Barley Yellow Striate Mosaic Virus Research Articles

A cytorhabdovirus phosphoprotein forms mobile inclusions trafficked on the actin/ER network for viral RNA synthesis.

As obligate parasites, plant viruses usually hijack host cytoskeletons for replication and movement. Rhabdoviruses are enveloped, negative-stranded RNA viruses that infect vertebrates, invertebrates, and plants, but the mechanisms of intracellular trafficking of plant rhabdovirus proteins are largely unknown. Here, we used Barley yellow striate mosaic virus (BYSMV), a plant cytorhabdovirus, as a model to investigate the effects of the actin cytoskeleton on viral intracellular movement and viral RNA synthesis in a mini-replicon (MR) system. The BYSMV P protein forms mobile inclusion bodies that are trafficked along the actin/endoplasmic reticulum network, and recruit the N and L proteins into viroplasm-like structures. Deletion analysis showed that the N terminal region (aa 43–55) and the remaining region (aa 56–295) of BYSMV P are essential for the mobility and formation of inclusions, respectively. Overexpression of myosin XI-K tails completely abolishes the trafficking activity of P bodies, and is accompanied by a significant reduction of viral MR RNA synthesis. These results suggest that BYSMV P contributes to the formation and trafficking of viroplasm-like structures along the ER/actin network driven by myosin XI-K. Thus, rhabdovirus P appears to be a dynamic hub protein for efficient recruitment of viral proteins, thereby promoting viral RNA synthesis.

Complete genome sequence of maize sterile stunt virus.

Based on serology, cytopathology, cereal host range and leafhopper vector, maize sterile stunt virus (MSSV) has been regarded as a strain of the cytorhabdovirus barley yellow striate mosaic virus (BYSMV). Here, we report the first-ever sequence of MSSV, comprising the complete genome of 12,561 nucleotides. Detailed analysis of genome organization, coding and non-coding sequences, and phylogeny confirms the close relationship to BYSMV and supports classification of this virus a strain of BYSMV.

Transmission Characteristics of Barley Yellow Striate Mosaic Virus in Its Planthopper Vector Laodelphax striatellus.

The most economically important plant viruses are specifically transmitted by phytophagous insects that significantly affect viral epidemiology. Barley yellow striate mosaic virus (BYSMV), a member of the genus Cytorhabdovirus, is transmitted by the small brown planthopper (SBPH, Laodelphax striatellus) in a persistent-propagative manner. However, the infection route of BYSMV in SBPHs is poorly understood. In this study, immunofluorescence confocal laser scanning microscopy (iCLSM) was performed to investigate the route of BYSMV in SBPHs. We unexpectedly found that BYSMV initially infected the hindgut epithelium of SBPHs, instead of the midgut epithelium initially infected by other persistent-propagative viruses. Subsequently, BYSMV disseminated to the hindgut visceral muscles and spread to other parts of alimentary canals, hemolymph, and salivary glands. Comparative analysis of gene expression on viral mRNAs and the BYSMV nucleoprotein by using different molecular detection and immunohistochemistry further demonstrated that BYSMV initially infected and replicated in the hindgut epithelial cells of SBPHs. Collectively, our study provides the first insight into that hindgut is initial infection site of BYSMV that represents a new dissemination route of persistent-propagative viruses.

Complete genome sequence of maize yellow striate virus, a new cytorhabdovirus infecting maize and wheat crops in Argentina.

A rhabdovirus infecting maize and wheat crops in Argentina was molecularly characterized. Through next-generation sequencing (NGS) of symptomatic leaf samples, the complete genome was obtained of two isolates of maize yellow striate virus (MYSV), a putative new rhabdovirus, differing by only 0.4% at the nucleotide level. The MYSV genome consists of 12,654 nucleotides for maize and wheat virus isolates, and shares 71% nucleotide sequence identity with the complete genome of barley yellow striate mosaic virus (BYSMV, NC028244). Ten open reading frames (ORFs) were predicted in the MYSV genome from the antigenomic strand and were compared with their BYSMV counterparts. The highest amino acid sequence identity of the MYSV and BYSMV proteins was 80% between the L proteins, and the lowest was 37% between the proteins 4. Phylogenetic analysis suggested that the MYSV isolates are new members of the genus Cytorhabdovirus, family Rhabdoviridae. Yellow striate, affecting maize and wheat crops in Argentina, is an emergent disease that presents a potential economic risk for these widely distributed crops.

Simultaneous detection of wheat dwarf virus, northern cereal mosaic virus, barley yellow striate mosaic virus and rice black-streaked dwarf virus in wheat by multiplex RT-PCR

Wheat dwarf virus (WDV), barley yellow striate mosaic virus (BYSMV), rice black-streaked dwarf virus (RBSDV) and northern cereal mosaic virus (NCMV) are four viruses infecting wheat and causing similar symptoms. In this paper, a multiplex reverse transcription polymerase chain reaction (m-RT-PCR) method has been developed for the simultaneous detection and discrimination of these viruses. The protocol uses specific primer set for each virus and produces four distinct fragments (273, 565, 783 and 1296bp), detecting the presence of RBSDV, BYSMV, WDV and NCMV, respectively. Annealing temperature, concentrations of dNTP, Taq polymerase and Mg2+ were optimized for the m-RT-PCR. The detection limit of the assay was up to 10−2 dilution. The amplification specificity of these primers was tested against a range of field samples from different regions of China, where RBSDV, BYSMV, WDV have been detected. This study fulfills the need for a rapid and specific wheat virus detection that also has the potential for investigating the epidemiology of these new viral diseases.

Wolbachia Occurrence in Planthopper (Hemiptera: Delphacidae) Vectors of Cereal Viruses in Argentina.

Maize (Zea mays L.) and wheat (Triticum aestivum L.) are the most important cereal crops for the Argentinean economy and are affected by several diseases. Different planthopper species transmit causal agents of some of those diseases, including Mal de Río Cuarto virus, barley yellow striate mosaic virus, and the recently proposed maize yellow striate virus. Many planthopper species are sap feeders and therefore are expected to host bacteria providing essential nutrients lacking in the diet. Previous studies have evidenced that some of these bacterial symbionts are involved in the virus transmission. Wolbachia is a group of obligate intracellular bacteria infecting numerous arthropod species and causing reproductive alterations in their hosts. These bacteria have been detected in planthopper species, considered rice pests in various regions of the world. To date, Wolbachia infection status of planthopper species of Argentina is unknown. Amplification by PCR and sequencing of 16S rDNA, wsp- and ftsZ-specific genes demonstrated Wolbachia infection in Caenodelphax teapae (Fowler), Delphacodes kuscheli Fennah, Pyrophagus tigrinus Remes Lenicov & Varela, Tagosodes orizicolus (Muir), and Toya propinqua (Fieber). This is the first report of Wolbachia in delphacid vectors of viruses affecting maize and wheat. An understanding of the bacterial diversity harbored by these insect vectors could lead to new options for future management of diseases of economically important crops in a developing country.

Characterization of the complete genome of Barley yellow striate mosaic virus reveals a nested gene encoding a small hydrophobic protein

Barley yellow striate mosaic virus (BYSMV), a member of the genus Cytorhabdovirus, causes serious crop losses in agriculture. Here, we have cloned the BYSMV-derived small interfering RNAs (siRNAs), assembled the siRNAs and used RT-PCR to reconstruct the BYSMV genome. The genome consists of 12,706 nucleotides and encodes ten predicted genes from the antigenomic strand. The major BYSMV structural proteins share identities ranging from 35% to 62% with northern cereal mosaic virus (NCMV) counterparts. A notable difference is that BYSMV contains three transcriptional units residing between the P and M genes compared with four units in the corresponding region of NCMV. Unexpectedly, the middle mRNA in this region encodes gene5 nested in an alternative frame within gene4 via a leaky scanning mechanism. The gene5 encodes a small hydrophobic protein targeting to the endoplasmic reticulum (ER). To our knowledge, this is the first report of nested gene in plant rhabdoviruses.

First Report of Barley yellow striate mosaic virus on Wheat in China.

In the spring of 2014, a survey of viral diseases on wheat (Triticum aestivum L.) was carried out in Hebei Province, China. The samples with virus-like symptoms of dwarfing and flag leaf yellowing were collected in Zhaoxian, Quyang, Anxin, and Luannan. To reproduce the viral symptoms and confirm whether the unknown virus was transmitted by insect vectors, the nymphs of aviruliferous planthopper (Laodelphax striatellus Fallen, Homoptera: Delphacidae) were transferred onto diseased wheat from the field for a 3-day acquisition access period and a 10-day incubation on fresh wheat seedlings, and then were exposed to 2- to 3-leaf stage wheat seedlings of wheat variety Shixin828 for a 3-day inoculation access period. The infected wheat plants developed mosaic symptoms on the young leaves at 7 days post inoculation (dpi), and followed with severe symptoms including stunting, chlorotic spots, and striation along the veins of leaves at around 14 dpi. The infection symptoms were same as in the field but distinct from wheat infected with Rice black streaked dwarf virus (RBSDV) or Northern cereal mosaic virus (NCMV). For further confirmation, total RNA was extracted from the symptomatic wheat leaves, and NCMV specific primers, NCMV-PF/NCMV-PR (5'-ATGGATAAGAAAGCAAGTGGA-3'/5'-TTAAAAGTCGGCATACGGGTC-3') and RBSDV specific primers, S10-F/S10-R (5'-TTACCCAACATCACGCAACT-3'/5'-GAGCAGGAACTTCACGACAAC-3') were used for amplification of sequences of phosphoprotein and coat protein genes, respectively. Neither RBSDV nor NCMV were present in the symptomatic tissue according to the RT-PCR assay (4). Tissues derived from symptomatic wheat leaves were fixed and embedded in Spurr's resin and used for ultra-thin sectioning and transmission electron microscopy observations, revealing large amounts of Rhabdovirus-like particles in the cytoplasm. The identified particles were about 315 to 353 × 46 to 57 nm, similar in size to Barley yellow striate mosaic virus (BYSMV), a member of the genus Cytorhabdovirus reported from Italy (2). The specific primer pair (5'-ACTAAGGGGGTACTCCGACC-3' and 5'-CTGATCTGCTTTGAGGGGCA-3') was designed based on the reported polymerase (L) gene sequence of BYSMV isolate Zanjan-1 (GenBank Accession No. FJ665628) (1), and used for the BYSMV detection by RT-PCR. A single bright band of the expected size (~500 bp) was obtained from total RNA extracted from the plants exhibiting symptoms in the greenhouse. No such band was amplified from asymptomatic plants, while 15 out of 23 field samples also produced the same 500-bp products in RT-PCR. PCR products from three virus-positive field samples were sequenced directly and the sequences were submitted to GenBank (KM052176, KM052177, and KM052178). BLAST search showed that the sequences shared 96 to 97% nucleotide identity with the polymerase L gene sequence of BYSMV isolate Zanjan-1, whereas only 73 to 75% identity with NCMV (AB030277 and GU985153) (1,3,5). To our knowledge, this is the first report of BYSMV occurrence on wheat in China.

First Report of Barley yellow dwarf virus and Cereal yellow dwarf virus Affecting Cereal Crops in Azerbaijan.

A field survey was conducted during the 2010/2011 growing season at the Absheron experimental station of the Genetic Resources Institute of Azerbaijan. A total of 49 cereal samples with yellowing and reddening symptoms were obtained from 12 bread wheats (Triticum aestivum), 25 durum wheats (T. durum), 11 wild or cultivated wheat relatives (T. dicoccoides, T. beoticum, T. monococcum, and T. turgidum), and one oat (Avena sativa). Samples were tested by tissue-blot immunoassay (2) using antisera against 7 cereal-infecting viruses: Barley stripe mosaic virus (BSMV), Wheat dwarf virus (WDV), Wheat streak mosaic virus (WSMV), Barley yellow mosaic virus (BaYMV), Barley yellow striate mosaic virus (BYSMV), Maize streak virus (MSV), and Barley yellow dwarf virus (BYDV). Strong positive reactions against the BYDV-PAV polyclonal antiserum were shown by 43 samples. To confirm, total RNAs from 10 of the positive samples (three bread wheat, three durum wheat, the oat, and one sample each of T. beoticum, T. turgidum, and T. dicoccoides) were submitted to RT-PCR with two primer pairs adapted in part from (3). Primers Luteo1F 5'TTCGGMSARTGGTTGTGGTCCA 3' and YanR-new 5'TGTTGAGGAGTCTACCTATTTNG 3' (adapted from primer YanR (3)) allow the specific amplification of viruses of the genus Luteovirus (including BYDV) while primers Luteo2F 5'TCACSTTCGGRCCGWSTYTWTCAG 3' (adapted from primer Shu2a-F (3)) and YanR-new are specific for the genus Polerovirus (including Cereal yellow dwarf virus, CYDV). All 10 tested samples gave a positive amplification at the expected size (~545 bp) with the first primer pair, while only two samples, one from oat and one from the wild wheat relative T. dicoccoides, gave a positive amplification of the expected size (~383 bp) with the second primer pair. Sequencing of amplification products obtained with the Luteo1F/YanR-new primer pair confirmed the presence of BYDV-PAV in all samples (GenBank JX275850 to JX275857). The Azeri isolates were all similar (0 to 1.7% nucleotide divergence) except for one isolate (JX275855, from T. turgidum, 2.4 to 3.2% divergence). An Azeri BYDV-PAV isolate (JX275851, from bread wheat) showed 100% identity with a Latvian isolate (AJ563414) and with two isolates from Morocco (AJ007929 and AJ007918). These isolates belong to a group of widespread PAV isolates and are 99% identical with isolates from Sweden, the United States, China, France, and New Zealand. Sequencing of products obtained with the Luteo2F/YanR-new primers (JX294311 and JX294312) identified CYDV-RPV. The two Azeri sequences show ~3% nucleotide divergence and their closest relatives in GenBank are a range of CYDV-RPV isolates mostly from the United States, including EF521848 and EF521830, with ~4 to 5% divergence. Presence of CYDV was also confirmed using amplification with a CYD-specific primer pair (CYDV-fw-New 5'TTGTACCGCTTGATCCACGG 3' et CYDV-rev-New 5'GTCTGCGCGAACCATTGCC 3', both adapted from (1)) and sequencing of the amplification products. This is, to our knowledge, the first report of BYDV-PAV and CYDV-RPV infecting cultivated cereals and wild or cultivated wheat relatives in Azerbaijan. These viruses are responsible for serious disease losses in cereal crops worldwide (4). Their full impact on crops in Azerbaijan is yet to be seen.

First Ocurrence of a Rhabdovirus Infecting Maize in Argentina

Maize (Zea mays) plants showing symptoms of shortened internodes, dwarfism, panicle sterility, and a mosaic of coarse and fine yellow stripes on leaf blades and sheaths, were found from December to March in experimental maize plantings in every crop year since 2000-01. Although the disease appeared at a very low incidence (estimates less than 1%), it was found in several locations such as Santa Isabel and Venado Tuerto, Santa Fe Province; Río Cuarto, Colonia Caroya, Río Segundo, and Sampacho, Córdoba Province; and Pedro Luro, Buenos Aires Province. Leaf tissue from eight symptomatic plants collected in Colonia Caroya in December 2011 was used to perform "leaf dips" and ultrathin sections. Electron microscopy of these preparations revealed membrane-bound bullet-shaped particles characteristic of the Rhabdoviridae family in mesophyll cytoplasm and vascular bundle parenchyma. The virus was experimentally transmitted to healthy 9-day-old corn plants, with Peregrinus maidis (order Hemiptera, family Delphacidae) raised under laboratory conditions using acquisition, latency, and inoculation vector periods of 7, 21, and 7 days, respectively. The field observed symptoms were replicated in the transmitted plants. Total RNA was extracted from symptomatic and asymptomatic plants with the RNeasy Plant Mini Kit (Qiagen, Germany), and one step RT-PCR (Access RT-PCR Kit, Promega, Madison, WI) was performed, using two sets of degenerate primers targeting conserved regions of rhabdovirus L polymerase gene, primers PVO (1) and Rhab (2). The agarose gel bands shown only in symptomatic samples were 450 bp (1) and 1,000 bp (2), as expected. The approximately 1 kb amplicon, which includes that of 450 bp, was cloned into pGEM-T Easy Vector System (Promega). Five independent clones were sequenced in both directions with M13 F/R universal primers to generate a consensus sequence (GenBank Accession No. JQ715419), which was compared to similar plant rhabdovirus sequences available on GenBank. The partial L polymerase gene sequence of the corn rhabdovirus, Maize yellow striate virus had 73% and 71% sequence identity with the members of the Cytorhabdovirus genus Barley yellow striate mosaic virus isolate Zanjan-1 (BYSMV; GenBank Accession No. FJ665628) and Northern cereal mosaic virus (NCMV; GenBank Accession No. NC002251), respectively. A phylogenetic tree from the partial nucleotide L polymerase sequence indicates that the rhabdovirus infecting maize in Argentina is closely related to the cytorhabdovirus members and is separated from the nucleorhabdovirus group. To our knowledge, this is the first mention of a Rhabdoviridae family virus infecting maize detected in Argentina.

Identificación y caracterización biológica del Barley yellow striate mosaic virus (BYSMV): nueva enfermedad del trigo en Argentina

Wheat (Triticum aestivum L.) is the most important winter grain in Argentina. Its production is limited by several factors, including viral diseases. The aim of this study was to identify and characterize a recently detected disease of wheat crops in Argentina. Symptomatic plants were collected from different locations from the wheat production area, Miramar and Balcarce (Buenos Aires), Rio Cuarto, Rosales and Marcos Juarez (Cordoba), Parana (Entre Rios) and General Pico (La Pampa). Samples were characterized by: electron microscopy (leaf-dip and ultrathin sections), serological tests (with antiserum reacting against different wheat viruses by DAS-ELISA and indirect ELISA), mechanical, seed and vector transmission assays, differential host range, and susceptibility of different wheat cultivars in natural infections. The results showed that this new disease is caused by Barley yellow striate mosaic virus (BYSMV) (Rhabdoviridae-Cytorhabdovirus), a widely distributed virus that can be transmitted to other crops such as barley, oat and triticale. This work represents the first report of BYSMV in Argentina.

Analysis of the Complete Nucleotide Sequence of the Polymerase Gene ofBarley Yellow Striate Mosaic Virus- Iranian Isolate

The complete nucleotide sequence of an Iranian isolate of Barley yellow striate mosaic virus (BYSMV) L gene comprising 6171 nucleotides was determined using the random polymerase chain reaction followed by filling of gaps by the use of specific primers. The deduced L protein sequence of BYSMV showed similarities with the L proteins of other plant rhabdoviruses and contained polymerase module motifs characteristic of RNA-dependent RNA polymerases of negative-strand RNA viruses. Pairwise and multiple alignments and phylogenetic analysis of BYSMV L protein revealed that it was more closely related to cytorhabdoviruses. These results revealed that, on the basis of polymerase gene, the Iranian isolate of BYSMV and Northern cereal mosaic virus (NCMV) appeared to be the most closely related plant rhabdoviruses sequenced to date. Interestingly, the amino acid sequence identity of BYSMV/NCMV (61.3%), shared more than twice the amino acid sequence identity compared with the next two most similar cytorabdoviruses, Lettuce necrotic yellows virus (28.8%) and Lettuce yellow mottle virus (28.2%). In this paper, we discuss the similarities and differences of BYSMV with other rhabdoviruses which support the classification of BYSMV as a distinct Cytorhabdovirus. This is the first report of BYSMV genome sequences.

First Detection of Wheat dwarf virus in Barley in Spain Associated with an Outbreak of Barley Yellow Dwarf.

Severe dwarfing, yellowing, and crop failure were observed on barley in northeastern Spain during March and April of 2003. Leaves from 106 plants collected from 15 barley fields were analyzed using enzyme-linked immunosorbent assay (ELISA) with commercial antisera (Loewe Biochemica, Munich) specific for Barley mild mosaic virus (BaMMV), Barley yellow mosaic virus (BaYMV), the PAV and MAV serotypes of Barley yellow dwarf virus (BYDV), Barley yellow striate mosaic virus (BYSMV), Barley stripe mosaic virus (BSMV), Brome mosaic virus (BMV), Brome streak mosaic virus, (BStMV), Cereal yellow dwarf virus (CYDV), Wheat streak mosaic virus (WSMV), Wheat spindle streak mosaic virus (WSSMV), Soilborne cereal mosaic virus (SBCMV), and Wheat dwarf virus (WDV). In 70 samples, BYDV-PAV was the sole virus detected; in 20 other samples, this virus was detected in association with WDV, WSMV, BaMMV, and/or BaYMV. Mixed infections were further analyzed using reverse transcriptase-polymerase chain reaction (RT-PCR) or PCR with specific primers that amplify 445 bp of BaMMV (3), 433 bp of BaYMV (1), 600 bp of WSMV (primer 1: 5'CGAAACGCAGCG TTATTTC3', primer 2: 5'CATCTGAAG GGCTTGACG3'), and 1,200 bp of WDV (4). Eight samples gave the expected amplicons for WDV, two samples gave the expected amplicon for BaMMV, and one sample gave the BaMMV and BaYMV amplicons. No samples gave the amplicon for WSMV. In addition, 10 samples that were positive with ELISA for BYDV, either as a single or as multiple infections with other viruses, were analyzed with specific primers that amplify 600 bp of the BYDV genome (2) and all gave the expected RT-PCR product. ELISA and RT-PCR results agreed completely for WDV and BYDV samples, but agreed poorly for BaMMV and BaYMV (three of seven ELISA-positive samples). PCR products of WDV were subsequently cloned and sequenced. Sequence analysis confirmed the presence of WDV in these barley samples. This report shows the high occurrence of BYDV in barley fields and its association with BaMMV, BaYMV, and WDV infections that induces barley crop failure. To our knowledge, this is the first detection of WDV in Spain.

Identification of viral diseases affecting barley and bread wheat crops in Yemen

A survey to identify virus diseases affecting barley and bread wheat crops at different locations in Yemen was conducted during 15–24 September 2004. The survey covered 13 barley and 23 bread wheat fields, which were randomly selected. The identification of the viruses and their incidence was determined by laboratory testing of 100–200 randomly collected samples and 2–20 symptomatic samples from each field by tissue blot immunoassay using antisera to six cereal viruses (Barley yellow dwarf virus-PAV, Barley stripe mosaic virus, Barley yellow striate mosaic virus, Wheat streak mosaic virus, Barley yellow dwarf virus-MAV and Cereal yellow dwarf virus-RPV). The most common virus detected on the randomly collected samples was the Barley yellow dwarf virus-PAV, with an overall incidence of 7.0% in barley and 4.3% in bread wheat, followed by the Barley stripe mosaic virus. Two cereal fields had a total virus disease incidence of 21% or higher. The highest virus disease incidence detected in barley fields was 28.9% in the El-Bon valley, which was infected with Barley stripe mosaic virus and Barley yellow dwarf virus. Other viruses, such as Barley yellow striate mosaic virus, Cereal yellow dwarf virus-RPV and Barley yellow dwarf virus-MAV were rarely detected. This is the first report of Barley stripe mosaic virus, Barley yellow striate mosaic virus, Barley yellow dwarf virus-MAV, Barley yellow dwarf virus-PAV and Cereal yellow dwarf virus-RPV naturally infecting cereals in Yemen.

First Record of Barley yellow striate mosaic virus Affecting Wheat Summer-Nurseries in Syria.

A limited survey to identify virus diseases affecting wheat in summer nurseries in agricultural stations in southern Syria was conducted during October 2002. A total of 94 bread and durum wheat samples with symptoms suggestive of virus infection (stripping, stunting, and yellowing) were collected. All samples were tested for the presence of four viruses by tissue-blot immunoassay (2) at the Virology Laboratory of ICARDA, Aleppo, Syria using the following polyclonal antibodies: Barley stripe mosaic virus (BSMV); Barley yellow dwarf virus-PAV (BYDV-PAV) and Wheat streak mosaic virus (WSMV) from the Virology Laboratory at ICARDA; and Barley yellow striate mosaic virus (BYSMV) isolated from Italy (BYSMV-Italy) and provided by M. Conti, Instituto di Fitovirologia applicata, Turino, Italy. Serological results obtained indicated that BYSMV was the most commonly encountered virus (78.7%) followed by BYDV-PAV (22.3%), whereas, BSMV and WSMV were not detected in any of the samples tested. In sodium dodecyl sulfate-polyacrylamide gel electrophoresis, followed by western blots, purified BYSMV preparations were observed to contain a 47-kDa structural protein typical of the N protein of Rhabdoviruses that reacted strongly with three BYSMV antisera (BYSMV-Italy, BYSMV-Lebanon [4], and BYSMV-Morocco [1]). Samples that reacted with BYSMV antisera were transmitted from wheat to wheat, barley, and oat plants by the planthopper Laodelphax striatella (Fallen) (Hemiptera: family Delphacidae) in a persistent manner, and the major symptoms of BYSMV on cereal crops were stripping and stunting. BYDV-PAV has been reported from Syria earlier (3) but to our knowledge, this is the first report of BYSMV affecting wheat in Syria.

Low-cost paper can be used in tissue-blot immunoassay for detection of cereal and legume viruses

In an effort to reduce the cost of virus assays, different types of regular paper were evaluated as possible replacements for the commonly used nitrocellulose membrane (NCM) as the solid phase in the tissue-blot immunoassay (TBIA) used to detect Alfalfa mosaic virus, Bean yellow mosaic virus and Broad bean stain virus (BBSV) in faba bean tissue, and Barley yellow striate mosaic virus in barley tissue. Among the many types of paper evaluated, Hewlett-Packard (HP) non-glossy plotter paper proved to be adequate for detection of all the above viruses. After printing (blotting) of the samples to be tested and blocking with either 2% gelatin (for one hour at 37oC) or using 0.1% Roche blocking reagent (for one hour at room temperature), satisfactory results were produced. This paper could also be used to detect BBSV in groups consisting of 15 young lentil seedlings. HP non-glossy plotter paper was not as effective when testing for phloem-limited legume viruses such as Bean leaf roll virus (BLRV), Faba bean necrotic yellows virus (FBNYV) and Barley yellow dwarf virus (BYDV). White paper (manufactured by Soporcel, Portugal) was slightly more sensitive when used for BLRV and FBNYV detection in faba bean tissues and for BYDV in barley tissues. Since NCM represents 40–50% of the cost of test reagents, using ordinary paper reduced costs considerably.

First Record of Barley yellow striate mosaic virus and Cereal yellow dwarf virus-RPV Infecting Wheat in Uzbekistan.

A preliminary survey to identify virus diseases affecting wheat in Uzbekistan was conducted during May 2001. The survey covered 12 wheat fields from 2 cereal-growing regions (Tashkent-Angren and Tashkent-Samarkand). A total of 250 wheat samples with symptoms suggestive of virus infection were collected and tested for the presence of nine viruses by tissue-blot immunoassay (TBIA) (1) at the Virology Laboratory of ICARDA, Aleppo, Syria, using the following antisera: monoclonal antibodies for Cereal yellow dwarf virus-RPV (CYDV-RPV) (ATCC PVAS-669 [American Type Culture Collection, Manassas, VA]) and Barley yellow dwarf virus-MAV (BYDV-MAV) (ATCC PVAS-673); and polyclonal antibodies for BYDV-SGV and BYDV-RMV (3); BYDV-PAV, Barley stripe mosaic virus, and Wheat streak mosaic virus (from Virology Laboratory, ICARDA); Wheat dwarf virus (provided by J. Vacke, Research Institute of Crop Production, Prague, Czeck Republic); and Barley yellow striate mosaic virus (BYSMV) isolated from Lebanon (2). The most common virus present was BYDV-PAV (detected in 12% of the 250 samples tested), followed by BYDV-SGV (10.8%), BYSMV (5.6%), BYDV-RMV (2.4%), BYDV-MAV (2%), and CYDV-RPV (1.2%). CYDV-RPV was detected in three fields; one field was 50 km southeast of Tashkent, and the other two fields were between Tashkent and Samarkand. The majority of BYSMV-positive samples originated from the same field, ≈40 km northeast of Samarkand. Field symptoms of BYSMV-infected plants included yellow flag leaf and stunting. All samples that produced a positive reaction to BYSMV-Lebanon antiserum were tested against four other rhabdovirus antisera: BYSMV-Italy, BYSMV-Morocco, Cereal chlorotic mottle virus, and American wheat striate mosaic virus. Serological tests showed that 100% of the samples reacted strongly with BYSMV-Italy and BYSMV-Morocco. In sodium dodecyl sulfate-polyacrylamide gel electrophoresis, followed by western blots, extracts from BYSMV-infected plants were found to contain 66- and 47-kDa structural proteins, typical of G and N proteins of rhabdoviruses, both of which reacted strongly with BYSMV-Italy antiserum. To our knowledge, this is the first report of BYSMV and CYDV-RPV in Uzbekistan.

First Report of Barley yellow striate mosaic virus Infecting Barley and Wheat in Lebanon.

Symptoms suggestive of virus infection in barley, bread wheat, and durum wheat were observed at high incidence in November 2000 in Terbol, Beqa'a Valley, Lebanon. The symptoms were mainly stunting, accompanied by leaf striping and yellowing. Symptomatic plant samples (27 barley, 37 bread wheat, and 81 durum wheat) were collected and tested for the presence of four different viruses by tissue-blot immunoassay (TBIA) (1) at the Virology Laboratory of ICARDA, Aleppo, Syria. Antisera used were for Barley stripe mosaic virus (BSMV, genus Hordeivirus) (2); Barley yellow dwarf virus (BYDV, genus Luteovirus, family Luteoviridae) (PAV serotype) (2); Wheat streak mosaic virus (WSMV, genus Tritimovirus, family Potyviridae) (3); and Barley yellow striate mosaic virus (BYSMV, genus Cytorhabdovirus, family Rhabdoviridae) provided by M. Conti, Instituto di Fitovirologia applicata, Turino, Italy. BYSMV was detected in 12 barley, 18 bread wheat, and 56 durum wheat samples; the corresponding numbers of barley, bread wheat, and durum wheat plants testing positive for BYDV-PAV were 4, 7, and 6, respectively. BSMV and WSMV were not detected in any of the samples tested. BYSMV was purified from infected wheat plants, and the purified preparation had a UV 260:280 ratio of 1.18, typical of Rhabdoviruses. In SDS-polyacrylamide gel electrophoresis, the purified virus preparation indicated the presence of 66, 47, and 15 kDa structural proteins, typical of the G, N and M proteins of Rhabdoviruses. In western blot, the 66 and 47 kDa protein bands reacted strongly with BYSMV antiserum. This is the first record of BYSMV infecting barley and wheat in Lebanon.

First Record of Barley yellow striate mosaic virus, Barley stripe mosaic virus, and Wheat dwarf virus Infecting Cereal Crops in Tunisia.

A survey conducted during April 2000 to identify viruses infecting cereal crops in different regions (Beja, Bizerte, Cap-bon, Jendouba, Kairouan, Siliana, and Zaghouan) of Tunisia covered 15 barley, 21 durum wheat, and 7 bread wheat randomly selected fields. Virus incidences were determined on the basis of laboratory testing of 100 to 200 randomly collected samples from each field. A total of 5,227 random (1,654 barley, 2,546 durum wheat, and 1,027 bread wheat) and 1,430 symptomatic (451 barley, 746 durum wheat, and 233 bread wheat) samples were collected. Samples were tested for the presence of five different viruses by tissueblot immunoassay (TBIA) (1) at the Virology Laboratory of INRAT. Antisera used were for Barley stripe mosaic virus (2), Barley yellow dwarf virus (PAV serotype) (2), Wheat streak mosaic virus (3), Barley yellow striate mosaic virus (BYSMV) provided by E. Luisoni, IFA, Turino, Italy (4), and Wheat dwarf virus (WDV) provided by J. Vacke, Research Institute of Crop Production, Prague, Chech Republic. BYDVPAV was detected in seven barley (from three fields), 25 durum wheat (10 fields), and eight bread wheat (three fields) samples from all except the Siliana region. BYSMV was detected in three barley (three fields), 16 durum wheat (six fields), and four bread wheat (three fields) samples from the Beja, Bizerte, Cap-bon, Jendouba, and Siliana regions. WDV was detected in five barley (three fields), nine durum wheat (four fields), and four bread wheat (one field) samples from the Beja, Cap-bon, and Bizerte regions. BSMV was detected in 49 barley (six fields) and 25 durum wheat (five fields) samples from the Beja, Bizerte, Cap-bon, Kairouan, and Zaghouan regions. This is the first record of BYSMV, BSMV, and WDV infecting cereal crops in Tunisia, but their incidence in fields was less than 1%. However, BSMV incidence was 10.5% in one barley field from the Cap-bon region. Virus incidence in symptomatic plants was a bit higher and ranged from 0.8% for WDV in bread wheat to 6% for BSMV in barley.

Viral Diseases of Cultivated Legume and Cereal Crops in Tunisia

A survey to identify virus diseases affecting legume (chickpea, faba bean and lentil) and cereal (bread and durum wheat and barley) crops at different locations in Tunisia was conducted in April, 2000. Thirty-eight legume fields (34 faba bean, 3 chickpea and one lentil) and 43 cereal fields (21 durum wheat, 7 bread wheat and 15 barley) were randomly selected. The identity of the viruses and virus disease incidence was determined on 100-200 randomly collected samples and 20-25 symptomatic samples from each field by testing samples against antisera of 12 legume and 6 cereal viruses. In the faba bean fields, Broad bean mottle virus (BBMV) and Beet western yellows virus (BWYV) were the most common followed by Faba bean necrotic yellows virus (FBNYV). In cereal fields, Barley stripe mosaic virus (BSMV) was the most common followed by Barley yellow dwarf virus (BYDV) and Barley yellow striate mosaic virus (BYSMV). Two faba bean fields had a virus disease incidence of 21% or higher at the time of the survey and two cereal fields had a virus disease incidence of more than 6%. The highest incidences found were 24.5% (BWYV and/or FBNYV) in the Siliana region and 23% (BBMV and/or BWYV) in the Jendouba region, both in faba bean fields, and 10.5% (BSMV) in a barley field in the Cap-Bon region. Other viruses, such as Broad bean stain virus (BBSV), Bean leaf roll virus (BLRV) and Cucumber mosaic virus (CMV) in legumes, and Wheat dwarf virus (WDV) in cereals were rare.