Benzothiazole Complexes Research Articles

Antimicrobial applications of transition metal complexes of benzothiazole based terpolymer: synthesis, characterization, and effect on bacterial and fungal strains.

Terpolymer of 2-amino-6-nitro-benzothiazole-ethylenediamine-formaldehyde (BEF) has been synthesized and characterized by elemental analysis and various spectral techniques like FTIR, UV-Visible, and 1H and 13C-NMR. The terpolymer metal complexes were prepared with Cu2+, Ni2+, and Zn2+ metal ions using BEF terpolymer as a ligand. The complexes have been characterized by elemental analysis and IR, UV-Visible, ESR, 1H-NMR, and 13C-NMR spectral studies. Gel permeation chromatography was used to determine the molecular weight of the ligand. The surface features and crystalline behavior of the ligand and its complexes were analyzed by scanning electron microscope and X-ray diffraction methods. Thermogravimetric analysis was used to analyze the thermal stability of the ligand and its metal complexes. Kinetic parameters such as activation energy (E a) and order of reaction (n) and thermodynamic parameters, namely, ΔS, ΔF, S*, and Z, were calculated using Freeman-Carroll (FC), Sharp-Wentworth (SW), and Phadnis-Deshpande (PD) methods. Thermal degradation model of the terpolymer and its metal complexes was also proposed using PD method. Biological activities of the ligand and its complexes were tested against Shigella sonnei, Escherichia coli, Klebsiella species, Staphylococcus aureus, Bacillus subtilis, and Salmonella typhimurium bacteria and Aspergillus flavus, Aspergillus niger, Penicillium species, Candida albicans, Cryptococcus neoformans, Mucor species fungi.

Syntheses, structures, spectroscopic properties and DFT calculations of Re(V)-benzothiazole and 2-(2-aminophenyl)benzothiazole complexes

The paper presents a combined experimental and computational study of novel oxorhenium(V) complexes of benzothiazole (bt) and 2-(2-aminophenyl)benzothiazole (apbt). The complexes [Re2O3Cl4(bt)4]·H2O (1·H2O), [ReO(OEt)Cl2(bt)(PPh3)]·Me2CO (2·Me2CO), [ReO(OPri)Cl2(bt)(PPh3)] (3), [ReOCl2(apbt)(OPPh3)] (4) and [ReOCl2(apbt)(OAsPh3)]·0.5CHCl3 (5·0.5CHCl3) have been characterized structurally (by single-crystal X-ray diffraction) and spectroscopically (by IR, NMR, UV–Vis). For compounds 1, 2 and 4, DFT and TD-DFT calculations have been performed to obtain their IR and UV–Vis absorption spectra, and satisfactory theoretical–experimental agreement was achieved. Additional information about binding between the rhenium atom and oxo ligand in the complexes 1, 2 and 4 has been obtained by NBO analysis.

ChemInform Abstract: Complexes of Benzothiazole with Some Group IV Metal Halides.

Abstract Complexes of benzothiazole (BT) of the composition SnX4 (BT) and MCl4(BT)2 (where X = Cl, Br or I; M = Ti, Zr or Si and BT = C7H5SN) have been prepared and studied by spectroscopic (proton magnetic resonance, electronic absorption and infrared spectra) techniques. The stability and composition of the complexes were established by melting point/decomposition point determinations and elemental analysis, respectively. Molar conductivity measurements show the covalent nature of the complexes. A polymeric structure involving ligand bridging through the sulphur and nitrogen atoms is suggested for the SnX4(BT) complexes. A trans-octahedral structure is suggested for the zirconium, silicon and titanium complexes with the ligands coordinated through the nitrogen atom.

Evaluation of Re and 99mTc Complexes of 2-(4′-Aminophenyl)benzothiazole as Potential Breast Cancer Radiopharmaceuticals

The synthesis of M(I)(CO)(3)(NNO) (M = Re, (99m)Tc) complexes conjugated to the antitumor agent 2-(4'-aminophenyl)benzothiazole and to its 6-methyl derivative, as well as their in vitro and in vivo biological evaluation as breast cancer radiopharmaceuticals, is reported. The Re complexes displayed under the fluorescence microscope clear uptake by the sensitive to the 2-(4'-aminophenyl)benzothiazole pharmacophore breast cancer cell lines MCF-7 and T47D, while uptake by less sensitive lines and by normal fibroblasts was much weaker. In accordance, uptake of the corresponding radioactive (99m)Tc complexes was clearly higher in the breast cancer cell lines MCF-7 and MDA-231 compared to normal fibroblasts. Biodistribution of the (99m)Tc complexes in SCID mice bearing MCF-7 xenografts showed appreciable tumor uptake. A tumor/muscle ratio of 2.2 was measured for the complex conjugated to 2-(4'-aminophenyl)benzothiazole that led to successful tumor imaging. The results render the 2-(4'-aminophenyl)benzothiazole complexes potential candidates for imaging ((99m)Tc) and targeted radiotherapy ((188)Re) of breast cancer.

Synthesis, Characterization and Antifungal Activities of Copper(II) Soaps and their Complexes Derived from Azadirecta Indica (Neem) and Pongamia Pinnata (Karanj) Oil

Abstract Neem (Azadirecta indica) and Karanj (Pongamia pinnata) oils are ecofriendly, non-toxic, completely biodegradable with antiviral, antifungal, and antibacterial properties. The dark green colour Copper(II) soaps derived from Neem and Karanj oil, their greenish brown complexes with ligand 2-amino-6-methyl benzothiazole containing nitrogen and sulphur have been synthesized and characterized by elemental analysis. IR and NMR of complexes suggest that the complexation has taken place successfully. From the analytical data the stoichiometry of the complexes has been observed to be 1:1 (metal-ligand). Copper soaps and their complexes are good anti-fungal agents. The fungi toxicities of the oils, soaps and complexes of neem and karanj have been investigated. The results indicate that the strain of Candida species is susceptible towards complexes of benzothiazole.

Viscometric Behaviour and Micellization of Complexes of Copper (II) Stearate with N-donor Heterocyclic Dyes

Abstract Colloido-chemical behavior of copper (II) stearate and N-donor ligands in benzene-methanol mixture of varying composition has been investigated by viscometric measurements. The critical micelle concentration values depend upon the composition of solvent mixture and are to be found in close agreement with each other. The general trend observed is that the viscometric parameters with concentration are quite different and the plots are obtained with curvature at a definite concentration corresponding to critical micelle concentration at which there is marked change in the aggregation of the complex molecules. The results of phenylthiourea and benzothiazole complexes in regards to solute-solvent and solute-solute interactions in mixed solvent systems have been discussed in terms of the equations proposed by Moulik and Jones-Dole. The complexes were synthesized with N-donor ligands and copper (II) stearate and characterized by their elemental analysis, molecular weight, melting point, IR and NMR spectral studies. Due to the surface-active properties of copper stearate, the complexes show remarkable applications in industries and are used as emulsifiers, dispersing agents, foaming and wetting agents. N-donor ability of ligands make them useful as intermediates for many organic compounds such as colorants, agrochemical and pharmaceutical. They are good antiviral, antibacterial and antimalerial agents.

Synthesis and electrochemical study of 2-(2-pyridyl)benzothiazole complexes with transition metals (CoII, NiII, and CuII). Molecular structure of aquabis[2-(2-pyridyl)benzothiazole]copper(II) diperchlorate

The reactions of 2-(2-pyridyl)benzothiazole (1) with MX2·nH2O salts (M = NiII, CoII, or CuII; X = Cl or ClO4; n = 0–2) in EtOH afforded the corresponding complexes. Depending on the nature of the counterion in the starting metal salt, the reactions give compounds of composition M(1)Cl2·nH2O or Cu(1)2(ClO4)2·H2O. The molecular and crystal structure of the CuII(1)2(ClO4)2·H2O complex was established by X-ray diffraction. The copper atom in this complex has a distorted tetragonal-pyramidal ligand environment and is coordinated by four nitrogen atoms of two ligand molecules and one water molecule. Electrochemical study of the ligand and the resulting complexes by cyclic voltammetry and at a rotating disk electrode demonstrated that ligand 1 stabilizes reduced forms of complexes containing Ni, Co, or Cu atoms in the oxidation state +1.

Inert benzothiazole functionalised ruthenium(ii) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+{bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the Lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+{Me(2)bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association with hairpin oligonucleotides, again with the Lambda enantiomer binding more strongly. A (1)H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

Pyrazole and benzothiazole palladacycles: stable and efficient catalysts for carbon–carbon bond formation

Cyclopalladated phosphine free pyrazole complexes 1 and benzothiazole complexes 2 are excellent catalysts for the Heck vinylation of aryl iodides and termolecular queuing cascades, leading to turnover numbers of >106 in some cases, at moderate temperatures; these catalysts show high thermal stability and are not sensitive to moisture and air.

Synthesis, characterization and biological studies of 2-(3,5-dimethylpyrazol-1-yl)benzothiazole complexes of cobalt(II), nickel(II) and copper(II)

Thirteen new complexes, MLX·nH2O and ML2(ClO4)2· nH2O [M = Co, Ni, Cu; X = Cl−, Br−, NO f3 p− , 1/2SO f4 p2− ; n = 1 or 2; and L = 2-(3,5-dimethylpyrazol-1-yl)benzothiazole], have been synthesized, and characterized by elemental analysis, conductivity measurements, magnetic moments, thermal studies and electronic, i.r. and e.p.r. spectral studies. On the basis of available data probable structures have been proposed. In a few cases the antibacterial and antifungal activities increase on complexation of the ligand with metals.

Complexes of Benzothiazole with Some Group IV Metal Halides

Abstract Complexes of benzothiazole (BT) of the composition SnX4 (BT) and MCl4(BT)2 (where X = Cl, Br or I; M = Ti, Zr or Si and BT = C7H5SN) have been prepared and studied by spectroscopic (proton magnetic resonance, electronic absorption and infrared spectra) techniques. The stability and composition of the complexes were established by melting point/decomposition point determinations and elemental analysis, respectively. Molar conductivity measurements show the covalent nature of the complexes. A polymeric structure involving ligand bridging through the sulphur and nitrogen atoms is suggested for the SnX4(BT) complexes. A trans-octahedral structure is suggested for the zirconium, silicon and titanium complexes with the ligands coordinated through the nitrogen atom.

Studies of charge transfer complex equilibria on iodine-thiazoles by constant activity method

The iodine charge transfer complexes of thiazole, 4-methylthiazole, 2,4-dimethylthiazole, and benzothiazole in carbon tetrachloride have been studied by the constant activity method. The equilibrium characteristics of the CT complexes formed were measured. It was concluded that the CT complexes are of the n-σ* nature and the donating site for the charge transfer interaction is the lone pair of electrons on the nitrogen atom. Moreover, the effect of substitution on the CT equilibrium was also studied. The equilibrium constants have been found to be satisfactorily correlated with the pK values of the respective thiazole derivatives. This can be attributed to the lone pair of electrons on nitrogen being more localized on increasing the donating power of substituent. Hence, the electron density on the nitrogen atom increases and an increase in equilibrium constant was seen.

NMR studies of cobalt(II) complexes of benzothiazole and substituted benzothiazoles

Proton magnetic resonance spectra are reported for several cobalt(II) complexes of benzothiazole and methyl substituted benzothiazoles. Large isotropic shifts are observed and assignments have been made by inter comparisons among the substituted and unsubstituted complexes. All of these complexes are labile and partly dissociated in actonitrile solution. Ionic dissociation of halide ions has been examined by conductivity measurements and dissociation of neutral benzothiazole ligands by NMR. Analysis of the latter data gives the limiting isotropic shifts for the undissociated complexes. The origin of these shifts is considered. It is concluded that contact terms due to unpaired electron density is both σ and π orbitals and dipolar interactions arising from the magnetic anisotropy of the complexes all contribute to the observed shifts.

Coordination chemistry of benzothiazole derivatives. 2-mercaptobenzothiazole and 2-(o-hydroxyphenyl)benzothiazole complexes with Cu(II), Ni(II) and Co(II)

Abstract The reaction of 2-mercaptobenzothiazole (MBTH) with Cu(II) ions resulted in a yellow diamagnetic Cu(II) complex, while the reaction with Co(II) produced a dimeric tetrahedral complex. The reaction of Ni(II) with MBTH gave a diamagnetic square planar complex. The yellow copper complex formed a blue five coordinate dimeric complex with pyridine. The isolated blue crystals were investigated by electron spin resonances. The reaction of the diamagnetic nickel complex with different bases yielded distorted octahedral dibase adducts. 2-( o -hydroxyphenyl)benzothiazole gave a brown pseudo tetrahedral complex with Cu(II) and a distorted tetrahedral complex wiht Ni(II). The reaction with Co(II) produced a high spin five coordinate polymeric type compound. The solid spectra of the complexes as well as their base adducts were investigated.

The thermal decomposition of transition-metal complexes containing heterocyclic ligands: 2.Benzoxazole complexes

Enthalpies of the overall decomposition reactions ▪ and of the intermediate reactions involving stepwise loss of ligand, L, where M is Mn, Co, Ni, Cu, or Cd, X is Cl or Br, and L is benzoxazole, 2-methylbenzoxazole, or 2,5-dimethylbenzoxazole have been measured by use of a differential scanning calorimeter. Specific heats of CoCl 2(2-methylbenzoxazole) 2, and CoBr 2(2-methylbenzoxazole) 2 are reported together with enthalpies of sublimation of CoCl 2(2-methylbenzoxazole) 2, CoBr 2(2-methyl-benzoxazole) 2, CoCl 2(2,5-dimethylbenzoxazole) 2 and CoBr 2(2,5-dimethylbenzoxazole) 2. Enthalpies of decomposition of benzoxazole complexes are found to be greater than those of the corresponding pyridine complexes, but less than those of the analogous benzothiazole complexes. However, the mean bond dissociation energies of the cobalt—nitrogen and cobalt—oxygen bonds in these complexes are all in the region 33±2 kcal mol −.

Complexes of benzotriazole, benzoxazole and benzothiazole with palladium(II)

Complexes of benzotriazole, benzoxazole and benzothiazole with palladium(II)

Complexes of thiazoles. Part II. Complexes of 2-amino-, 2-chloro-, and 2-methyl-benzothiazole with cobalt(II), nickel(II), copper(II), and zinc(II) salts

Complexes of some 2-substituted benzothiazoles have been prepared and characterised by magnetic and spectroscopic techniques. Further information on benzothiazole complexes is also reported. Since 2-aminobenzothiazole shows a different pattern of behaviour towards nickel(II) from the other 2-substituted ligands, it is suggested that it may be bonded through the amino nitrogen atom in contrast to the other ligands which are bonded through the ring nitrogen. We have also considered the effect of the 2-substituent in determining the stereochemistry of nickel(II) complexes with 2-substituted nitrogen heterocyclic ligands. The possibility of co-ordinated acetone in the complex [Cu(2-NH2bt)3(acetone)3](ClO4)2 is discussed.

Complexes of thiazoles. Part I. Complexes of benzothiazole with cobalt(II), nickel(II), copper(II), and zinc(II) halides, thiocyanates, and perchlorates

Complexes of benzothiazole (BT) have been prepared and studied by magnetic and spectroscopic techniques. Tetrahedral complexes, M(BT)2X2, which have been well characterised, are formed with ZnX2(X = Cl, Br) and CoX2(X = Cl, Br, I, NCS). Tetrahedral Ni(BT)2I2 has also been formed, but the following nickel complexes have an octahedral or distorted octahedral stereochemistry: Ni(BT)4Br2, Ni(BT)2X2(X = Cl, Br), Ni(BT)Br2. The Ni(BT)2X2 species involve halogen-bridged polymeric structures with benzothiazole molecules above and below the plane, while in Ni(BT)Br2 the planes of nickel atoms and bridging bromine atoms are connected by bridging benzothiazole molecules. It is suggested that bridging benzothazole is also present in [Cu2(BT)6](ClO4)4. Tetragonal polymeric copper(II) complexes, Cu(BT)2X2, with bridging X (Cl, Br) and 1 : 1 complexes, Cu(BT)X2, which it is suggested are dimeric, four-co-ordinate, with bridging X, are also reported. A number of other 1 : 2 species with CuBr2 are reported, together with some octahedral perchlorates and perchlorato-complexes of Ni(II) and Co(II). It appears that benzothiazole co-ordinates through the nitrogen heteroatom in these complexes (except when acting as a bridging ligand, when both heteroatoms are involved).

Electronic spectra and structures of some benzothiazole complexes of iron(II), cobalt(II), and nickel(II)

The preparations and electronic spectra are reported for the compounds ML2X2(L = benzothiazole; M = Fe, X = Cl or Br; M = Co or Ni, X = Cl, Br, or l); ML4X2(M = Fe or Ni, X = Br; M = Co, X = ClO4); and NiL2(NCS)2 and its acetone solvate. The cobalt complexes, FeL2Br2, and NiL2I2 have tetrahedral structures, while the other compounds are essentially octahedral. The benzimidazole analogues of the thiocyanate complexes are also described.