BCR-ABL Positive Leukemia Cells Research Articles

The Efficacy of Histone Deacetylase Inhibitor, Vorinostat against BCR-ABL Positive Leukemia Cells Include ABL Kinase Domain Mutation in Monotherapy and in Combination with Dasatinib

The development of imatinib are represented a major therapeutic advance in BCR-ABL positive diseases. However, a substantial number of patients are either primary refractory or acquire resistance to imatinib associated with ABL kinase domain mutation and this becomes a problematic in clinically. Histone acetylation and deacetylation is important for the accurate regulation of gene expression. Histone deacetylase (HDAC) inhibitors such as vorinostat (suberoylamide hydroxamic acid: SAHA) are the class of anticancer drugs currently in clinical trials for the treatment of hematological malignacies and solid tumors. Especially, vorinostat have shown efficacy in a wide range of cancers such as cutaneous T-cell lymphoma (CTCL). However, the molecular and functional consequences of vorinostat against BCR-ABL expressing cellswith Abl kinase mutation have not fully known. In this study, we investigated the vorinostat efficacy by using the murine Ba/F3 cell line which was transfected wild type (Wt) p210 BCR-ABL or imatinib resistant BCR-ABL mutants such as G250E, Q252H, Y253F, E255K, M294V, T315I, T315A, F317L, F317V, M351T and H396P. 48 hours treatment of vorinostat exhibits cell growth inhibition and proapoptotic activity murine Ba/F3 cells ectopically expressing wild type (Wt) p210 and imatinib resistant BCR-ABL mutants including T315I mutation in a dose dependent manner. IC50 of these cell lines are Wt(720nM), G250E(625nM), Q252H(220nM), Y253F(525nM), E255K(685nM), M294V(785nM), T315I(500nM), T315A(715nM), F317L(560nM), F317V(565nM), M351T(375nM) and H396P(485nM). Vorinostat is more effective in BCR-ABL mutant cells compared with Ba/F3 Wt BCR-ABL cells. We examined the intra cellular signaling by using these cell lines. We found that caspase 3, and poly (ADP-ribose) polymerase (PARP) were activated in a dose and a time dependent manner. Phosphorylation of Crk-L which is downstream target of BCRABL was reduced after vorinostat treatment. We also found the protein level of BCR-ABL was reduced after 48 hours vorinostat treatment in a dose dependent manner. BCR-ABL degradations in mutant cells were significantly enhanced compared with Ba/F3 Wt p210 BCR-ABL cells. Protein degradation of BCR-ABL was blocked by ubiquitin-proteasome inhibitor, Lactacystin suggested that this was involved ubiquitin-proteasome pathway. Dasatinib is a potent dual Src/BCR-ABL kinase inhibitor. Dasatinib is more than 100- fold more potent than imatinib against the ABL kinases and retains this low nanomolar inhibitory activity against the imatinib resistant mutations. Because dasatinib has shown efficacy against imatinib resistant BCR-ABL mutant, we investigated the efficacy between vorinostat and dasatinib by using these cell lines. We found that combination of vorinostat and dasatinib synergistically cell growth inhibition of Wt and BCR-ABL mutatants Ba/F3 cells in 48 hours treatment. Phosphorylation of Crk-L was reduced after vorinostat and dasatinib treatment in these cells. Caspase 3 and PARP activation were also synergistically increased after vorinostat and dasatinib treatment. Data from this study suggested that administration of the clinically available HDAC inhibitor vorinostat may be a powerful strategy against BCR-ABL mutant cells and enhance cytotoxic effects of dasatinib in those imatinib resistant BCR-ABL mutant cells and this approach warrants further examination in BCR-ABL related malignancies.

Methanolic Extract of Cynara Cardunculus L. Inhibits Cell Proliferation and Bcr/Abl Expression in K562 Cell Line

Introduction: Chronic myeloid leukaemia (CML) is a myeloid neoplasm defined by the Bcr/Abl oncoprotein that is considered essential for leukaemogenesis and accumulation of neoplastic cells. Evidence exists showing that extracts of antichoke Cynara cardunculus L. (CCE) are able to inhibit cancer cell growth in vitro (1). In the present study we have investigated the antiproliferative effect of methanolic extract of CEE on K562 Bcr-Abl positive leukemia cell line. In addition we evaluated whether the extract of CEE also affects the mRNA levels of Bcr-Abl and p210 expression in this cell line.Materials and Methods:Preparation of methanolic extract of CEE. The aerial parts of CEE were air dried until dryness at room temperature, cut into small pieces and then extracted with methanol through maceration (48 h for 3 times). The resultant total extracts were dried under reduced pressure and their weight was determined.Cell culture. The K562 cells were grown in RPMI 1640 with L-glutamine supplemented with 10% (v/v) heat-inactivated FBS, 1% penicillin/streptomycin in humidified atmosphere of 5% CO2 at 37°C. In all experiments growing cells at optimal concentration were placed in 24 or 96 well plate and then treated with vehicle or 5–100–200 μg/ml methanolic extract of CEE. 48h after the treatment cultures were tested for proliferative activity, mRNA level of Bcr-Abl by RT-PCR and p210 protein expression by western blotting analysis.Proliferative activity. Proliferative activity was determined using the MTT technique according to the method described by Tubaro et al. (1996). The assay was performed in triplicate and absorbance values at 550 nm were measured using a microplate reader.RT-PCR Analysis. The total cellular mRNA was isolated from treated and control cells using an silica coloumns. Using equal amounts of the RNA from each sample, the cDNA was synthesized by Superscript VILO™ cDNA kit. PCR was performed using Platinum® Taq DNA polymerase and specific primers for t(9;22) p210 transcripts (b3a2): GAAGTGTTTCAGAAGCTTTCC (sense) and GTTTGGGCT-TCACACCATTCC (antisense). 35 amplification cycles were performed at 94°C for 30s, 55°C for 30s and 72°C for 1min. Gel electrophoresis and ethidium bromide staining was used to visualize the PCR products.Western Blot Analysis. Cell pellets from control and treated cultures were lysed using lysis buffer with protease and phosphatase inhibitors. The proteins were then quantified and equal amounts (30 ug) were separated by SDS-PAGE and electro-blotted to nitrocellulose. After blocking procedure the blots were incubated with specific primary antibody against p210 protein and then challenged with specific horseradish peroxidase-conjugated secondary antibody. The reactive protein was visualized using an enhanced chemiluminescence detection system.Results: The results have shown that treatment of K562 cell line with methanolic extract of CEE reduced cell viability in a dose-dependent fashion (IC50=41.7 μg/ml) as demonstrated by MTT assay. PCR and Western blot analysis revealed that the cell growth inhibition was associated to a dramatic decrease of mRNA levels of Bcr-Abl and to a significant reduction of p210 protein expression suggesting that the antiproliferative effect of methanolic extract of CEE likely due to the inhibition at transcriptional level of Bcr-Abl oncoprotein. Further studies are needed to better elucidate this mechanisms and to identify the compound of crude extract which is responsible of cancer growth suppression.

Synthesis, biological evaluation and docking studies of 4-amino substituted 1 H-pyrazolo[3,4- d]pyrimidines

The synthesis of new 4-amino substituted pyrazolo[3,4- d]pyrimidines along with their activity in cell-free enzymatic assays on Src and Abl tyrosine kinases is reported. Some compounds emerged as good dual inhibitors of the two enzymes, showed antiproliferative effects on two Bcr–Abl positive leukemia cell lines K-562 and KU-812, and induced apoptosis, as demonstrated by the PARP assay. Docking studies have been also performed to analyze the binding mode of compounds under study and to identify the structural determinants of their interaction with both Src and Abl.

Small Molecules Targeting Rad51 Recombinase Synergize with Imatinib and Overcome Imatinib-Resistance in CML.

Rad51 recombinase is a key downstream effector of BCR-ABL, essential for DNA repair, cell proliferation and survival. In BCR-ABL positive leukemia cells, Rad51, itself a direct substrate of BCR-ABL, is transcriptionally activated through the BCR/ABL-Stat5 pathway. We have identified a novel compound IBR2, which targets Rad51 and inhibits its functions both in vitro and in vivo. We investigated whether targeted inhibition of Rad51 by IBR2 could overcome imatinib-resistance in CML. IBR2 potently inhibited the proliferation of Ba/F3 cells expressing wild-type BCR-ABL (P210), T315I or E255K mutant with the IC50 values (12–20 μM), but had much lesser effect on the Ba/F3 parental cells. By annexin-V staining and FACS analysis, treatment with 20 μM IBR2 for 48 hours significantly killed Ba/F3 cells expressing P210, E255K or T315I with 33.6, 35.8 and 66.5% of apoptotic cells, respectively. The effects of IBR2 on protein expression and phosphorylation of BCR-ABL and Stat5 and Rad51 were examined by Western blotting after 48 hours of exposure to IBR2 (10–20 μM). In Ba/F3 cells expressing BCR-ABL, dose-dependent decreases of Rad51, BCR-ABL, phosphorylated BCR-ABL, and phosphorylated Stat5 were revealed, while c-Abl, p-c-Abl and total Stat5 protein were unchanged. In contrast, there was little effect on Ba/F3 parental cells. In a murine imatinib-resistant chronic myelogenous leukemia (CML) model bearing T315I mutant BCR-ABL, IBR2 at the dose of 100mg/kg daily for 20 days (i.p.) significantly prolonged animal survival. By colony-forming cell (CFC) assays, IBR2 did not significantly inhibit the growth of cord blood progenitor cells (less than 10% up to 40 μM). However, IBR2 at concentrations of 25, 30 and 40 μM could effectively inhibit the growth of CD34+ progenitor cells from CML patients with demonstrated clinical resistance to imatinib and cross-resistance to Nilotinib by 38.9, 54.8 and 95.5%, respectively. In contrast, these cells were inhibited with 5 μM imatinib by 35.2%; with 5 μM nilotinib by less than 9%; and with 0.5 μM dasatinib by up to 41.3%. Synergistic effects were observed upon co-treatment of IBR2 with imatinib in Ba/F3 cells expressing wild-type BCR-ABL. Treatment with 15 μM IBR2 alone resulted in <10% killing of these Ba/F3 cells expressing wild-type BCR-ABL, whereas treatment with 0.1, 0.2, 0.4 and 0.6 μM imatinib induced 6.8, 7.6, 23.1 and 39.3%, apoptosis respectively. IBR2 in combination with imatinib resulted in substantial increases of apoptosis to 28.4, 62.4, 73.6 and 86.4%, respectively. The effects of co-treatment on Rad51, BCR-ABL, and Stat5 protein expression levels were also examined. Treatment with 0.1–0.6 μM imatinib did not influence the Stat5 protein level, while Rad51, BCR-ABL, p-BCR-ABL and p-Stat5 levels were modestly decreased in a dose-dependent manner. In contrast, co-treatment of IBR2 (15 μM) with imatinib, resulted in a remarkable decrease in Rad51, BCR-ABL, p-BCR-ABL and p-Stat5 levels in a dose-dependent manner, but not Stat5 protein level. The significant inhibitory effects elicited by IBR2 or IBR2-imatinib co-treatment support potential clinical applications, which may be especially beneficial for late stage or imatinib-resistant CML patients. Corresponding author: whlee@uci.edu (WHL) and plchen@uci.edu (PLC).

The Anti-Apoptotic Role of the Unfolded Protein Response in Bcr-Abl Positive Leukemia Cells.

Accumulation of unfolded or misfolded proteins within the endoplasmic reticulum triggers the unfolded protein response (UPR). Evidence from several studies suggests that the UPR is activated in various tumors and might play a crucial role in tumor growth. However, the role of the UPR in leukemia remains unclear. Therefore, to define the role of the UPR in leukemogenesis, we used p210 Bcr-Abl-expressing 32D myeloid cell lines (p210 32D). The mRNA expression of UPR-related genes, namely, a spliced form of X-box DNA-binding protein (XBP1) and glucose regulated protein 78 (GRP78), was increased in p210 32D. Luciferase assay indicated that p210 Bcr-Abl induced high levels of the transcriptional activity of the UPR element. Moreover, levels of the phosphorylated eIF2 alpha protein increased in p210 32D. Inhibition of the UPR using IRE1 and ATF6 dominant-negative mutants diminished the ability of Bcr-Abl to protect the cells from etoposide- and imatinib-induced apoptosis, but had no effect on the proliferation of p210 Bcr-Abl-transformed cells. We also evaluated the expression of UPR-related genes in primary leukemic cells from Ph chromosome-positive cells by real-time RT-PCR; it was found that these cells showed higher expression levels than the control cells. Taken together, these results for the first time suggested that UPR is a downstream target of the Bcr-Abl oncoprotein, and it plays the anti-apoptotic role of Bcr-Abl in Ph chromosome-positive leukemia cells.

Combination of Imatinib and Hypusination Inhibitors Represents a Novel Therapeutic Strategy in Bcr-Abl Positive Leukemias.

In order to identify new cellular Bcr-Abl downstream targets, we have recently detected differential regulation of eukaryotic initiation factor 5A (eIF-5A) in Bcr-Abl positive cells. EIF-5A represents the only known eukaryotic protein activated by post-translational hypusination. Hypusination inhibitors (HI) GC7 and ciclopirox alone exerted an anti-proliferative effect on Bcr-Abl positive (K562, BA/F3p210) and negative human leukemia cell lines (HL-60, BA/F3) in vitro. No direct effect of HI treatment on phosphorylation of Bcr-Abl downstream targets (global p-tyrosination, p-CRKL, p-STAT5) was observed. However, the synergistic dose-effect relationship for apoptosis induction, cytotoxicity and inhibition of proliferation found for the combination of Imatinib and HI was restricted to Bcr-Abl-positive cells. Furthermore, this synergistic effect was confirmed by cytotoxicity assays, cell cycle analysis and CFSE-labeling of primary CD34+ CML cells in comparison to CD34+ cells from healthy donors. In parallel to these findings, eIF-5A mRNA is expressed at clearly (if significant then say significant and add p-value, otherwise delete clearly) elevated levels in PBMCs from CML patients at different disease stages when compared with PBMCs from healthy donors. Specificity of this effect could be demonstrated by co-treatment of K562 cells with Imatinib and a stable lentiviral siRNA against eIF-5A. Based on this observation, we observed a strong antiprolifrative effect of HI as single agents on BA/F3p210 cells, including the Imatinib-resistant mutants T315I, M351T or E255K. Furthermore, a combination of Imatinib and HI had a synergistic effect in inducing cytotoxicity, apoptosis and inhibition of proliferation in leukemic cell lines with moderate resistance to imatinib (M351T). In contrast, in BA/F3p210T315I (T315I) cells, which are resistant to Imatinib as a single agent, the co-treatment of Imatinib and HI did not lead to additive or synergistic effects. In conclusion, we have identified inhibition of eIF-5A hypusination as a promising new approach for single agent or combination therapy in Bcr-Abl

Characterization of Bcr-Abl Positive Leukemic Cells under Long-Term In Vitro Treatment with Telomerase Inhibitor BIBR1532.

In normal somatic cells telomeres shorten with each cell division because of the end-replication problem. The ribonucleoprotein enzyme telomerase is able to prevent replicative telomere shortening and to maintain or elongate telomere length. In 90 % of tumour cells the enzyme telomerase is found to be upregulated. Chronic myeloid leukemia is a disorder characterized by a reciprocal translocation between Chromosome 9 and 22, leading to the so called Philadelphia chromosome harbouring the BCR-ABL translocation. BCR-ABL positive leukemic stem cells are characterized by increased turnover leading to accelerated telomere shortening as opposed to their normal counterparts. It is unclear to date whether accelerated telomere shortening in Bcr-Abl-positive cells is linked to genetic instability eventually leading to the acquisition of secondary clonal events that might propagate acceleration of the disease to blast crisis. Therefore we aimed to characterize Bcr-Abl positive chronic myeloid leukemia cell line K562 with or without inhibition of telomerase activity under long-term culture conditions. K652 cells were expanded for 400 populations doublings (PD) with or without treatment with the small molecule telomerase inhibitor BIBR1532 in vitro. While telomeres in untreated control cells remained relatively constant, telomeres in BIBR1532 treated cells underwent replicative shortening from 10 kb to 3 kb (as measured by flow FISH), reflecting a rate of 22 base pairs (bp) lost per PD. No difference in growth kinetics were observed until that stage. We next characterized treated K562 with short telomeres (K562-S) in contrast to control cells with long telomeres (K562-L) for the expression of telomere and telomerase-binding proteins. No difference in mRNA expression for any of the candidate proteins were observed by RT-PCR. Comparative analysis of global protein expression was performed by 2D gel electrophoresis. Taken together, 23 protein spots were found to be differentially expressed between treated and untreated cells, fifteen of which were already identified by mass spectometry. Additionally, we analysed the cells for the acquisition of additional cytogenetic abnormalities by M-FISH. Interestingly, in this ongoing study, we consistently found acquisition of genetic material on chromosome 7 in treated as compared to untreated cells. To study radiation sensitivity under BIBR1532 treatment, K562 cells were exposed to increasing doses of irradiation. Interestingly, despite of a dose-dependent increase in the fraction of apoptotic cells in the pre-treated as opposed to control cells, no accumulation in the number of double strand breaks or lethal aberrations were detected. Interestingly, telomere shortening after telomerase inhibition translated to increased sensitivity to Imatinib (IC50 0.6 μM vs. IC50 1.2 μM). Taken together, telomerase inhibition represent a attractive new therapeutic strategy in Bcr-Abl positive leukemias. However, careful evaluation of side effects need to be studied on the proteomics and cytogenetic level.

IPI-504, a Novel, Orally Active HSP90 Inhibitor, Prolongs Survival of Mice with BCR-ABL T315I CML and B-ALL.

Development of mutations within the kinase domain is a major drug-resistance mechanism for tyrosine kinase inhibitors (TKIs) in cancer therapy. In CML (chronic myeloid leukemia), a disease driven by the constitutively active BCR-ABL oncoprotein, no available TKIs have been effective in treating patients with the BCR-ABL T315I mutation. Heat shock protein 90 (Hsp90) is a highly conserved, constitutively expressed molecular chaperone that facilitates folding of client proteins like BCR-ABL, and affects the stability of these proteins. Several labs have shown that Hsp90 inhibition in vitro results in the degradation of BCR-ABL T315I and induces potent killing of these cell lines. However, these results have not been demonstrated in animal models for BCR-ABL-induced CML and B-ALL (B-cell acute lymphoblastic leukemia, a disease that does not respond well to TKIs including imatinib and dasatinib). Thus, IPI-504, an orally administered Hsp90 inhibitor, was evaluated in murine models of CML and B-ALL. Treatment of mice with wild type (WT)- or T315I BCR-ABL-induced CML with IPI-504 resulted in BCR-ABL protein degradation and a decrease in circulating BCR-ABL positive cells. In response to treatment with vehicle the median survival time of WT and T315I CML mice is approximately 20 days. While the T315I CML mice were resistant to imatinib with a median survival of 21 days, IPI-504 (50 and 100 mg/kg, PO TIW) demonstrated dose-dependent prolonged survival of these mice by 30 and 70 days, respectively (p<0.001 for both doses). Both imatinib and IPI-504 similarly prolonged survival of mice with BCR-ABL-WT-induced CML. In the T315I CML mice prolonged survival of the IPI-504 treated cohort was associated with decreased peripheral blood BCR-ABL positive leukemia cells during treatment, less splenomegaly and improved pulmonary histopathlogy at necropsy. In CML mice receiving mixed BCR-ABL-WT- or T315I-transduced donor bone marrow cells, Hsp90 inhibition more potently suppressed T315I-expressing leukemia clones relative to the WT clones, consistent with in vitro studies where T315I BCR-ABL was more sensitive to IPI-504 induced degradation in cell lines than WT BCR-ABL. Combination treatment with IPI-504 and imatinib was more effective than either treatment alone in prolonging survival of mice bearing both WT and T315I leukemic cells. IPI-504 also significantly prolonged survival of B-ALL mice bearing the T315I mutation (p<0.001).These results provide a rationale for use of an Hsp90 inhibitor as a novel approach to overcoming resistance to TKIs as well as the potential for first line combination treatment in CML patients. The potential for IPI-504 to eliminate mutant kinases via Hsp90 inhibition provides a new therapeutic strategy for treating BCR-ABL-induced CML, ALL as well as other cancers resistant to treatment with TKIs.