addition of ethanol or 1-propanol. Unbound fractions of both the S- and R-enantiomer were decreased by 2-propanol. In various commercial albumin preparations, unbound fractions of both the S- and R-enantiomer were increased by ethanol. The different effects of ethanol among fatty acid-free HSA and commercial albumin preparations were observed.

Chiral resolution of histidine using an anti- d-histidine l-RNA aptamer microbore column

In this paper, we report a new anti-amino acid aptamer chiral stationary phase (CSP). The enantiomers of histidine were separated using an immobilized histidine-specific l-RNA aptamer (40-mer) and an aqueous buffer as mobile phase. The effects of the variation of different operating parameters, including the mobile phase pH and the MgCl 2 concentration as well as the column temperature, on the solute retention were assessed. The results suggested that (i) the protonated form of histidine was involved in the stereospecific RNA binding and (ii) Mg 2+ was essential for the target enantiomer binding to the specific aptamer sites. From a practical point of view, it appeared that the baseline resolution in a minimum analysis time can be achieved at a column temperature of 35 °C for an eluent containing 10 mM of MgCl 2, pH 5.5.

Differential inhibition of Candida albicans CYP51 with azole antifungal stereoisomers.

Azole antifungal compounds are important in agriculture and in the treatment of mycotic infection. The target enzyme, sterol 14 alpha-demethylase (CYP51), is inhibited through binding of triazole N-4 to the haem of this P450, as a sixth ligand together with the N-1 substituent groups interacting in some way with the apoprotein. Here we use Saccharomyces cerevisiae expression systems for the target enzyme of Candida albicans to investigate binding of enantiomers of the azole antifungal compounds SCH39304 and tetraconazole. A molecular model produced previously provided qualitative explanations for these differences. Interaction of the azole antifungal aromatic group with Phe-233 or -235 may cause the higher activity for (R)-tetraconazole while inactivity of the (SS)-enantiomer of SCH39304 was predicted to result from incompatibility of the hydrophilic sulfonyl moiety when located into the hydrophobic pocket of the active site.

Inert benzothiazole functionalised ruthenium(ii) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+{bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the Lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+{Me(2)bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association with hairpin oligonucleotides, again with the Lambda enantiomer binding more strongly. A (1)H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

Biomolecular mirror‐image recognition: Reciprocal chiral‐specific DNA binding of synthetic enantiomers of zinc finger domain from GAGA factor

To experimentally demonstrate the mirror-image recognition in protein and DNA interaction, we have designed a small DNA-binding peptide based on the zinc-finger domain of GAGA transcription factor. Circular dichroism data suggest that the conformations of peptide enantiomers as well as the DNA enantiomers have a mirror-image relationship. The gel mobility shift assay showed that the synthetic enantiomers of the peptide showed reciprocal chiral-specific interactions with the DNA; the natural L-peptide binds specifically with the natural D-DNA substrate, and the unnatural D-peptide binds specifically with the unnatural L-DNA substrate. The present data imply that the folding of the L- and D-enantiomers of the peptide as well as the DNA substrates are exact mirror images of each other in 3-D structure and biological activity, and generalize the chiral-specific nature of biomolecular interaction.

Selective binding of coumarin enantiomers to human α 1-acid glycoprotein genetic variants

Coumarin-type anticoagulants, warfarin, phenprocoumon and acenocoumarol, were tested for their stereoselective binding to the human orosomucoid (ORM; AGP) genetic variants ORM 1 and ORM 2. Direct binding studies with racemic ligands were carried out by the ultrafiltration method; the concentrations of free enantiomers were determined by capillary electrophoresis. The binding of pure enantiomers was investigated with quinaldine red fluorescence displacement measurements. Our results demonstrated that all investigated compounds bind stronger to ORM 1 variant than to ORM 2. ORM 1 and human native AGP preferred the binding of ( S)-enantiomers of warfarin and acenocoumarol, while no enantioselectivity was observed in phenprocoumon binding. Acenocoumarol possessed the highest enantioselectivity in AGP binding due to the weak binding of its ( R)-enantiomer. Furthermore, a new homology model of AGP was built and the models of ORM 1 and ORM 2 suggested that difference in binding to AGP genetic variants is caused by steric factors.

Chromatographic Framework to Determine the Enantiomer Binding Mechanism on Pepsin Protein Surface

This paper describes sodium chloride salt effects on both dansyl-D,L aminoacid derivatives-pepsin protein surface association and the selectivity process. The thermodynamic functions of this enantiomer association were determined. The variation plots of the enantiomer association data versus the sodium chloride salt concentration (x) in the bulk solvent indicated a change in both the enantiomer-pepsin association and selectivity mechanisms. Enthalpy-entropy compensation confirmed this observation. This study shows the importance of taking into account, the electrostatic interactions and the hydrophobic effect in order to determinate optimum conditions for enantiomeric separation in this chromatographic system.

DNA-binding and photoactivated cleavage of enantiomeric ruthenium(II) complexes

A set of enantiomeric RuII complexes Δ- and Λ-[Ru(bpy)2TAPTP](PF6)2(bpy=2,2’-bipyridine, TAPTP=4,5,9,18-tetraazaphenanthreno[9,10-b]triphenylene) have been synthesized and characterized. Binding of both enantiomers to calf thymus DNA has been studied by spectroscopic methods, viscosity, and equilibrium dialysis. The experimental results indicated that both enantiomers bind to DNA by intercalation. Upon irradiation at 302 nm, both enantiomers were found to promote the cleavage of plasmid pBR 322 DNA from supercoiled form I to a nicked form II, and obvious enantioselectively was observed on DNA cleavage, the Λ- enantiomer exhibiting higher cleaving efficiency. The mechanisms for DNA cleavage by the two enantiomers are also proposed.

NMR Evidence for Major Groove Binding of Both Λ‐ and Δ‐[Ru(bpy)2(pqx)](PF6)2 to the Oligonucleotide d(CGCGAATTCGCG)2

AbstractThe enantiomeric complexes Λ‐ and Δ‐[Ru(bpy)2(pqx)](PF6)2 [pqx = 2‐(2′‐pyridyl)quinoxaline] were synthesized and characterized by various spectroscopic techniques. Their binding properties to the oligonucleotide duplex d(CGCGAATTCGCG)2 were subsequently studied by NMR spectroscopy. 1D and 2D NMR techniques provided evidence for major‐groove binding of both enantiomers with the oligonucleotide. The Δ‐[Ru(bpy)2(pqx)](PF6)2 enantiomer binds more deeply enantiomer to the oligonucleotide than the Λone. The quinoxalinic moiety of the pqx ligand faces the major groove in the Δ complex and is oriented at the external side of the adduct in the Λ complex. Both complexes show some affinity for the T8C9 base sequence of the dodecanucleotide helix. (© Wiley‐VCH Verlag GmbH &amp; Co. KGaA, 69451 Weinheim, Germany, 2004)

Differential binding of disopyramide and warfarin enantiomers to human alpha(1)-acid glycoprotein variants.

The F1S and A genetic variants of alpha1-acid glycoprotein (AAG) change under various physiological and pathological conditions. They also vary in their drug binding abilities. We have studied the stereoselective binding ability of each of the AAG variants using enantiomers of disopyramide (DP) and warfarin (WR). The AAG variants were separated by hydroxyapatite chromatography. Binding of drug enantiomers to the AAG variants was studied by the Hummel-Dreyer method. The characteristics of the binding activities were examined by Scatchard plot analysis. The first five amino-terminal amino acids (residues 112-116) of the cyanogen bromide (CNBr) fragment (residues 112-181) of each of the separated AAG fractions were elucidated by Edman degradation. Commercial AAG was separated into two main fractions. Residues 112-116 of fraction 2 were identical to the amino acid sequences predicted from the AAG A gene, LAFDV, and encode the F1S variant. In fraction 3, the deduced amino acid sequence of the AAG B gene, FGSYL, was established, and encodes the A variant. The binding affinities of both DP enantiomers in fraction 3 were significantly higher than those in fraction 2. The differences between dissociation constants (Kd) in fractions 2 and 3 were 5.2-fold for (S)-DP (P < 0.05) and 3.7-fold for (R)-DP (P < 0.001). The dissociation constant of (S)-DP (0.39 +/- 0.08 micro m) was lower than that of (R)-DP (0.53 +/- 0.10 micro m) in fraction 3 [95% confidence interval (CI) - 0.282, - 0.010; P < 0.05], although the binding activities of the DP enantiomers were almost the same in fraction 2. By contrast WR enantiomers had a higher binding affinity in fraction 2 than in fraction 3, the differences in dissociation constants between fractions 2 and 3 being 12.6-fold for (S)-WR (P < 0.001) and 8.3-fold for (R)-WR (P < 0.001). The dissociation constant of (S)-WR (0.28 +/- 0.10 microm) was significantly lower than that of (R)-WR (0.48 +/- 0.08 microm) in fraction 2 (95% CI - 0.369, - 0.028; P < 0.05), but there were no significant differences between the binding activities of WR enantiomers in fraction 3. DP and WR enantiomers bind preferentially to fraction 3 and fraction 2, respectively. Fractions 2 and 3 are encoded by the AAG A and the AAG B genes, respectively.

Diastereoisomerism, contact points, and chiral selectivity: a four-site saga

In biology, chiral recognition usually implies the ability of a protein, such as an enzyme or a drug receptor, to distinguish between the two enantiomeric forms of a chiral substrate or drug. Both diastereoisomerism and specific contacts between enzyme/receptor and substrate/drug are necessary. The minimum requirement is for four contact points including four nonplanar atoms (or groups of atoms) in both probe and target. The molecular models described by Easson and Stedman and by Ogston require three binding sites in a plane. A modified model with three binding sites in three dimensions is described. Under certain circumstances this model allows binding of both enantiomeric forms of a substrate or a drug. Enantiomer superposition of two enantiomers at an active site occurs in some specific cases (e.g., phenylalanine ammonia-lyase, isocitrate dehydrogenase) and is likely in others. The nature of enantiomer binding to racemase enzymes is discussed.