Beta Macrocarpa Research Articles

Agroinoculation of Beet necrotic yellow vein virus cDNA clones results in plant systemic infection and efficient Polymyxa betae transmission

Agroinoculation is a quick and easy method for the infection of plants with viruses. This method involves the infiltration of tissue with a suspension of Agrobacterium tumefaciens carrying binary plasmids harbouring full-length cDNA copies of viral genome components. When transferred into host cells, transcription of the cDNA produces RNA copies of the viral genome that initiate infection. We produced full-length cDNA corresponding to Beet necrotic yellow vein virus (BNYVV) RNAs and derived replicon vectors expressing viral and fluorescent proteins in pJL89 binary plasmid under the control of the Cauliflower mosaic virus 35S promoter. We infected Nicotiana benthamiana and Beta macrocarpa plants with BNYVV by leaf agroinfiltration of combinations of agrobacteria carrying full-length cDNA clones of BNYVV RNAs. We validated the ability of agroclones to reproduce a complete viral cycle, from replication to cell-to-cell and systemic movement and, finally, plant-to-plant transmission by its plasmodiophorid vector. We also showed successful root agroinfection of B. vulgaris, a new tool for the assay of resistance to rhizomania, the sugar beet disease caused by BNYVV.

Beet necrotic yellow vein virus subgenomic RNA3 is a cleavage product leading to stable non-coding RNA required for long-distance movement

Beet necrotic yellow vein virus (BNYVV) is a multipartite RNA virus. BNYVV RNA3 does not accumulate in non-host transgenic Arabidopsis thaliana plants when expressed using a 35S promoter. However, a 3'-derivative species has been detected in transgenic plants and in transient expression assays conducted in Nicotiana benthamiana and Beta macrocarpa. The 3'-derivative species is similar to the previously reported subgenomic RNA3 produced during virus infection. 5' RACE revealed that the truncated forms had identical 5' ends. The 5' termini carried the coremin motif also present on BNYVV RNA5, beet soil-borne mosaic virus RNA3 and 4, and cucumber mosaic virus group 2 RNAs. This RNA3 species lacks a m(7)Gppp at the 5' end of the cleavage products, whether expressed transiently or virally. Mutagenesis revealed the importance of the coremin sequence for both long-distance movement and stabilization of the cleavage product in vivo and in vitro. The isolation of various RNA3 5'-end products suggests the existence of a cleavage between nt 212 and 1234 and subsequent exonucleolytic degradation, leading to the accumulation of a non-coding RNA. When RNA3 was incubated in wheatgerm extracts, truncated forms appeared rapidly and their appearance was protein- and divalent ion-dependent.

A full-length infectious clone of beet soil-borne virus indicates the dispensability of the RNA-2 for virus survival in planta and symptom expression on Chenopodium quinoa leaves

For a better understanding of the functionality and pathogenicity of beet soil-borne virus (BSBV), full-length cDNA clones have been constructed for the three genomic RNAs. With the aim of assessing their effectiveness and relative contribution to the virus housekeeping functions, transcripts were inoculated on Chenopodium quinoa and Beta macrocarpa leaves using five genome combinations. Both RNAs-1 (putative replicase) and -3 (putative movement proteins) proved to be essential for virus replication in planta and symptom production on C. quinoa, whereas RNA-2 (putative coat protein, CP, and a read-through domain, RT) was not. No symptoms were recorded on B. macrocarpa, but viral RNAs were detected. In both host plants, the 19 kDa CP was detected by Western blotting as well as a 115 kDa protein corresponding to the CP-RT.

Role of Ammonium to Limit Nitrate Accumulation and to Increase Water Economy in Wild Swiss Chard

ABSTRACT The present study was performed to characterize the interaction between nitrogen (N) form and availability with respect to growth, water relations, and mineral nutrition of wild swiss chard (Beta macrocarpa Guss). Plants were cultured hydroponically with two levels of N concentrations, high-N (2.5 mM) or low-N (0.5 mM), added as nitrate (NO− 3) or ammonium (NH+ 4). At high N, growth was affected significantly by N form. If the NO− 3 medium was considered as control, the use of NH+ 4 decreased dry matter production and leaf area by ca. 35%. Use of NH+ 4 led to water economy and did not affect the nutrient content of the plant tissues. Compared to growth with high N, plants growth fell in either low- NO− 3 or low- NH+ 4 medium. In this case, the difference between the two N sources was not significant. Our results showed that the replacement of NO− 3 by NH+ 4 as the N source decreased the NO− 3 concentration in consumable leaves and increased the water use efficiency.

Beet soil-borne mosaic virus RNA-3 is replicated and encapsidated in the presence of BNYVV RNA-1 and -2 and allows long distance movement in Beta macrocarpa

Beet soil-borne mosaic virus (BSBMV) and Beet necrotic yellow vein virus (BNYVV) belong to the Benyvirus genus. BSBMV has been reported only in the United States, while BNYVV has a worldwide distribution. Both viruses are vectored by Polymyxa betae and possess similar host ranges, particle number and morphology. BNYVV and BSBMV are not serologically related but they have similar genomic organizations. Field isolates usually consist of four RNA species but some BNYVV isolates contain a fifth RNA. RNAs 1 and 2 are essential for infection and replication while RNAs 3 and 4 play important roles in plant and vector interactions, respectively. Nucleotide and amino acid analyses revealed that BSBMV and BNYVV are sufficiently different to be classified as two species. Complementary base changes found within the BSBMV RNA-3 5′ UTR made it resemble to BNYVV 5′ RNA-3 structure whereas the 3′ UTRs of both species were more conserved. cDNA clones were obtained, and allowed complete copies of BSBMV RNA-3 to be trans-replicated, trans-encapsidated by the BNYVV viral machinery. Long-distance movement was observed indicating that BSBMV RNA-3 could substitute BNYVV RNA-3 for systemic spread, even though the p29 encoded by BSBMV RNA-3 is much closer to the RNA-5-encoded p26 than to BNYVV RNA-3-encoded p25. Competition occurred when BSBMV RNA-3-derived replicons were used together with BNYVV-derived RNA-3 but not when the RNA-5-derived component was used. Exploitation of the similarities and divergences between BSBMV and BNYVV should lead to a better understanding of molecular interactions between Benyviruses and their hosts.

Identification of differentially expressed root genes upon rhizomania disease.

Rhizomania is one of the most devastating sugar beet diseases. It is caused by Beet necrotic yellow vein virus (BNYVV), which induces abnormal rootlet proliferation. To understand better the physiological and molecular basis of the disorder, transcriptome analysis was performed by restriction fragment differential display polymerase chain reaction (RFDD-PCR), which provided differential gene expression profiles between non-infected and infected sugar beet roots. Two distinct viral isolates were used to detect specific or general virus-induced genes. Differentially expressed genes were selected and identified by sequence analysis, followed by reverse Northern and reverse transcriptase PCR experiments. These latter analyses of different plants (Beta vulgaris and Beta macrocarpa) infected under distinct standardized conditions revealed specific and variable expressions. Candidate genes were linked to cell development, metabolism, defence signalling and oxidative stress. In addition, the expression of already characterized genes linked to defence response (pathogenesis-related protein genes), auxin signalling and cell elongation was also studied to further examine some aspects of the disease. Differential expression was retrieved in both B. vulgaris and B. macrocarpa. However, some candidate genes were found to be deregulated in only one plant species, suggesting differential response to BNYVV or specific responses to the BNYVV vector.

First Report of Pelargonium zonate spot virus from Tomato in the United States.

Pelargonium zonate spot virus (PZSV) was first isolated from tomato in southern Italy in 1982 (1) and later was also reported from Spain (3) and France (2). Infected tomato plants showed stunting, malformation, yellow rings and line patterns on the leaves, and concentric chlorotic ringspots on the stems. In June of 2006, more than 100 tomato (Lycopersicon esculentum Mill.) plants exhibiting symptoms similar to PZSV were observed in seven acres of tomato fields in Yolo County, California. The causal agent was mechanically transmitted to several indicator species. Symptoms on infected plants included local lesions on Beta macrocarpa, Chenopodium amaranticolor, C. capitatum, C. quinoa, Cucumis melo, Cucurbita pepo, and Tetragonia expansa, and systemic infection on Capsicum annuum, Chenopodium murale, L. esculentum, Nicotiana benthamiana, N. clevelandii, N. glutinosa, N. tabacum, Physalis floridana, and P. wrightii. Two field-infected tomato plants and one each of the mechanically inoculated host plant were positive with double-antibody sandwich (DAS)-ELISA using a commercial PZSV IdentiKit (Neogen Europe Ltd., Ayr, Scotland, UK). Partially purified virions stained with 2% uranyl acetate contained spherical to ovate particles. The particle diameters ranged between 25 and 35 nm. Published sequences of PZSV (GenBank Accession Nos. NC_003649 for RNA1, NC_003650 for RNA2, and NC_003651 for RNA3) were used to design three sets of primer pairs specific for PZSV RNA1 (R1-F: 5' TGGCTGGCTTTTTCCGAACG 3' and R1-R: 5' CCTAATCTGTTGGTCCGAACTGTC 3'), RNA2 (R2-F: 5' GCGTGCGTATCATCAGAAATGG 3' and R2-R: 5' ATCGGGAGCAG AGAAACACCTTCC 3'), and RNA3 (R3-F: 5' CTCACCAACTGAAT GCTCTGGAC 3' and R3-R: 5' TGGATGCGTCTTTCCGAACC 3') for reverse transcription (RT)-PCR tests. Total nucleic acids were extracted from field-infected tomato plants and partially purified virions for RT-PCR. RT-PCR gave DNA amplicons of the expected sizes. The DNA amplicons were gel purified and sequenced. The sequenced amplicons had 92, 94, and 96% nt sequence identity to PZSV RNA1, RNA2, and RNA3, respectively. The symptomatology, serology, particle morphology, and nucleotide sequences confirm the presence of PZSV in a tomato field in California. To our knowledge, this is the first report of the occurrence of PZSV in the United States.

Physiological Response to Sodium Chloride of Wild Swiss Chard

ABSTRACT The present work was aimed at determining the limits of tolerance to sodium chloride (NaCl) of a halophyte, Beta macrocarpa Guss (wild Swiss chard). Five week-old plants were cultivated with a nutritive solution to which was added 0, 100, 200, and 300 mM NaCl. Plants were harvested after four weeks of treatment. The growth (fresh and dry weight, leaf surface area, and leaf number), water contents, and the mineral composition (meq · g−1 DW) of roots and leaves (reduced nitrogen (N), K+, Ca2 +, Na+, Cl−) were determined on individual plants. Results show that Beta macrocarpa can tolerate up to 200 mM NaCl. A significant decrease in biomass production (to 50% of control) was observed only for 300 mM NaCl. In the latter treatment, leaf mean surface area was 25% of control. The shoot-to-root ratio was not changed. Leaf hydration was not modified by salt treatment. This ability of the plant to maintain the hydric equilibrium of its leaves seemed associated with an efficient intracellular compartmentalization of Na+ and Cl− ions. Salt treatment had little effect on N content (80% of control), but decreased significantly K+ and Ca2 + contents. These three essential elements could be limiting for growth of leaves and roots of plants challenged by NaCl.

Use of a Beet necrotic yellow vein virus RNA-5-derived replicon as a new tool for gene expression

A new gene-expression system based on RNA-5 of Beet necrotic yellow vein virus (BNYVV) was constructed to allow the expression of recombinant proteins in virally infected cells. Replication and expression levels of the RNA-5-based replicon containing the green fluorescence protein (GFP) gene were compared with those obtained with the well-characterized RNA-3-derived replicon (Rep-3). When RNA-3 and/or RNA-4 BNYVV RNAs were added to the inoculum, the expression levels of RNA-5-encoded GFP were considerably reduced. To a lesser extent, RNA-3-derived GFP expression was also affected by the presence of RNA-4 and -5. Both RNA-3- and RNA-5-derived molecules were able to express proteins within the same infected cells. Together with Rep-3, the RNA-5-derived replicon thus provides a new tool for the co-expression of different recombinant proteins. In Beta macrocarpa, Rep-5-GFP was able to move in systemic tissues in the presence of RNA-3 and thus provides a new expression system that is not restricted to the inoculated leaves.

Vascular movement of beet necrotic yellow vein virus in Beta macrocarpa is probably dependent on an RNA 3 sequence domain rather than a gene product.

RNAs 1 and 2 of beet necrotic yellow vein virus (BNYVV) carry the functions enabling viral RNA replication, cell-to-cell movement, virus assembly and vascular movement of the virus in the systemic host Spinacea oleracea. In Beta macrocarpa, on the other hand, BNYVV RNA 3 is required for vascular movement. Replication-competent RNA 3 transcripts carrying various point mutations and deletions were coinnoculated with RNAs 1 and 2 to young leaves of B. macrocarpa and the ability of the virus to multiply on the inoculated leaves and to invade the plant systemically was examined. None of the RNA 3 mutants tested interfered with virus multiplication in the inoculated leaves. Point mutations designed to specifically block or truncate translation of the ORFs of the two known RNA 3 gene products, P25 and N, did not interfere with vascular movement. Vascular movement was not inhibited by deletions eliminating the short 5'-proximal ORF on RNA 3 (ORF A) or by point mutations blocking putative translation of the short 5'-proximal ORF (ORF S) on RNA 3sub, a subgenomic RNA derived from RNA 3. On the other hand, deletions in a 'core region' encompassing nucleotides 1033-1257 of RNA 3 completely blocked vascular movement of the virus while removal of sequences flanking the core region lowered its efficiency. The observations suggest that some feature of the RNA 3 sequence rather than an RNA-3 coded protein is important for vascular movement of BNYVV in B. macrocarpa.

A New Report of Rhizomania and Other Furoviruses Infecting Sugar Beet in Minnesota

Several fields planted in sugar beet (Beta vulgaris) in the Southern Minnesota Beet Sugar Cooperative growing area showed patches of pale greenish yellow foliage and upright leaves characteristic of rhizomania. Other symptoms included reduced root size and root proliferation. Samples taken from these areas during August of 1996 were evaluated for beet necrotic yellow vein virus (BNYVV), the cause of rhizomania, and for other sugar beet furoviruses. BNYVV was identified in 59 of 90 beet samples tested with enzyme-linked immunosorbent assay and Western blot (immunoblot) analyses (molecular mass approximately 22 kDa) with specific (polyclonal antisera donated by K. Richards; monoclonal antisera donated by G. Grassi) and broadly reactive antisera produced at the USDA in Salinas, CA. Recovery by mechanical inoculation of Chenopodium quinoa and Beta macrocarpa confirmed identity. Beet leaves showing symptoms of vein clearing, vein banding, mosaic, and vein necrosis were all identified as being infected with beet soilborne mosaic virus (BSBMV). No systemic leaf symptoms of BNYVV were found in any sample. The BSBMV isolates were identical to one another based on symptomatology of indicator plants and molecular masses in Western blots (approximately 24 kDa), but symptoms were distinct from those of other members of the BSBMV serogroup isolates previously studied from Texas, Idaho, Nebraska, and Colorado. The beet soilborne virus (BSBV) was also recovered by mechanical inoculation and Western blot analysis (antisera donated by R. Koenig) in three samples of field-collected beets. This is a new report of BNYVV, BSBMV, and BSBV in Minnesota. The distribution of rhizomania in infested fields was not isolated to any general area, which indicates that the virus has been present and multiplying in previous sugar beet crops and was not detected. Severity of infection ranged from mild root symptoms with near normal yields and sugar content, to moderate and severe root symptoms with low yields and low sugar content.

Evidence that Beet Necrotic Yellow Vein Virus RNA-4 Is Essential for Efficient Transmission by the Fungus Polymyxa betae

SUMMARY The efficiency of transmission by Polymyxa betae of beet necrotic yellow vein virus (BNYVV) isolates containing different RNA components was compared using sugar-beet seedlings as test plants. Isolate S-4, containing RNA-1 +2 + 4, was transmitted by P. betae about 100 times more efficiently than isolate S-3 (RNA-1 +2 + 3) and about 1000 times more efficiently than isolate S-0 (RNA-1 + 2). Isolate S-34 (RNA-1 + 2 + 3 + 4) was transmitted even more efficiently than isolate S-4. Each isolate retained its characteristic RNA composition after transmission by P. betae. The virus content, measured by ELISA, of infected rootlets was S-34 > S-3 > S-4 > S-0. In inoculated leaves of Tetragonia expansa and Beta macrocarpa, isolates S-3 and S-34 multiplied more extensively than did S-4 and S-0. The inefficient transmission of isolate S-3 by P. betae, as compared with S-4, cannot be attributed to a poorer ability to spread in root tissue, but the difference in transmissibility of S-3 and S-0 may be explained in this way. These results show that RNA-4 of BNYVV is essential for efficient transmission by P. betae, and suggest that RNA-3 may influence the ability of the virus to spread in root tissue. RNA-4 and RNA-3 therefore seem to play important, but different, roles in virus survival and spread in nature.

The Diploidised Meiosis of Tetraploid Beta macrocarpa and its Possible Application in Breeding Sugar Beet

AbstractAccessions of Beta macrocarpa Guss., collected on the Canary Islands, were tetraploid (2n = 36). Three of these accessions were studied in detail. The plants were rather uniform in their morphological appearance, both within and between accessions, and were annual and fully self‐compatible. Meiosis was completely diploidised, suggesting an alloploid nature of the tetraploid species. Crosses with diploid B. vulgaris yielded triploid hybrids which were sterile or nearly so; a few descendants of such hybrids were highly aneuploid. Crosses between tetraploid B. macrocarpa and autotetraploid cytotypes of B. vulgaris showed variable results, only part of these crosses yielded tetraploid hybrids. The tetraploid hybrids exhibited somewhat higher fertility than the triploids. An F2 generation showed partial hybrid dwarfness, partial fertility and segregation for carliness and coloration of the hypocotyl. All hybrids had multivalents at meiosis (averages: 2.5—5.4 multivalents per pollen mother cell), indicating suppression of the diploidised meiosis. The possibilities of application of the diploidised meiosis in breeding sugar beet are discussed.

Naturally Occurring Hybrids Between Sugarbeet and Beta Macrocarpa in the Imperial Valley of California

Bluehost - Top rated web hosting provider - Free 1 click installs For blogs, shopping carts, and more. Get a free domain name, real NON-outsourced 24/7 support, and superior speed. web hosting provider php hosting cheap web hosting, Web hosting, domain names, front page hosting, email hosting. We offer affordable hosting, web hosting provider business web hosting, ecommerce hosting, unix hosting. Phone support available, Free Domain, and Free Setup.

Beet Necrotic Yellow Vein Virus from Rizomania-Affected Sugar Beet in Japan

A virus, designated as beet necrotic yellow vein virus (BNYVV), was isolated from sugar beet plants affected with rizomania disease. The virus was transmitted through the soil and by sap inoculation, but not by the aphids, Myzus persicae and Aulacorthum solani. Of 84 species of plants belonging to 16 families inoculated by sap, 15 of 17 species belonging to Chenopodiaceae, Tetragonia expansa and Gomphrena glohosa plants became infected with the virus. The virus tended to be restricted to the inoculated leaves of all host plants, but sugar beet, spinach, and Beta macrocarpa plants occasionally became infected systemically. The thermal inactivation point of the virus was between 65 and 70C, the dilution end point was 10-4, and the infectivity was retained for 5 days at 20C or for 8 days at 4C. BNYVV particles (isolate YS) had a diameter of about 20nm and three peaks of length distribution at 95-110nm, 255-270nm, and 370-390nm. The virus was partially purified by organic-solvent clarification and polyethylene glycol precipitation. An antiserum to BNYVV had a titer of 1/1, 024 in ring precipitin tests. In agar gel-diffusion tests, a band of precipitation was produced between the virus and its antiserum. BNYVV did not serologically relate to soil-borne wheat mosaic virus, tobacco rattle virus, and tobacco mosaic virus. The present cryptogram of BNYVV is */*:*/*:E/E:S/(Fu).