Base Triads Research Articles

Probing hydrogen bonding in a DNA triple helix using protium-deuterium fractionation factors.

In this communication we report protium-deuterium fractionation factors for the intramolecular triple helix formed by the DNA oligonucleotide 5'-d(AGAGAGAACCCCTTCTCTCTTTTTCTCTCTT)-3'. The fractionation factors of individual Watson-Crick and Hoogsteen hydrogen bonds in the structure are measured by NMR spectroscopy. The results show that, in contrast to proteins, the fractionation factors are all equal or lower than unity. On the average, the values of the fractionation factors are centered between 0.6 and 0.8, and no significant differences are observed between Hoogsteen and Watson-Crick hydrogen bonds. Deviations from the average are observed for the 5'-end region of the molecule where a base triad is absent and the structure is strained by the intramolecular folding of the DNA strand.

Proton exchange and local stability in a DNA triple helix containing a G.TA triad.

Recognition of a thymine-adenine base pair in DNA by triplex-forming oligonucleotides can be achieved by a guanine through the formation of a G.TA triad within the parallel triple helix motif. In the present work, we provide the first characterization of the stability of individual base pairs and base triads in a DNA triple helix containing a G.TA triad. The DNA investigated is the intramolecular triple helix formed by the 32mer d(AGATAGAACCCCTTCTATCTTATATCTGTCTT). The exchange rates of imino protons in this triple helix have been measured by nuclear magnetic resonance spectroscopy using magnetization transfer from water and real-time exchange. The exchange rates are compared with those in a homologous DNA triple helix in which the G.TA triad is replaced by a canonical C(+).GC triad. The results indicate that, in the G.TA triad, the stability of the Watson-Crick TA base pair is comparable with that of AT base pairs in canonical T.AT triads. However, the presence of the G.TA triad destabilizes neighboring triads by 0.6-1.8 kcal/mol at 1 degrees C. These effects extend to triads that are two positions removed from the site of the G.TA triad. Therefore, the lower stability of DNA triple helices containing G.TA triads originates, in large part, from the energetic effects of the G.TA triad upon the stability of canonical triads located in its vicinity.

A double chain reversal loop and two diagonal loops define the architecture of unimolecular DNA quadruplex containing a pair of stacked G(syn)·G(syn)·G(anti)·G(anti) tetrads flanked by a G·(T-T) triad and a T·T·T triple

The architecture of G·G·G·G tetrad-aligned DNA quadruplexes in monovalent cation solution is dependent on the directionality of the four strands, which in turn are defined by loop connectivities and the guanine syn/anti distribution along individual strands and within individual G·G·G·G tetrads. The smallest unimolecular G-quadruplex belongs to the d(G2NnG2NnG2NnG2) family, which has the potential to form two stacked G-tetrads linked by Nn loop connectivities. Previous studies have focused on the thrombin-binding DNA aptamer d(G2T2G2TGTG2T2G2), where Nn was T2 for the first and third connecting loops and TGT for the middle connecting loop. This DNA aptamer in K+ cation solution forms a unimolecular G-quadruplex stabilized by two stacked G(syn)·G(anti)·G(syn)·G(anti) tetrads, adjacent strands which are antiparallel to each other and edge-wise connecting T2, TGT and T2 loops. We now report on the NMR-based solution structure of the d(G2T4G2CAG2GT4G2T) sequence, which differs from the thrombin-binding DNA aptamer sequence in having longer first (T4) and third (GT4) loops and a shorter (CA) middle loop. This d(G2T4G2CAG2GT4G2T) sequence in Na+ cation solution forms a unimolecular G-quadruplex stabilized by two stacked G(syn)·G(syn)·G(anti)·G(anti) tetrads, adjacent strands which have one parallel and one antiparallel neighbors and distinct non-edge-wise loop connectivities. Specifically, the longer first (T4) and third (GT4) loops are of the diagonal type while the shorter middle loop is of the double chain reversal type. In addition, the pair of stacked G·G·G·G tetrads are flanked on one side by a G·(T-T) triad and on the other side by a T·T·T triple. The distinct differences in strand directionalities, loop connectivities and syn/anti distribution within G·G·G·G tetrads between the thrombin-binding DNA aptamer d(G2T2G2TGTG2T2G2) quadruplex reported previously, and the d(G2T4G2CAG2GT4G2T) quadruplex reported here, reinforces the polymorphic nature of higher-order DNA architectures. Further, these two small unimolecular G-quadruplexes, which are distinct from each other and from parallel-stranded G-quadruplexes, provide novel targets for ligand recognition. Our results demonstrate that the double chain reversal loop connectivity identified previously by our laboratory within the Tetrahymena telomere d(T2G4)4 quadruplex, is a robust folding topology, since it has now also been observed within the d(G2T4G2CAG2GT4G2T) quadruplex. The identification of a G·(T-T) triad and a T·T·T triple, expands on the available recognition alignments for base triads and triples.

Evidence for a DNA triplex in a recombination-like motif: I. Recognition of Watson-Crick base pairs by natural bases in a high-stability triplex.

Data are presented on a triplex type with two parallel homologous strands for which triplex formation is almost as strong as duplex formation at least for some sequences and even at pH 7 and 0.2 M NaCl. The evidence mainly rests upon comparing thermodynamic properties of similar systems. A paperclip oligonucleotide d(A12C4T12C4A12) with two linkers C4 obviously can form a triplex with parallel back-folded adenine strand regions, because the single melting transition of this complex splits in two transitions by introducing mismatches only in the third strand region. Respectively, a hairpin duplex d(A12C4T12) and a single strand d(A12) form a triplex as a 1:1 complex in which the second adenine strand is parallel oriented to the homologous one in the Watson-Crick paired duplex. In this system the melting temperature T(m) of the triplex is practically the same as that of the duplex d(A12)-d(T12), at least within a complex concentration range of 0.2-4.0 microM. The melting behaviour of complexes between triplex stabilizing ligand BePI and the system hairpin duplex plus single strand supports the triplex model. Non-denaturing gel electrophoresis suggests the existence of a triplex for a system in which five of the twelve A-T*A base triads are substituted by C-G*C base triads. The recognition between any substituted Watson-Crick base pair (X-Y) in the hairpin duplex d(A4XA7C4T7YT4) and the correspondingly replaced base (Z) in the third strand d(A4ZA7) is mutually selective. All triplexes with matching base substitutions (Z = X) have nearly the same stability (T(m) values from 29 to 33.5 degrees C), whereas triplexes with non-matching substitutions (Z not equal X) show a clearly reduced stability (T(m) values from 15 to 22 degrees C) at 2microM equimolar oligonucleotide concentration. Most nucleic acid triple helices hitherto known are limited to homopurine-homopyrimidine sequences in the target duplex. A stable triplex formation is demonstrated for inhomogeneous sequences tolerating at least 50% pyrimidine content in the homologous strands. On the basis of the surprisingly similar thermodynamic parameters for duplex and triplex, and of the fact that this triplex type seems to be more stable than many other natural DNA triplexes known, and on the basis of semiempirical and molecule mechanical calculations, we postulate bridging interactions of the third strand with the two other strands in the triplex according to the recombination motif. This triplex, denoted by us 'recombination-like form', tolerates heterogeneous base sequences.

Recognition of 5-aminouracil (U(#)) in the central strand of a DNA triplex: orientation selective binding of different third strand bases.

A necessary feature of the natural base triads for triplex formation is the requirement of a purine (A or G) in the central position, since only these provide sets of two hydrogen bond donors/acceptors in the major groove of the double helix. Pyrimidine bases devoid of this feature have incompatible complementarity and lead to triplexes with lower stability. This paper demonstrates that 5-aminouracil (U#) (I), a pyrimidine nucleobase analogue of T in which 5-methyl is replaced by 5-amino group, with hydrogen bonding sites on both sides, is compatible in the central position of triplex triad X*U# x A, where X = A/G/C/T/2-aminopurine (AP), and * and x represent Hoogsteen and Watson-Crick hydrogen bonding patterns respectively. A novel recognition selectivity based on the orientation (parallel/antiparallel) of the third strand purines A, G or AP with A in the parallel motif (A(p)*U# x A), and G/AP in the antiparallel motif (G(ap)/AP(ap)*U# x A) is observed. Similarly for pyrimidines in the third strand, C is accepted only in a parallel mode (C(p)*U(#) x A). Significantly, T is recognised in both parallel and antiparallel modes (T(p)/T(ap)*U(#) x A), with the antiparallel mode being stable compared to the parallel one. The 'U(#)' triplexes are also more stable than the corresponding control 'T' triplexes. The results expand the lexicon of triplex triads with a recognition motif consisting of pyrimidine in the central strand.

Quadruplex structures in nucleic acids.

DNA oligonucleotides that have repetitive tracts of guanine bases can form G-quadruplex structures that display an amazing polymorphism. Structures of several new G-quadruplexes have been solved recently that greatly expand the known structural motifs observed in nucleic acid quadruplexes. Base triads, base hexads, and quartets that contain cytosine have recently been identified stacked over the familiar G-quartets. The current status of the diverse array of structural features in quadruplexes is described and used to provide insight into the polymorphism and folding pathways. This review also summarizes recent progress in the techniques used to probe the structures of G-quadruplexes and discusses the role of ion binding in quadruplex formation. Several of the quadruplex structures featured in this review can be accessed in the online version of this review as CHIME representations.

A diamond-shaped zipper-like DNA architecture containing triads sandwiched between mismatches and tetrads

The present study reports on the solution structure of the guanine plus adenine rich d(A2G2T4A2G2) 12-mer sequence which forms a unique fold in moderate NaCl solution. Proton resonance assignments for this sequence, which contains a pair of AAGG repeats separated by a T4 linker segment, were aided by site-specific 15N-labeling of guanine and adenine bases, as well as site-specific incorporation of 2,6-diaminopurine and 8-bromoadenine for adenine, 8-bromoguanine, 7-deazaguanine and inosine for guanine, and uracil and 5-bromouracil for thymine. The solution structure, which was solved by a combined NMR and intensity-refined computational approach, consists of a diamond-shaped architecture formed through dimerization of a pair of d(A2G2T4A2G2) hairpins. This 2-fold symmetric structure contains a quadruplex core consisting of a pair of symmetry-related G(syn)·G(syn)·G(anti)·G(anti) tetrads, where adjacent strands have both parallel and anti-parallel neighbors and connecting T4 segments which form diagonal loops. Each of the G(syn)·G(syn)·G(anti)·G(anti) tetrads forms a platform on which stacks a T(anti)·[A(syn)-A(anti)] triad containing a novel A(syn)-A(anti) platform step and a reversed Hoogsteen A(syn)·T(anti) pair. We observe both base-base and base-sugar stacking interactions, with the latter occuring at a sheared A-G step where the sugar of the A stacks on the purine plane of the G. Unexpectedly, the topology of this sheared A(anti)-G(syn) step has many similarities with the C(anti)-G(syn) step in left-handed Z-DNA. The T·(A-A) triad is sandwiched between the G-tetrad on one side and a reversed Hoogsteen A(anti)·T(anti) pair on the other. This intercalative topology is facilitated by a zipper-like motif where the A(anti) residue of the triad is interdigitated within a stretched A(anti)-G(syn) step. Our structural study reports on new aspects of A-A platforms, base triads, zipper-like interdigitation and sheared base steps, together with base-base and base-sugar stacking defining a diamond-like architecture for the d(A2G2T4A2G2) sequence. One can anticipate that mixed guanine-adenine sequences will exhibit a rich diversity of polymorphic architectures that will provide unique topologies for recognition by both nucleic acids and proteins.

The Synthesis of N4‐(6‐Aminopyridin‐2‐yl)‐2′‐deoxycytidine for Recognizing the CG Base Pair at Neutral pH by Oligodeoxyribonucleotide‐Directed Triple Helix Formation

AbstractThe sequence‐specific recognition of double‐helical DNA by oligodeoxyribonucleotide‐directed triple helix (triplex) formation is limited mostly to purine tracts. To interrupt the purine tract in a target sequence, a non‐natural deoxyribonucleoside N4‐(6‐aminopyridin‐2‐yl)‐2′‐deoxycytidine (pC) was designed to interact with the C base in the CG base pair. The protected phosphoramidite synthon of pC was synthesized in seven steps and then was incorporated into an oligodeoxyribonucleotide by an automatic DNA synthesizer. Two 22‐mers, designated as C2 and P, with a common sequence of 5′‐d‐TmCTXTmCTTCTGTCTCCAGACAG were synthesized in this study. mC is 5‐methyl‐2′‐deoxycytidine and X is either 2′‐deoxycytidine (C) or pC for C2 and P, respectively. C2 is able to form a paper clip type triplex with one C · CG mismatched base triad in slightly acidic conditions but not at the neutral pH. On the other hand, P forms a stable triplex under both acidic and neutral conditions. This indicates that pC is able to form a pC · CG base triad in the triplex. Their physical properties were studied by UV thermal melting experiments and circular dichorism spectroscopy (CD). The thermal melting results imply that the pC · CG base triad is as stable as the C+ · GC triad at pH 6.0, and pC helps the triplex formation preferably at neutral to acidic pH. In addition to the hydrogen bonding interaction with the CG base pair, the hydrophobic interaction of pC may also play an important role in stabilizing the triplex formation of oligodeoxyribonucleotides. In the presence of spermine at either pH 5.0 or pH 6.0, the melting temperature of the third strand of P was elevated about 30 and 21 °C, respectively. Thus, spermine can enhance the stability of the triple‐helical structure.

The Formation of Triple Stranded Helix of Oligodeoxyribonucleotides Containing 8‐Oxo‐2′‐deoxyadenosine

AbstractTriple stranded DNA helix (triplex) formation is limited by pH and the sequence of oligodeoxyribonucleotide. In this study, the 8‐oxo‐2′‐deoxyadenosine (8‐oxoA) can replace 2′‐deoxycytidine for forming a base triad with a base pair guanine and cytosine. The target for the triplex formation is a motif of a promotor (5′‐d‐TTGGGGGGGAA, −3 – −12 of PKCα m‐RNA) of mouse protein kinase Cα. The probes contain 20 bases with a common sequence 5′‐d‐XXXXXXTTCCCCCCAA. The XXXXXX portion may contain either 5‐methyl‐2′‐deoxycytidines, six 8‐oxoA's or both. Only the probe with a motif of six 8‐oxoA's can for triplex with the target in the presence of magnesium ion and spermine at neutral pH. Therefore, 8‐oxoA is useful for triplex formation under physiological conditions.

Nanosecond Molecular Dynamics Simulations of Parallel and Antiparallel Guanine Quadruplex DNA Molecules

Molecular dynamics (MD) simulations are presented of four-stranded G-DNA molecules formed by the sequences d(G4) and d(G4T4G4). Starting coordinates are based on high-resolution X-ray structures or NMR data. Simulations of the all-parallel d(G4) quadruplex with sodium cations in the central ion channel yield exceptionally stable trajectories on the nanosecond scale. Simulations without cations in the channel show destabilization of the G-DNA structure, underscoring the central role of these ions for the structural integrity of the molecule. Further simulations reveal that the cation-stabilized d(G)4 stem can adopt an alternative very stable conformation involving a guanine base triad. Simulations of d(G4T4G4) quadruplexes indicate a similar rigidity and stability of the antiparallel guanine stem as for the parallel d(G4) conformer. The simulations further demonstrate significant geometrical plasticity of the thymine residues arranged in four-nucleotide loops, including loop geometries capable of coordinat...

Triple helix formation: binding avidity of acridine-conjugated AG motif third strands containing natural, modified and surrogate bases opposed to pyrimidine interruptions in a polypurine target.

A critical issue for the general application of triple-helix-forming oligonucleotides (TFOs) as modulators of gene expression is the dramatically reduced binding of short TFOs to targets that contain one or two pyrimidines within an otherwise homopurine sequence. Such targets are often found in gene regulatory regions, which represent desirable sites for triple helix formation. Using intercalator-conjugated AG motif TFOs, we compared the efficacy and base selectivity of 13 different bases or base surrogates in opposition to pyrimidines and purines substituted into selected positions within a paradigm 15-base polypurine target sequence. We found that substitutions closer to the intercalator end of the TFO (positions 4-6) had a more deleterious effect on the dissociation constant (K d) than those farther away (position 11). Opposite T residues at position 11, 3-nitropyrrole or cytosine in the TFO provided adequate binding avidity for useful triplex formation (K ds of 55 and 110 nM, respectively). However, 3-nitropyrrole was more base selective than cytosine, binding to T >/=4 times better than to A, G or C. None of the TFOs tested showed avid binding when C residues were in position 11, although the 3-nitropyrrole-containing TFO bound with a K d of 200 nM, significantly better than the other designs. Molecular modeling showed that the 3-nitropyrrole.T:A triad is isomorphous with the A.A:T triad, and suggests novel parameters for evaluating new base triad designs.

Molecular Mechanics Calculations on a Triple Stranded DNA Involving C+.G-T and T.A+-C Mismatched Base Triples

We have carried out molecular modeling of a triple stranded pyrimidine(Y). purine (R): pyrimidine(Y) (where ‘:’ refers to Watson-Crick and ‘.’ to Hoogsteen bonding) DNA, formed by a homo- purine (d-TGAGGAAAGAAGGT) and homo-pyrimidine (d-CTCCTTTCTTCC). Molecular mechanics calculations using NMR constraints have provided a detailed three dimensional structure of the triplex. The entire stretches of purine and the pyrimidine nucleotides have a conformation close to B-DNA. The three strands are held by the canonical C+.G:C and T.A:T hydrogen bonds. The structure also contains two mismatch C+.G-T and T.A+-C base triples which have been characterized for the first time. In the A+-C base-pair of the T.A+-C triple, both hydrogen donors are situated on the purine (A+(1N) and A+(6N)). We observe a unique hydrogen bonding interaction scheme in case of C+.G-T where one acceptor, G(60), is bonded to three donors (C+(3NH), C+(4NH2) and T(3NH)). Though the C+.G-T base triple is less stable than C+.G:C, it is significantly more stable than T.A:T. On the other hand, T. A+-C is as stable as the T.A:T base triad.

A novel palindromic triple-stranded structure formed by homopyrimidine dodecamer d-CTTCTCCTCTTC and homopurine hexamer d-GAAGAG.

We have carried out NMR and molecular mechanics studies on a complex formed when a palindromic homopyrimidine dodecamer (d-CTTCTCCTCTTC) and a homopurine hexamer (d-GAAGAG) are mixed in 1:1 molar ratio in aqueous solutions. Such studies unequivocally establish that two strands of each oligomer combine to form a triple-stranded DNA structure with a palindromic symmetry and with six T.A:T and six C+. G:C hydrogen-bonded base triads. The two purine strands are placed head to head, with their 3' ends facing each other in the center of the structure. One-half of each pyrimidine strand contains protonated and the other half contains non-protonated cytosines. The two half segments containing protonated cytosines are hydrogen bonded to each of the two purine hexamers through Hoogsteen T.A and C+.G base pairing. The segments containing non-protonated cytosines are involved in Watson-Crick (A:T and G:C) base pairing. This leads to a palindromic triplex with a C2-dyad symmetry with respect to the center of the structure. The complex is less stable at neutral pH, but the cytosines involved in Hoogsteen base pairing remain protonated even under these conditions. Molecular mechanics calculations using NMR constraints have provided a detailed three-dimensional structure of the complex. The entire stretches of purine, and the pyrimidine nucleotides have a conformation close to B-DNA.

A Novel Unusual DNA Structure Formed in an Inverted Repeat Sequence

A potential to form a non-cruciform unusual DNA structure was shown at the inverted repeat DNA sequence of a fish satellite DNA. The recombinant plasmid harboring a member of the EcoRI satellite family ofSillago japonica(Percoidei, Sillaginidae) was subjected to S1 nuclease treatment, and the cutting sites were mapped by primer extension assay. The S1 nuclease attacked the 3′-half of the inverted repeat but not the middle part of symmetry under various salt conditions, suggesting that this unusual DNA structure is different from the DNA cruciform and a conventional intramolecular triplex structure. In the presence of 200 mM potassium chloride, the typical DNA cruciform has extruded, suggesting that certain purine-purine-pyrimidine base triads are involved in the formation of this unusual DNA structure. These results support the occurrence of a novel unusual DNA structure formed in the inverted repeat sequence.

Bimolecular DNA triplexes: duplex extensions show implications for H-form DNA stability.

H-form DNA has recently been shown to be biologically relevant by its involvement in the process of homologous recombination [Kohwi, Y. , and Panchenko, Y. (1993) Genes Dev. 7, 1766-1778]. A bimolecular DNA triple-stranded structure (triplex) is central to the formation of H-form DNA. Understanding the formation and factors governing the stability of such bimolecular triplexes is necessary to fully elucidate the structure/function relationship of H-form DNA. In this study, we extend known information on bimolecular triplexes by examining the effect of a variable CNC base triad (where N = A, C, T, or G) on a 10 base triad triplex that mimics the triplex motif in H-form DNA. We also examine the effect that a duplex extension of four base pairs has on triplex stability and selectivity for the base N. Results from thermal denaturation experiments indicate that the fully complementary triplex is more stable than its duplex counterpart (DeltaTm = 13 degrees C) and is resistant to degradation by bovine spleen phosphodiesterase for at least 24 h at 10 degrees C. A single-base mismatch in the purine strand of the triplex structure is destabilizing (DeltaTm = approximately 20 degrees C), and all structures containing a mismatch were readily degraded by bovine spleen phosphodiesterase. An extension of four duplex base pairs onto the triplex structure affects the stability of the DNA complex and may have implications relevant to H-form DNA.

Bombyx mori single repeat telomeric DNA sequence forms a G-quadruplex capped by base triads.

A combined NMR-molecular dynamics approach has been applied to determine the solution structure of a truncated analogue of the Bombyx mori telomeric d(TTAGG) single repeat sequence in Na+ cation-containing aqueous solution. The two-fold symmetric four-stranded d(TAGG) quadruplex contains two adjacent G(syn).G(syn).G(anti).G(anti) G-tetrads sandwiched between novel (T.A).A triads with individual strands having both a parallel and antiparallel neighbour around the quadruplex. The (T.A).A triad represents the first experimental verification of a base triad alignment which constitutes a key postulate in the recently proposed model of triad-DNA. Further, the (T.A).A triad is generated by positioning an A residue through hydrogen bonding in the minor groove of a Watson-Crick T.A base pair and includes a T-A platform related to an A-A platform recently observed in the structure of the P4-P6 domain of the Tetrahymena self splicing group I ribozyme. The novel architecture of the truncated Bombyx mori quadruplex structure sets the stage for the design and potential identification of additional base tetrads and triads that could participate in pairing alignments of multi-stranded DNA structures during chromosome association and genetic recombination.

Non-Watson-Crick base associations in DNA and RNA revealed by single crystal x-ray diffraction methods: Mismatches, modified bases, and nonduplex DNA

Single crystal x-ray diffraction methods have been used to characterize numerous oligonucleotide structures, providing valuable information on the fine structure of DNA, oligonucleotide hydration, interactions with small molecule ligands and proteins. There has been a particular focus on nonstandard base associations and a number of groups have sought to characterize different non-Watson-Crick base pairs to further the understanding of their influence on the structure of duplex DNA and RNA, and to investigate which structural features might be utilized by enzymes in recognition and repair of these errors in DNA. Bases that have been chemically damaged by mutagenic or carcinogenic agents have distinctive modified hydrogen-bonding patterns and these have been investigated. The structure determination of a series of nonduplex DNA structures including examples of a triplex, quadruplexes, and a novel DNA loop have recently been published. In this article we survey the structures of a series of non-Watson-Crick base associations in duplex DNA and RNA. We show how nonstandard base pairs, base triads, and tetrads play an important role in stabilizing nonduplex structures. © 1997 John Wiley & Sons, Inc. Biopoly 44: 91–103, 1997

Determination of the conformations of intramolecular DNA triple helices by FT-IR spectroscopy: effect of loop length

Oligonucleotides with a basic sequence of 5′-d-(TC) 3T m (CT) 3C n (AG) 3-3′ have been designed and chemically synthesized. The pH-stability curves and fluorescence spectra reveal that these oligomers undergo a similar self-folding process on a reduction in pH, and form intramolecular DNA triple-helical structures containing loops of different lengths at acidic pH. FT-IR spectra recorded in D 2O solution also provide independent evidence of base triad formation, and indicate that the loop length does not significantly influence the conformation of the Py-motif intramolecular DNA triplexes in acidic solution, wherein all four triplexes predominantly take on S-type sugar conformations, but with a different relative proportion of S-type sugar pucker to N-type depending on the loop length.

Determination of the conformations of intramolecular DNA triple helices by FT-IR spectroscopy: effect of loop length

Oligonucleotides with a basic sequence of 5′-d-(TC) 3T m (CT) 3C n (AG) 3-3′ have been designed and chemically synthesized. The pH-stability curves and fluorescence spectra reveal that these oligomers undergo a similar self-folding process on a reduction in pH, and form intramolecular DNA triple-helical structures containing loops of different lengths at acidic pH. FT-IR spectra recorded in D 2O solution also provide independent evidence of base triad formation, and indicate that the loop length does not significantly influence the conformation of the Py-motif intramolecular DNA triplexes in acidic solution, wherein all four triplexes predominantly take on S-type sugar conformations, but with a different relative proportion of S-type sugar pucker to N-type depending on the loop length.

A Study of Triplex Formation of 5′-d-T-(C-T-)2C-(T-)4C-(T-C-)2T with 5′-d-A-(G-A-)2G A Hairpin Triplex with Three T · A · T and Three C+· G · C Bases Triads

The UV mixing titration, gel electrophoresis, and CD measurements indicate that oligomers with a basic sequence of 5'-d-T-(C-T-)2C-(T-)4C-(T-C-)2T form a hairpin type triplex with the target 5'-d-A-(G-A-)2G. The stability, measured UV melting temperatures, were studied in aqueous solution as functions of mC (5-methylcytidine) replacement of C, pH (4 to 7), and salt concentrations (up to 1 M). The order of stability is 5'-d-A-(G-A-)2G + 5'-d-T-(C-T-)2C-(T-)4C-(T-C-)2T < 5'-d-A-(G-A-)2G + 5'-d-T-(mC-T-)2mC-(T-)4C-(T-C-)2T approximately 5'-d-A-(G-A-)2G + 5'-d-T-(C-T-)2C-(T-)4 mC-(T-mC-)2T < 5'-d-A-(G-A-)2G + 5'-d-T-(mC-T-)2mC-(T-)4mC-(T-mC-)2T at pH 4. These results indicate that (a) a stable triplex is formed with three T.A.T and three C+.G.C base triads and (b) mC is more effective than C to stablize the triplex formation in acidic condition. Thus, this provides a simple system for further studies of triplex.