Barley Yellow Dwarf virus-PAV Research Articles

First report of barley yellow dwarf virus PAS (Luteovirus pashordei) in oat in Australia.

Luteoviruses (family Tombusviridae) and poleroviruses (family Solemoviridae) are economically important pathogens of cereals such as wheat (Triticum aestivum), barley (Hordeum vulgare) and oat (Avena sativa). In Australia, the luteoviruses barley yellow dwarf virus PAV (BYDV PAV) and barley yellow dwarf virus MAV (BYDV MAV), along with the poleroviruses cereal yellow dwarf virus RPV (CYDV RPV) and maize yellow dwarf virus RMV (MYDV RMV), were distinguished from each other and reported in the 1980s (Sward and Lister 1988; Waterhouse and Helms 1985). The poleroviruses barley virus G (BVG) and cereal yellow dwarf virus RPS (CYDV RPS) were reported in Australia more recently (Nancarrow et al. 2019; Nancarrow et al. 2023), while the luteovirus barley yellow dwarf virus PAS (BYDV PAS) has not previously been reported in Australia. During 2010, an oat plant exhibiting yellow/ red leaf discoloration and stunted growth was collected from a roadside in Horsham, Victoria, Australia. The plant tested positive for BYDV PAV and negative for BYDV MAV, CYDV RPV and MYDV RMV by tissue blot immunoassay (TBIA) as described by Trębicki et al (2017). The virus isolate has since been continuously maintained in a glasshouse in live wheat plants using aphids (Rhopalosiphum padi). In 2021, total RNA extracted from a wheat plant infected with this isolate (Nancarrow et al. 2023) tested positive for BYDV PAV by RT-PCR using the primers BYDV-1/BYDV-2 (Rastgou et al. 2005), but negative for BYDV PAV, CYDV RPV and MYDV RMV using other published primers (Deb and Anderson 2008). A high-throughput sequencing (HTS) library was prepared from the total RNA with the NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB) without ribosomal RNA depletion and sequenced on a NovaSeq 6000 (Illumina). Raw reads were trimmed and filtered using fastp v0.20.0 (Chen et al. 2018) while de novo assembly of all of the resulting 5,049,052 reads was done using SPAdes v3.15.3 (Nurk et al. 2017). BLASTn analysis of the resulting 4,067 contigs (128- 12,457 bp in length) revealed only one large virus-like contig (5,649 bp) which was most similar to BYDV PAS isolates on NCBI GenBank, sharing 87% nucleotide (nt) identity with BYDV PAS isolate OH2 (MN128939), 86% nt identity with the BYDV PAS reference sequence (NC_002160) and 82% nt identity with the BYDV PAV reference sequence (NC_004750). Additionally, 4,008 HTS reads were mapped to the assembled genome sequence with Bowtie2 v2.4.5. (Langmead and Salzberg 2012) with 100% genome coverage and an average coverage depth of 101X. Primers were designed to the assembled genome sequence to generate overlapping amplicons across the genome, and the resulting amplicons were Sanger sequenced. This confirmed the genome sequence of BYDV PAS isolate PT from Australia (5649 bp, GC content 47.9%), which was deposited in GenBank (LC782749). Ten additional plant samples collected from western Victoria, Australia, all tested positive for BYDV PAS by RT-PCR using the primers PASF and PASR (Laney et al. 2018). The additional samples consisted of one oat sample collected in 2005, one barley sample collected in 2007, three wheat samples collected in 2016 and one barley, one brome grass (Bromus sp.) and three wheat samples collected in 2020. BYDV PAS is also efficiently transmitted by R. padi but is often more prevalent and severe than BYDV PAV; it can also overcome some sources of virus resistance that are effective against BYDV PAV (Chay et al. 1996, Robertson and French 2007). To our knowledge, this is the first report of BYDV PAS in Australia. Further work is needed to determine the extent of its distribution, incidence, impacts and epidemiology in Australia, along with its relationship to other BYDV PAS isolates.

First report of cereal yellow dwarf virus RPS infecting wheat in Australia.

Yellow dwarf viruses (YDVs) reduce grain yield in a wide range of cereal hosts worldwide. Cereal yellow dwarf virus RPV (CYDV RPV) and cereal yellow dwarf virus RPS (CYDV RPS) are members of the Polerovirus genus within the Solemoviridae family (Scheets et al. 2020; Sõmera et al. 2021). Along with barley yellow dwarf virus PAV (BYDV PAV) and barley yellow dwarf virus MAV (BYDV MAV) (genus Luteovirus, family Tombusviridae), CYDV RPV is found worldwide and has mostly been identified as being present in Australia based on serological detection (Waterhouse and Helms 1985; Sward and Lister 1988). However, CYDV RPS has not previously been reported in Australia. In October 2020, a plant sample (226W) was collected from a volunteer wheat (Triticum aestivum) plant located near Douglas, Victoria, Australia that displayed yellow-reddish leaf symptoms typical of YDV infection. The sample tested positive for CYDV RPV and negative for BYDV PAV and BYDV MAV by tissue blot immunoassay (TBIA) (Trębicki et al. 2017). Given that CYDV RPV and CYDV RPS can both be detected using serological tests for CYDV RPV (Miller et al. 2002), total RNA was extracted from stored leaf tissue of plant sample 226W for further testing using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) with modified lysis buffer (Constable et al. 2007; MacKenzie et al. 1997). The sample was then tested by RT-PCR using three sets of primers that were designed to detect CYDV RPS, targeting three distinct overlapping regions (each approximately 750 bp in length) of the 5' end of the genome where CYDV RPV and CYDV RPS differ most (Miller et al. 2002). The primers CYDV RPS1L (GAGGAATCCAGATTCGCAGCTT)/ CYDV RPS1R (GCGTACCAAAAGTCCACCTCAA) targeted the P0 gene, while CYDV RPS2L (TTCGAACTGCGCGTATTGTTTG)/ CYDV RPS2R (TACTTGGGAGAGGTTAGTCCGG) and CYDV RPS3L (GGTAAGACTCTGCTTGGCGTAC)/ CYDV RPS3R (TGAGGGGAGAGTTTTCCAACCT) targeted two different regions of the RdRp gene. Sample 226W tested positive using all three sets of primers and the amplicons were directly sequenced. NCBI BLASTn and BLASTx analyses showed that the CYDV RPS1 amplicon (Accession No. OQ417707) shared 97% nucleotide (nt) identity and 98% amino acid (aa) identity similarity with the CYDV RPS isolate SW (Accession No. LC589964) from South Korea, while the CYDV RPS2 amplicon (Accession No. OQ417708) shared 96% nt identity and 98% aa identity similarity with the same CYDV RPS isolate SW. The CYDV RPS3 amplicon (Accession No. OQ417709) shared 96% nt identity and 97% aa identity similarity with the CYDV RPS isolate Olustvere1-O (Accession No. MK012664) from Estonia, confirming that isolate 226W is CYDV RPS. In addition, total RNA extracted from 13 plant samples that had previously tested positive for CYDV RPV by TBIA were tested for CYDV RPS using the primers CYDV RPS1 L/R and CYDV RPS3 L/R. The additional samples, consisting of wheat (n=8), wild oat (Avena fatua, n=3) and brome grass (Bromus sp., n=2), were collected at the same time as sample 226W from seven fields within the same region. Five of the wheat samples were collected from the same field as sample 226W, one of which tested positive for CYDV RPS while the remaining 12 samples were negative. To the best of our knowledge, this is the first report of CYDV RPS in Australia. It is not known if CYDV RPS is a recent introduction to Australia, and its incidence and distribution in cereals and grasses in Australia, while currently unknown, is being investigated.

First Report of Beet western yellows virus Infecting Wheat in China.

Wheat (Triticum aestivum L.) is an important cereal crop widely cultivated worldwide. Viral disease is a major threat to wheat yield. In April 2022, fifteen winter wheat plants with yellowing and stunting symptoms were collected from wheat fields in Jingjiang, Jiangsu Province. Total RNA of each sample was extracted, and RT-PCR was performed using two pairs of degenerate luteovirus primers Lu-F (5'-CCAGTGGTTRTGGTC-3') and Lu-R (5'-GTCTACCTATTTGG-3'), Leu-F (5'-GCTCTAGAATTGTTAATGARTACGGTCG-3') and Leu-R (5'-CACGCGTCN ACCTATTTNGGRTTNTG-3'). Amplicons with the expected size were obtained from 10 of the 15 samples (using primers Lu-F/Lu-R) and 3 of the 15 samples (using primers Leu-F/Leu-R), respectively. These amplicons were cloned into the pDM18-T vector (TaKaRa) for sequencing. Blastn alignment showed that 10 amplicons (531 bp) from Lu-F/Lu-R primers were essentially identical to one another, which shared 99.62% nucleotide sequence identity to barley yellow dwarf virus-PAV (BYDV-PAV) isolate GJ1 from Avena sativa in South Korea (LC550014). Three amplicons (635 bp) from Leu-F/Leu-R primers had 99.68% nucleotide identity to the corresponding part of an isolate of beet western yellows virus (BWYV) from saffron (Crocus sativus) in China (MG002646). Among the 13 virus-positive samples, none were co-infected by BYDV-PAV and BWYV. Then, amplification using BWYV-specific primers (BWYV-F: 5'-TGCTCCGGTTTTGACTGGAGTGT-3', BWYV-R: 5'-CGTCTACCT ATTTTGGGTTGTGG-3') generated a 1409 bp product, corresponding to the partial sequence of the viral RNA-dependent RNA polymerase gene and complete sequence of the coat protein (CP) gene. The sequences (GenBank accession no. ON924175) of amplicons from 3 BWYV samples were identical to one another, which shared 98.41% nucleotide identity to BWYV isolate Hs from Japanese hop (Humulus scandens) in China (KC210049). The predicted coat protein of the BWYV wheat isolate had 99.51% nucleotide and 100% amino acid identity to BWYV isolate Hs. BWYV infection on wheat samples was also verified by dot-nucleic acid hybridization using a digoxigenin-labeled cDNA probe against the CP gene, as described previously (Liu et al. 2007). Further, RNA-positive samples were tested by enzyme-linked immunosorbent assay (ELISA) using the ELISA reagent kit for BWYV (Catalog No. KS19341, Shanghai Keshun Biotech, Shanghai, China); test results were also BWYV-positive, confirming that both BWYV nucleic and coat protein are present in these wheat samples. BYDV-PAV is a common wheat virus (Chay et al. 1996), while BWYV has never been reported to infect wheat. BWYV, an aphid-transmitted virus belonging to the Polerovirus genus, has an extensive host range, including over 150 plant species from 23 dicotyledonous families, such as Beta vulgaris, Spinacia oleracea, Lactuca sativa, and Brassica oleracea var. italica (Duffus 1964, 1973; Russell 1965; Beuve et al. 2008). In addition, BWYV was reported to infect a monocotyledonous plant, Crocus sativus (Iridaceae) (Zheng et al. 2018). To our knowledge, this is the first report of BWYV in wheat or any other Gramineae crop. The result also implies that BWYV has a potential risk to cereal crops in the field.

Asymmetric interactions between barley yellow dwarf virus -PAV and wheat dwarf virus in wheat.

The deciphering of the epidemiology of a plant virus has long been focused on the study of interactions between partners of one pathosystem. However, plants are exposed to numerous viruses which lead to frequent co-infection scenarios. This can change characteristics of virus-vector-host interactions and could impact the epidemiology of viral diseases. Barley yellow dwarf virus-PAV (BYDV-PAV; species: Luteovirus pavhordei; genus Luteovirus), wheat dwarf virus (WDV; genus Mastrevirus) and their respective vectors (BYDV-PAV: e.g. Rhopalosiphum padi and WDV: Psammotettix alienus) are commonly found in cereal fields. Wheat plants co-infected with BYDV-PAV and WDV have been reported from field surveys, although epidemiological outcomes of BYDV-PAV - WDV interactions in planta have not yet been studied. Experiments were carried out to evaluate and compare, through different competition scenarios (i.e. single- and co- (simultaneous and sequential) inoculations), the efficiency of BYDV-PAV and WDV to infect, to accumulate in and to be spread between wheat plants. Moreover, the impact of competition scenarios on the biological parameters of these two viruses was evaluated at different stages of the infection and with plants at different ages at inoculation. Results showed i) that these viruses achieve their infection cycle and their plant-to-plant transmission with different efficiencies and ii) BYDV-PAV - WDV interactions lead to different phenotypes ranging from antagonism to synergism. Finally, when these two viruses share a host, the nature and strength of virus-virus interactions varied depending on the order of virus arrival, stages of the infection cycle and plant age at inoculation. Precisely, the introduction (i.e. co- and sequential inoculation) and infection process (i.e. virus accumulation) of BYDV-PAV in a wheat benefit from the presence of WDV. For the latter, the sympatry with BYDV-PAV exerts opposite pressure on parameters involved in virus introduction (i.e. benefit during sequential inoculation) and spread (i.e. lower transmission efficiency and virus accumulation in co-infected plants). In the context of increased potential exposure of crops to insect vectors, this study participates in a better understanding of the impact of BYDV-PAV and WDV co-infections on biological and ecological parameters of the diseases induced by these viruses.

Discovery and Genome Characterization of a Closterovirus from Wheat Plants with Yellowing Leaf Symptoms in Japan

Many aphid-borne viruses are important pathogens that affect wheat crops worldwide. An aphid-transmitted closterovirus named wheat yellow leaf virus (WYLV) was found to have infected wheat plants in Japan in the 1970s; however, since then, its viral genome sequence and occurrence in the field have not been investigated. We observed yellowing leaves in the 2018/2019 winter wheat-growing season in an experimental field in Japan where WYLV was detected five decades ago. A virome analysis of those yellow leaf samples lead to the discovery of a closterovirus together with a luteovirus (barley yellow dwarf virus PAV variant IIIa). The complete genomic sequence of this closterovirus, named wheat closterovirus 1 isolate WL19a (WhCV1-WL19a), consisted of 15,452 nucleotides harboring nine open reading frames. Additionally, we identified another WhCV1 isolate, WL20, in a wheat sample from the winter wheat-growing season of 2019/2020. A transmission test indicated that WhCV1-WL20 was able to form typical filamentous particles and transmissible by oat bird-cherry aphid (Rhopalosiphum pad). Sequence and phylogenetic analyses showed that WhCV1 was distantly related to members of the genus Closterovirus (family Closteroviridae), suggesting that the virus represents a novel species in the genus. Furthermore, the characterization of WhCV1-WL19a-derived small RNAs using high-throughput sequencing revealed highly abundant 22-nt-class small RNAs potentially derived from the 3'-terminal end of the WhCV1 negative-strand genomic RNA, indicating that this terminal end of the WhCV1 genome is likely particularly targeted for the synthesis of viral small RNAs in wheat plants. Our results provide further knowledge on closterovirus diversity and pathogenicity and suggest that the impact of WhCV1 on wheat production warrants further investigations.

The Complete Nucleotide Sequence of Barley Yellow Dwarf Virus-PAV from Wheat in Turkey

ABSTRACTWe report the sequence of an assembled genome of Barley yellow dwarf virus-PAV (BYDV-PAV) from Turkey. This 5,672 nucleotide RNA encodes seven known open reading frames and a possible eighth. This genome from wheat is closely related to BYDV-PAVs in Pakistan, Brazil, and Australia, including one sequenced 34 years ago.

First report of maize yellow mosaic virus (MaYMV) naturally infecting wheat in China.

Maize yellow mosaic virus (MaYMV), a new species in the genus Polerovirus (family Solemoviridae), was reported in maize for the first time in China in 2016 (Chen et al., 2016). Later, MaYMV was found in other gramineous species including sugarcane (Saccharum spp.), itch grass (Rottboellia cochinchinensis), millet (Panicum miliaceum) and sorghum (Sorghum bicolor) in several countries in Asia, Africa, and South America (Yahaya et al. 2017; Lim et al. 2018; Sun et al. 2019; Nithya et al. 2021). Here, we report its presence in cultivated wheat (Triticum aestivum), detected using high-throughput sequencing (HTS). In 2021 in Henan Province, China, wheat plants with virus-like symptoms such as yellowing, stunting, and vein clearing were collected from fields in Luoyang (three plants, cv. Luohan 6), Nanyang (two plants, cv. Xinong 979), and Anyang (one plant, cv. Bainong 207). RNA was extracted from symptomatic leaves of each plant sample using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). From each sample, 1 μg of RNA was mixed into a single pool to construct an rRNA-depleted RNA-seq library using a TruSeq RNA Sample Prep Kit for sequencing on the HiSeq X-Ten platform as 150-bp paired-end reads. A total of 88,892,804 clean reads were obtained after removing adaptor sequences and low-quality reads. Reads were mapped against the wheat genome database (IWGSC RefSeq v2.1) using the hisat2 v2.0.5 program. Remaining sequences were de novo assembled into contigs with Trinity program. Contigs from barley yellow dwarf virus PAV (BYDV-PAV), and BYDV-GAV were identified using a Blast search of the NCBI nr/nt database, all previously reported in wheat in China. Interestingly, four contigs with high similarity (>95%, at the nucleotide level) to MaYMV were also identified. Using the sequence of MaYMV isolate Yunnan 9 (KU291105) as reference, a total of 1,260 reads from HTS mapped to the virus genome with a coverage of 75.5% (average coverage: 33.5×). For verifying the presence of MaYMV in the source samples, MaYMV-specific primers MV-fw/MV-rev were designed to amplify the 513-bp fragment of the RdRp gene by a reverse transcription-polymerase chain reaction (RT-PCR) using the original total RNA. RT-PCR assay revealed that only 1 of the 6 samples tested positive for MaYMV, while the remaining plants were positive for other viruses (BYDV-PAV and BYDV-GAV that produce similar symptoms; viral-specific primers as previously described [Liu et al., 2020]). A subsequent survey of 17 winter wheat fields in 2021 confirmed that 6 of 286 wheat samples with virus symptoms were infected with MaYMV; 4 positives were from Linfen, Shanxi Province and 1 each from Yuanyang and Anyang, Henan Province. The full genome of wheat-infecting MaYMV isolate Anyang1 was then sequenced using RT-PCR with Sanger sequencing technology; the genomic sequence (5,642 nt) was deposited in GenBank as accession OK331995. BLASTn search showed that the complete genome sequence of this virus is 99.0%, 98.9% and 98.7% identical to isolate SC1 (MK652148), Guizhou1 (KU291107) and Yunnan 11 (KU248489), respectively. Also, the MaYMV isolate Anyang1 obtained in this study clustered with other MaYMV isolates in a phylogenetic analysis based on MaYMV full genomes. To the best of our knowledge, this is the first report of MaYMV in wheat worldwide. The presence of MaYMV in wheat is important because winter wheat could serve as an overwintering reservoir of MaYMV and perpetuate the virus in wheat-maize rotation systems in northern China.

Can Mixed Intercropping Protect Cereals from Aphid-Borne Viruses? An Experimental Approach.

Simple SummaryAphids are vectors of plant viruses and can cause important yield losses in numerous crops. Rhopalosiphum padi is the main vector of Barley yellow dwarf virus PAV (BYDV-PAV). The yellow dwarf disease (YDD), present in all cereal growing regions in the world, caused by BYDV-PAV, can induce up to 80% of yield losses in barley. In a context of global warming, reduction of pesticide uses, and development of organic farming, new control methods for YDD incidence are needed. In this study, the association of a winter barley with clover was tested for its impact(s) on the R. padi/BYDV-PAV pathosystem. The effect of clover was different according to the morph of the aphid introduced in a multi-plant (i.e., arena) experimental design in laboratory. A spatial effect on aphid distribution (observed for alate founder morph) and a reduction of the size of aphid populations (observed for wingless founder morph) are described. However, the presence of clover did not modify, under our experimental conditions, the efficiency of BYDV-PAV infections and within arena spread of YDD. Thus, clover used by cereal growers for other services (weeds reduction, nitrogen supply, and soil cover), would participate to lower the risks associated to the presence of BYDV vectors through a bottom-up regulation of aphid populations within the field. Barley/clover intercropping should be considered as a promising method for a future management strategy against vectors of yellow dwarf disease, especially in an insecticide-free agriculture.Intercropping, i.e., association of two or more species, is promising to reduce insect populations in fields. The cereal aphid Rhopalosiphum padi, a vector of the Barley yellow dwarf virus PAV (BYDV-PAV), represents a major threat for cereal grain production. In this study, we tested the potential of winter barley intercropped with clover to reduce the size of R. padi populations and to lower the BYDV-PAV incidence in fields. We used arenas (i.e., sets of 36 barley plants) intercropped with or without clover plants (at different sown densities). In each arena, a single viruliferous founder, R. padi, (with an alate or a wingless morph) was deposited to introduce aphids and viruses in the experiment. Thirteen days later, the number of aphids in the arena, the percentage of plants hosting aphids and the infection rates were monitored. Data produced through this experimental design showed that clover alters the distribution of the aphid progeny (lower aphid spread) produced by an alate founder morph. Moreover, clover reduces the size of aphid populations produced by a wingless founder morph. However, despite the effects of clover on biological parameters of R. padi, the presence of clover in barley arena did not modify BYDV infections, suggesting complex mechanisms between partners of the BYDV pathosystem for plant-to-plant virus spread.

Manipulation of Insect Vectors' Host Selection Behavior by Barley Yellow Dwarf Virus Is Dependent on the Host Plant Species and Viral Co-Infection.

Previous studies have shown that vector-borne viruses can manipulate the host selection behavior of insect vectors, yet the tripartite interactions of pathogens, host plants and insect vectors have been documented only in a limited number of pathosystems. Here, we report that the host selection behavior of the insect vector of barley yellow dwarf virus-PAV (BYDV-PAV) and cereal yellow dwarf virus-RPS (CYDV-RPS) is dependent on the host plant species and viral co-infection. This study shows that a model cereal plant, Brachypodium distachyon, is a suitable host plant for examining tripartite interactions with BYDV-PAV and CYDV-RPS. We reveal that BYDV-PAV has a different effect on the host selection behavior of its insect vector depending on the host plant species. Viruliferous aphids significantly prefer non-infected plants to virus-infected wheat plants, whereas viral infection on a novel host plant, B. distachyon, is not implicated in the attraction of either viruliferous or nonviruliferous aphids. Furthermore, our findings show that multiple virus infections of wheat with BYDV-PAV and CYDV-RPS alter the preference of their vector aphid. This result indicates that BYDV-PAV acquisition alters the insect vector’s host selection, thereby varying the spread of multiple viruses.

ЗАХВОРЮВАНІСТЬ ТА ПОШИРЕННЯ ВІРУСІВ ЗЛАКОВИХ КУЛЬТУР У 2020–2021 РОКАХ В УКРАЇНІ

Cereals play a significant role in the Ukrainian economy and agriculture. Viral diseases can cause a serious reduction in yields. Aim. The aim of the work was to identify and determine the spread of grain viruses in the main cereal-growing regions of Ukraine in the period 2020–2021 using different methods of virus detection. Methods. Enzyme-linked immunosorbent assay was used to identify viruses using commercial test systems by for wheat streak mosaic virus (WSMV), barley stripe mosaic virus (BSMV), brome mosaic virus (BMV), wheat dwarf virus (WDV), High Plainswheat mosaic virus (HPWMoV), barley yellow dwarf virus-PAV (BYDV-PAV), barley yellow dwarf virus-MAV (BYDV-MAV), andcereal yellow dwarf virus-RPV (CYDV-RPV). Transmission electron microscopy was used for direct virus detection. Reverse transcription polymerase chain reaction was performed to identify viruses by molecular methods. Results. Summarizing the results obtained by different methods, we can say about the circulation of WSMV, HPWMoV, BSMV, BYDV-PAV, and BYDV-MAV in the Ukrainian agrocoenoses in 2020–2021. Significant prevalence and the dominant role of WSMV have been shown, with the degree of damage to symptomatic plants reaching 52 %. The spread of HPWMoV in Kyiv and Poltava regions has been established, although previously the virus was detected only in the eastern part of our country. WSMV was more likely to induce monoinfection (70 %). Conclusions. During the testing of symptomatic plants in the agrocenoses of Ukraine in 2020–2021 the most common were WSMV and HPWMoV (52 % and 19 %, respectively), also found BYDV-PAV in winter wheat and BYDV-MAV in oats.

Survey for Legume and Cereal Viruses in Libya

Abukraa, H., S.G. Kumari and F. Bshia. 2022. Survey for Legume and Cereal Viruses in Libya. Arab Journal of Plant Protection, 40(3): 222-230. https://doi.org/10.22268/AJPP-40.3.222230 A field survey was conducted during March and April 2010, to identify viral diseases affecting cereal and legume crops in different regions of Libya. A total of 3706 barley and wheat samples were collected randomly in addition to 187 symptomatic samples from 22 barley and 20 wheat fields. Moreover, 34 symptomatic legume samples were collected from two faba bean fields and one field each of of lentil, chickpea, Vicia sativa, Vicia ervillia and Vicia narbonesis. All samples were tested at ICARDA Virology Laboratory by tissue blot immunoassay (TBIA) using specific antibodies. Results of random cereal samples showed that Barley yellow dwarf virus-PAV (BYDVPAV) was more common (12.6%) in wheat and barley samples, followed by Wheat dwarf virus (WDV) (1.1%). In symptomatic samples, BYDV-PAV was also the most common (45 out of 187 samples tested were infected: 45/187), followed by WDV (23/187), Barley yellow striate mosaic virus (BYSMV) (40/187) and Maize streak virus (MSV) (7/187). In legume fields, Soybean dwarf virus (SbDV) 13 out of 34 samples tested were infected (13/34) was the most common, followed by Bean leafroll virus (BLRV) (12/34), Chickpea chlorotic stunt virus (CpCSV) (5/34) and Beet western yellows virus (BWYV) (4/34). Serological results were confirmed by amplification with polymerase chain reaction (PCR) using specific primers. This is the first report of WDV, MSV and BYSMV on cereal crops, and BLRV, BWYV, SbDV and CpCSV on legume crops in Libya. Keywords: Libya, Cereals, Legumes, Viruses, TBIA, PCR

Reservoirs of plant virus disease: Occurrence of wheat dwarf virus and barley/cereal yellow dwarf viruses in Sweden

AbstractNon‐crop plants such as grasses and volunteer plants are an inseparable part of the flora of crop fields and can influence virus incidence in crop plants. The presence of grasses as virus reservoirs can lead to a higher probability of virus incidence in crop plants. However, the role of reservoirs as an inoculum source in agricultural fields has not been well studied for many viral diseases of crops. Grasses have been found to constitute potential reservoirs for cereal‐infecting viruses in different parts of the world. This study revealed that cereal‐infecting viruses such as wheat dwarf virus (WDV), barley yellow dwarf viruses (BYDVs), and cereal yellow dwarf virus‐RPV (CYDV‐RPV) can be found among ryegrass growing in or around winter wheat fields. Phylogenetic analysis showed that a WDV isolate from ryegrass was a typical WDV‐E isolate that infects wheat. Similarly, a ryegrass isolate of barley yellow dwarf virus‐PAV (BYDV‐PAV) grouped in a clade together with other BYDV‐PAV isolates. Inoculation experiments under greenhouse conditions confirmed that annual ryegrass of various genotypes can be infected with WDV to a very low titre. Moreover, leafhoppers were able to acquire WDV from infected ryegrass plants, despite the low titre, and transmit the virus to wheat, resulting in symptoms. Information from the grass reservoir may contribute to improving strategies for controlling plant virus outbreaks in the field. Knowledge of the likely levels of virus in potential reservoir plants can be used to inform decisions on insect vector control strategies and may help to prevent virus disease outbreaks in the future.

A Survey Using High-Throughput Sequencing Suggests That the Diversity of Cereal and Barley Yellow Dwarf Viruses Is Underestimated.

Worldwide, barley/cereal yellow dwarf viruses (YDVs) are the most widespread and damaging group of cereal viruses. In this study, we applied high-throughput sequencing technologies (HTS) to perform a virus survey on symptomatic plants from 47 cereal fields in Estonia. HTS allowed the assembly of complete genome sequences for 22 isolates of cereal yellow dwarf virus RPS, barley yellow dwarf virus GAV, barley yellow dwarf virus PAS (BYDV-PAS), barley yellow dwarf virus PAV (BYDV-PAV), and barley yellow dwarf virus OYV (BYDV-OYV). We also assembled a near-complete genome of the putative novel species BYDV-OYV from Swedish samples of meadow fescue. Previously, partial sequencing of the central part of the coat protein gene indicated that BYDV-OYV represented a putative new species closely related to BYDV-PAV-CN, which currently is recognized as a subtype of BYDV-PAV. The present study found that whereas the 3′gene block of BYDV-OYV shares the closest relationship with BYDV-PAV-CN, the 5′gene block of BYDV-OYV shows the closest relationships to that of BYDV-PAS. Recombination detection analysis revealed that BYDV-OYV is a parental virus for both. Analysis of complete genome sequence data indicates that both BYDV-OYV and BYDV-PAV-CN meet the species criteria of genus Luteovirus. The study discusses BYDV phylogeny, and through a systematic in silico analysis of published primers for YDV detection, the existing gaps in current diagnostic practices for detection of YDVs, proposing primer pairs based on the most recent genomic information for the detection of different BYDV species. Thanks to the rising number of sequences available in databases, continuous updating of diagnostic primers can improve test specificity, e.g., inclusivity and exclusivity at species levels. This is needed to properly survey the geographical and host distribution of the different species of the YDV complex and their prevalence in cereal/barley yellow dwarf disease epidemics.

Luteoviruses affected energy reserves and fatty acid composition of their aphid vectors

AbstractLuteoviruses are plant‐infecting RNA viruses that are transmitted by aphids in a persistent circulative mode. Luteoviruses have been shown to positively influence their aphid vectors fitness. To find out the physiological responses of aphid vectors to luteoviruses, fatty acid (FA) composition and energy components (EC) of aphid vectors including pea aphid (Acyrthosiphon pisum Harris), black bean aphid (Aphis fabae Scopoli) and bird cherry‐oat aphid (Rhopalosiphum padi L.) were evaluated in response to Pea enation mosaic virus 1 (PEMV1), Bean leafroll virus (BLRV) and Barley yellow dwarf virus‐PAV (BYDV‐PAV), respectively. Our results showed that the number and the proportion of FA of total lipid are altered in aphid vectors in response to the luteoviruses. Compared to non‐viruliferous (NV) aphids, BLRV and PEMV1 elevated the amount of myristic acid (1.13 and 1.03‐fold increase) in A. fabae and A. pisum, respectively. V R. padi individuals exhibited a 1.11‐fold increase in palmitic acid content compared to the NV individuals. In contrast, other V aphids showed a reduced proportion of FA in response to the viruses. These changes in FA profile enhanced the ratio of saturated to unsaturated FA in V aphids (4.09‐fold increase). BLRV decreased protein and lipid contents in its aphid vector, A. fabae, while carbohydrate content was found to increase in V R. padi and A. pisum. Thus, our results demonstrate that luteoviruses change the content of some FA and EC in their aphid vectors highlighting a specific interaction among virus species, plant host and aphid vector.

Yield Losses Caused by Barley Yellow Dwarf Virus-PAV Infection in Wheat and Barley: A Three-Year Field Study in South-Eastern Australia.

Barley yellow dwarf virus (BYDV) is transmitted by aphids and significantly reduces the yield and quality of cereals worldwide. Four experiments investigating the effects of barley yellow dwarf virus-PAV (BYDV-PAV) infection on either wheat or barley were conducted over three years (2015, 2017, and 2018) under typical field conditions in South-Eastern Australia. Plants inoculated with BYDV-PAV using viruliferous aphids (Rhopalosiphum padi) were harvested at maturity then grain yield and yield components were measured. Compared to the non-inoculated control, virus infection severely reduced grain yield by up to 84% (1358 kg/ha) in wheat and 64% (1456 kg/ha) in barley. The yield component most affected by virus infection was grain number, which accounted for a large proportion of the yield loss. There were no significant differences between early (seedling stage) and later (early-tillering stage) infection for any of the parameters measured (plant height, biomass, yield, grain number, 1000-grain weight or grain size) for either wheat or barley. Additionally, this study provides an estimated yield loss value, or impact factor, of 0.91% (72 kg/ha) for each one percent increase in natural BYDV-PAV background infection. Yield losses varied considerably between experiments, demonstrating the important role of cultivar and environmental factors in BYDV epidemiology and highlighting the importance of conducting these experiments under varying conditions for specific cultivar–vector–virus combinations.

Pliant pathogens: Estimating viral spread when confronted with new vector, host, and environmental conditions.

Pathogen spread rates are determined, in part, by the performance of pathogens under altered environmental conditions and their ability to persist while switching among hosts and vectors.To determine the effects of new conditions (host, vector, and nutrient) on pathogen spread rate, we introduced a vector‐borne viral plant pathogen, Barley Yellow Dwarf Virus PAV (BYDV‐PAV) into hosts, vectors, and host nutrient supplies that it had not encountered for thousands of viral generations. We quantified pathogen prevalence over the course of two serial inoculations under the new conditions. Using individual‐level transmission rates from this experiment, we parameterized a dynamical model of disease spread and projected spread across host populations through a growing season.A change in nutrient conditions (increased supply of phosphorus) reduced viral transmission whereas shifting to a new vector or host species had no effect on infection prevalence. However, the reduction in the new nutrient environment was only temporary; infection prevalence recovered after the second inoculation. Synthesis. These results highlight how robust the pathogen, BYDV‐PAV, is to changes in its biotic and abiotic environment. Our study also highlights the need to quantify longitudinal infection information beyond snapshot assessments to project disease risk for pathogens in new environments.

Host-targeted salt stress affects fitness and vector performance of bird cherry-oat aphid (Rhopalosiphum padi L.) on wheat

Salinity is becoming a limiting factor for crop production, particularly in arid and semiarid areas all around the world. This phenomenon can adversely affect both plant integrity and herbivorous insects. Herein, we assessed the bottom-up effects of four salinity levels (3.1 [control], 6.0, 10 and 12.0 dS/m) on the life parameters of viruliferous bird cherry-oat aphid (Rhopalosiphum padi L.) and the aphid transmission of Barley yellow dwarf virus-PAV (BYDV-PAV) to wheat host. The results revealed that nymph longevity and adult pre-oviposition period of the aphids fed on salinity-stressed plants were significantly increased, while adult longevity, gross reproductive rate, net reproductive rate, intrinsic rate of increase and finite rate of increase of the aphids on plants challenged with salinity levels of 10 and 12.0 dS/m were significantly reduced. Also, survival rate and life expectancy of viruliferous R. padi remarkably decreased on wheat plants under 10 and 12.0 dS/m salinity. The R. padi-mediated transmission of BYDV-PAV to salinity-stressed (10 and 12.0 dS/m) wheat plants was significantly reduced. Moreover, the biochemical assays showed a significant increase in biosynthesis of phenolics and free proline within wheat plants challenged with salinity stress. Based on these findings, it can be concluded that salinity stress negatively influences life parameters of viruliferous R. padi, possibly through induction of phenolics and free proline within the salinity-stressed plants, and the aphid transmission of BYDV-PAV to wheat host.

Molecular diversity of barley yellow dwarf virus-PAV from China and the Czech Republic

Wheat yellow dwarf disease (BYD), caused by different species of barley/cereal yellow dwarf viruses (B/CYDVs), is one of the most serious cereal diseases in China and the Czech Republic. Because genetic diversity of the virus directly influences disease epidemiology, the molecular diversity and population structure of 24 Chinese isolates and 16 the Czech Republic isolates of BYDV-PAV from different regions in two countries were analyzed by sequencing their coat protein (CP) and readthrough protein (RTP) domain (RTD) genes and comparing the sequences with six CP and 16 RTP sequences of BYDV-PAV isolates from the NCBI database based on nucleotide identity position, phylogenetic analysis and nucleotide diversity. Nucleotide identities between the Chinese and the Czech Republic isolates for the CP were 76.6–99.4%, 73.9–89.1% for RTD (ORF5), respectively. The Chinese and the other country isolates showed 74.7–99.2% nucleotide identity for RTP (ORF3+ORF5). Phylogenetic analysis of CP sequences showed that 20 Chinese isolates clustered in the same clade, but the other four Chinese isolates clustered in another clade with the isolates from the Czech Republic and other counties. The population of BYDV-PAV in China had greater nucleotide variability and was more divergent than that in the Czech Republic. Geographical and ecological factors but not hosts might contribute to the population differences in the two countries.

Barley yellow dwarf virus-PAV is the dominant species causing Barley yellow dwarf disease in South Dakota and Minnesota

Barley yellow dwarf (BYD), caused by ten different species of viruses from the Luteoviridae family, is an economically important viral disease of small grains in the US Northern Great Plains. Identification of virus species in the region associated with BYD is critical to deployment of specific effective resistance genes. However, a comprehensive survey of virus species using modern diagnostic tools has not been done before in the US Northern Great Plains. In this study, species composition of viruses associated with BYD in small grains of Minnesota and South Dakota were determined by sampling BYD infected tissue from a large geographical area over three years. Whole genomic RNA was extracted from leaf tissue and reverse transcription polymerase chain reaction (RT-PCR) was conducted to detect infection of BYD and classify into species using primers from a two-step multiplex PCR protocol. Out of 463 samples collected from Minnesota and South Dakota from 2013 to 2015, about 50% (n = 222) of the samples tested positive for BYD. The majority of virus infected samples (n = 146) were identified as the Barley yellow dwarf virus PAV. These results indicate that the RT-PCR protocol used in this study is a viable molecular diagnostic tool for detection of BYD causing viruses in field collected samples. Moreover, the results indicate that Barley yellow dwarf virus PAV is most the dominant species associated with BYD in the US Northern Great Plains. Due to the species-specific nature of resistance to BYD these results can also guide breeding strategies in small grains for BYD management.

The Evaluation of Wheat Cultivar Resistance and Yield Loss Thresholds in Response to Barley Yellow Dwarf Virus-PAV Infection

The PAV strain of barley yellow dwarf virus (BYDV) is one of the causal agents of yellow dwarf disease in cereals. The use of germplasm resistant to BYDV is generally regarded as the most effective means of controlling damage caused by this pathogen. In field trials, response to infection with a barley yellow dwarf virus of selected wheat cultivars registered in the Czech Republic was compared with that of control cultivars. Although a good level of resistance to BYDV-PAV was found in cultivar Athlon and yield loss was low, symptoms were more severe than on the moderately resistant control cultivar Sparta. Several other cultivars, such as Nordika, Julie, and Replik, also had slightly less than a 30% reduction in grain weight per spike, even though symptoms were more severe on Sparta or Athlon. Our results showed that, in the case of approximately 60% of wheat plants with BYDV-PAV symptoms, the yield reductions under optimal agronomic conditions reached approximately 17% for moderately resistant cultivars and 30% for moderately susceptible cultivars. The application of N fertilizer significantly reduced yield losses in BYDV-PAV-infected wheat cultivars, particularly in the moderately resistant cultivars. Even when infected with BYDV-PAV, the yield of moderately resistant cultivars, including those of spring wheat, was still acceptable. However, the re-cultivation costs of spring wheat in replacing damaged winter wheat lead to a total economic loss per hectare that is much greater than that for BYDV-infected wheat cultivars (moderately resistant and/or moderately susceptible ones). Furthermore, the economic loss is much lower when a moderately resistant cultivar is used. Hence, even with a high level of disease symptoms in winter wheat, the re-cultivation of spring wheat is not economically feasible.