Badh2 Gene Research Articles

Identification of Drought Tolerant and Molecular Analysis of DREB2A and BADH2 Genes and Yield Potensial of Lines from Single Crossing Bengkulu Local Rice Varieties

Screening in the seedling stage of 39 progeny of F6 lines to drought stress was carried out in the greenhouse. Drought tolerant and sensitive varieties of IR 20 and Salumpikit, respectively, were used as control plants. The methods for traits identification of leaf curled, dried, and recovery ability after exposure to severe drought for two weeks was following the Standard Evaluation System (SES) developed by IRRI. Molecular analysis to detect the presence of the DREB2A gene was carried out by PCR amplification of genomic DNA using forward- and reverse- oligonucleotide primers of CCTCATTGGGTCAGGAAGAA and GGATCTCAGCCACCCACTTA, respectively, while for BADH2 gene using forward- and reverse- oligonucleotide primers of GGCCAAGTACCTCAAGGCGA and TGTCCCCAGCTGCTTCATCC, respectively. Molecular markers of DREB2A and BADH2 genes were also identified in 39 tested lines with approximately 250 and 2300 bp length, respectively. This study concluded that the progeny of F6 lines generating from the crossing of local varieties of IR7858 and IR148 is the potential to become a drought-tolerant variety of upland rice. Line numbers BKL2 B-2-264-6 and BKL4 B-1-268-10 have a potential yield of more than 12 tonnes/ha. These line has the potential to be developed on rainfed lowland rice or dry land because it has drought resistance.

Developing KASP Markers for Identification of Basmati Rice Varieties

Authentication of Basmati rice has relied on microsatellite markers since 2004, but microsatellites cannot distinguish between all of the forty-one Basmati varieties approved in 2017. This study investigated whether single nucleotide polymorphisms (SNP) and insertion/deletion (InDel) variations developed into KASP™ (Kompetitive Allele Specific PCR; LGC Biosearch Technologies) could be used to distinguish between commercial Basmati varieties. Suitable loci were identified by comparing whole genome sequences of 120 diverse rice accessions. Sequences flanking these loci were standardized across a wide range of rice genomes to produce optimal KASP designs. We selected 364 KASP designs to use for genotyping; they were either near to informative microsatellite markers, within the Badh2 and Waxy genes, or distributed throughout the rice genome. Genotypes for 327 KASP were obtained with 255 loci revealing polymorphism in up to 41 samples of approved Basmati varieties and 20 non-Basmati varieties. The varieties genotyped had not been used in the KASP design process. KASP were able to distinguish between commercial Basmati varieties that could not be distinguished with currently available microsatellites. Thirty-seven Basmati varieties could be distinguished from all others with between 3 and 8 KASP markers out of a pool of 98 informative markers. A reduced set of 24 KASP markers could determine whether a sample belongs to one of eight family groups. All of the KASP markers used in this study can be purchased from LGC Biosearch Technologies. These markers have potential to be used by industry for routine testing and regulation.

Allelic variations in aroma gene in cultivated rice varieties

Germplasm is a valuable source of genetic diversity that supports crop improvement efforts in any breeding programme but it must first be fully characterised for economically valuable traits before it can be effectively utilised. In rice (Oryza sativa), the development of new varieties with improved aroma requires correct phenotyping and prior knowledge of the available genes and alleles governing the aroma trait in the gene pool. Correct phenotyping and genotyping can be achieved using sensory methods and functional markers associated with polymorphisms that define the aroma genes. The objective of this study was to evaluate the aroma status of rice accessions and to assess for the various alleles of badh2 gene using functional markers. A total of 56 rice accessions were evaluated at National Crops Resources Research Institute (NaCRRI) in Uganda for their aroma using sensory methods and a molecular marker to differentiate between aromatic and non- aromatic accessions. The aromatic accessions were then evaluated for variations within the betaine aldehyde dehydrogenase2 (badh2) gene responsible for aroma in rice using functional markers. Sensory evaluation of aroma identified 23 accessions to be aromatic; while 33 were non-aromatic. Molecular results identified 20 accessions as aromatic; while 36 accessions were non-aromatic. Functional marker analysis indicated the presence of badh2-E7 allele in 20 aromatic accessions within this collection that could be employed in the breeding programme for the rice aromatic trait.
 Key words: badh2 alleles, functional markers, Oryza sativa

Characterization of Haplotype Diversity in the BADH2 Aroma Gene and Development of a KASP SNP Assay for Predicting Aroma in U.S. Rice

BackgroundAroma is an important grain quality trait in rice, controlled by mutations within the BADH2 gene. The trait is simply inherited, and its importance in variety development makes it a practical target for marker-assisted selection in applied breeding programs. The predominant functional mutation within BADH2, an 8-bp indel, can be reliably detected using a PCR-based assay, but the available assays and associated genotyping platforms are insufficient for large-scale applied molecular breeding applications and are not compatible with outsourcing genotyping services.ResultsWe first characterized SNP diversity across the BADH2 gene in a collection of 2932 rice varieties to determine the number of gene haplotypes in O. sativa. Using 297 gene-based SNPs, 11 haplotype groups were detected, and subsequently identified a minimal set of nine informative SNPs that uniquely identified the BADH2 haplotypes. These nine SNPs were developed into KASP assays and used to examine a panel of 369 U.S. rice accessions. The panel represented modern breeding germplasm and included all known aroma pedigree sources in U.S. rice. Six haplotypes were detected within the U.S. panel, of which two were found in majority (85%) of varieties. A representative set of 39 varieties from all haplotype groups was evaluated phenotypically to distinguish aromatic from non-aromatic lines.ConclusionOne haplotype (Hap 6) was found to be perfectly associated with the aromatic phenotype. A single KASP SNP unique to Hap 6 was demonstrated to reliably differentiate aromatic from non-aromatic rice varieties across U.S. germplasm.

Grain Quality and Allelic Variation of the Badh2 Gene in Thai Fragrant Rice Landraces

Fragrance, which plays an important role in determining the economic value of rice to growers and consumers, is known to be controlled by the Badh2 gene. This study evaluated the grain quality characteristics and allelic variation of the Badh2 gene in 22 fragrant rice landraces from Thailand. The rice seed samples from farmers’ storage facilities in northern, northeastern and southern Thailand, plus two advanced breeding lines and three check varieties, were evaluated for seed morphology and grain quality, and their Badh2 genes covering intron 4 to intron 8 were re-sequenced. Almost all of the landraces were classified as large grain types, with medium to high gelatinization temperatures. The variation in the Badh2 gene by haplotype analysis correlated with grain aroma by sensory evaluation. The badh2-E7 was found in haplotype 1 with a strong aroma in KH, NDLP, and PLD, as in KDML105 and the moderately aromatic BNM-CMU, BNM4, and SKH, along with PTT1. Three haplotypes had different positions of SNP on the Badh2 gene with varying results in the sensory test. The present results suggest that some rice varieties could be potentially introduced as genetic resources for fragrant rice breeding programs or could be developed to highly palatable cultivars with geographical indications to increase the income of highland farmers.

Development and application of two novel functional molecular markers of BADH2 in rice

Fragrance is one of the most important quality traits in rice, and the phenotype is attributed to the loss-of-function betaine aldehyde dehydrogenase ( BADH2 ) gene. At least 12 allelic variations of BADH2 have been identified, and some of these have been applied to rice fragrance breeding using traditional molecular markers and Sanger sequencing techniques. However, these traditional methods have several limitations, such as being very expensive, imprecise, inefficient, and having security issues. Thus, a new molecular marker technology must be developed to improve rice fragrance breeding. In this study, more than 95% of the cultivated fragrant rice varieties belonged to a 7-bp deletion in exon 2 ( badh2-E2 ) or an 8-bp deletion and 3-bp variation in exon 7 ( badh2-E7 ). Both allelic variations resulted in the loss of function of the badh2 gene. We developed two novel SNP molecular markers, SNP_badh2-E2 and SNP_badh2-E7, related to the alleles. Their genotype and phenotype were highly cosegregated in the natural variation of rice accessions, with 160 of the 164 fragrant rice varieties detected with the two markers. These markers cosegregated with the fragrance phenotype in the F 2 population. Two functional SNP molecular markers of badh2-E2 and badh2-E7 allelic variations were developed. These functional SNP molecular markers can be used for genotype and genetic improvement of rice fragrance through marker-assisted selection and will significantly improve the efficiency of fragrant rice breeding and promote commercial molecular breeding of rice in the future. How to cite: Li W, Zeng X, Li S, et al. Development and application of two novel functional molecular markers of BADH2 in rice. Electron J Biotechnol 2020;46. https://doi.org/10.1016/j.ejbt.2020.04.004 .

RNAi-mediated down regulation of BADH2 gene for expression of 2-acetyl-1-pyrroline in non-scented indica rice IR-64 (Oryza sativa L.).

2-acetyl-1-pyrroline (2AP) is a principal aroma compound in scented rice and a mutation in betaine aldehyde dehydrogenase 2 (OsBADH2) is responsible aroma in scented rice. The present study was aimed at inducing 2AP production in non-scented indica rice cultivar IR-64 by silencing OsBADH2 via RNAi technique. A vector pBSK was used for the construction of RNAi cassette and pRI101ON as a binary vector. Agrobacterium (GV3101)-mediated transformation was done using embryogenic calli of IR-64. The resultant transgenic lines showed up to 14-fold reduction in expression of OsBADH2 gene and 50% inhibition in enzyme activity. Gas chromatography (GC-MS) analyses showed a significant amount of 2AP production in RNAi callus, leaves, and seeds of IR-64. A total 39 volatile compounds were identified from the control and RNAi seeds of IR-64. Among them, octanal and 2-pentylfuron were found to be increased (30-40%) in RNAi seeds of IR-64. The content of precursors, proline, and methylglyoxal increased substantially, whereas GABA content reduced up to 25% in transgenic IR-64 lines. The study demonstrated that RNAi approach could be successfully used for imparting pleasant aroma character in non-scented indica rice cultivars.

In silico analysis of the fragrance gene (badh2) in Asian rice (Oryza sativa L.) germplasm and validation of allele specific markers

AbstractBadh2 of rice is considered to be the major gene responsible for the fragrance in rice. The wild type badh2 allele encodes betaine aldehyde dehydrogenase 2 (BADH2) enzyme while the mutated version of badh2 gene encodes non-functional BADH2 enzyme that leads to the accumulation of 2-acetyl-1-pyrroline (2AP), the principal fragrant compound in rice. There are many mutated recessive alleles causing fragrance in global rice germplasm, although the badh2.1 allele present in Basmati type rice is the most well-known among breeders. In this study, we attempted to reveal potential fragrance causing mutations, and the respective varieties carrying them, through in silico analysis based on the sequences available in the Rice SNP-Seek-Database of International Rice Research Institute. The sequences of 1878 rice accessions from 22 countries were analysed to identify mutations in each exon of badh2 comparatively with the non-fragrant ‘wildtype’ GenBank sequence in Nanjing11, Oryza sativa indica (EU770319.1). Results revealed that 63 varieties from 12 countries possessed the most prevalent allele, badh2.1 having an 8 bp deletion and three single nucleotide polymorphisms in the 7th exon. The second most prevalent allele in genotypes from Asia was badh2.7 having a ‘G’ insertion in the 14th exon. A novel allele with a T deletion in 9th exon was detected in a Thai rice accession. Rice varieties containing either badh2.1 or badh2.7 alleles could be identified with DNA markers for badh2.1 (frg) and badh2.7 (Bad2.7CAPS). The marker, Bad2.7CAPS, co-segregated with the fragrance phenotype in two crosses, confirming the possibility of employing it in marker assisted breeding.

Genotyping for Blast (Pyricularia oryzae) Resistance Genes in F2 Population of Supa Aromatic Rice (Oryza sativa L.).

The ascomycete fungus, Pyricularia oryzae or Magnaporthe oryzae, is known to cause blast disease in more than 80 host plants of the Gramineae family—cereals including rice and grasses. The improvement of the Supa234 rice line (IR97012-27-3-1-1-B, containing badh2 gene for aroma) developed at IRRI-ESA Burundi consisted of introgression of R genes (Pita and Pi9) for blast resistance. The F2 population obtained via the cross had been screened for blast resistance using inoculation with Pyricularia oryzae spore's suspension. The objectives of this study were to assess the presence of Pita and Pi9 genes for blast resistance and to assess the presence of the badh2 gene for aroma in the screened F2 plants using molecular markers. Genotyping was carried out in 103 F2 plants which grew to maturity using the KASP genotyping method with SNP markers (snpOS0007, snpOS0006, and snpOS0022) targeting the Pita and Pi9 genes for blast resistance and the badh2 gene for aromatic fragrance. The genotyping results showed that 38 F2 plants had the Pita gene present in both alleles, 31 F2 plants with the Pita gene in one allele, and only one plant (3B1) was found with the Pi9 gene in one allele. The badh2 gene for aroma was detected in 27 F2 plants on both alleles and in 57 F2 plants on one allele. There were thirteen plants which had both the Pita gene and the badh2 gene for aroma, and only one plant (3B1) had a combination of the three genes (Pita, Pi9, and badh2). Seven plants resistant to blast disease (2H2, 2H4, 1G2, 1C12, 1E13, 1B12, and 1C5) with the Pita and badh2 genes were found, and only one resistant plant (3B1) had a combination of the three genes Pi9, Pita, and badh2 which is recommended to be bulked for the development of the Supa aromatic rice variety resistant to blast disease. The plants generated by the best line 3B1 should further be evaluated for grain quality (Supa type) after F5 generation in the field.

Screening of traditional scented rice (Joha) of Assam for presence of Badh2, blast and brown spot diseases

The traditional scented rice (Joha) varieties are very popular among the people of Assam. The traditional scented rice though carries a premium price throughout the world, is a low yielder. However, the traditional Joha varieties are tolerant to many disease and pest, indicating the joha germplasm may be a source for several disease/pest resistant genes. However not much work has been carried out to identify the factors responsible for disease/pest tolerance in these lines. Hence, an attempt was made in 39 Joha germplasms to identify blast and brown spot resistant/tolerant germplasms at Regional Agricultural Research Station, Assam Agricultural University, Titabar. In most of the aromatic lines the aroma is due to the function of the Badh2 gene. Therefore, an attempt was made to study the action of Badh2 gene in these germplasms with the help of SNP analysis. The present study reveals the associated between Badh2 gene fragrance in most of the Joha germplasms. However in some aromatic Joha germplasms the fragrance is not correlated with the action of Badh2, and it may be due to some other factors. This finding needs further studies to identify the factors contributing to the fragrance in Joha rice.

Isolation and Molecular Marker Detection of Badh2 Gene from Aromatic Rice Germplasm Resources in Southern Henan

The production of aroma in aromatic rice is due to the increase of 2-acetyl-1-pyrroline (2-AP) precursor substances caused by the functional deletion of Badh2 gene on chromosome 8, and the accumulation of 2AP makes rice produce aroma. In this study, Badh2 gene was isolated and cloned from 18 representative aromatic rice cultivars in Southern Henan, and the bioinformatics analysis of Badh2 gene was carried out. Meanwhile, seven functional molecular markers developed by Badh2 gene were used to detect and analyze Badh2 gene in 18 aromatic rice varieties from Southern Henan. The results showed that the coding region of Badh2 gene was 1509 bp in length. It contained 15 exons and 14 introns, and encoded 503 amino acids. There are many types of variation of the Badh2 gene in the 18 aromatic rice varieties. According to the variation of Badh2 gene, the tested aromatic rice varieties could be divided into three groups, among which Xinxianggeng 1, Xiangnuo 25, Heixiangdao 193 and Xiangbao 2 were concentrated in group Ⅰ, while the other 14 kinds of aromatic rice were concentrated in group II. Seven functional molecular markers of Badh2 gene were used to detect different varieties mutation types in exon 2, exon 4~5, exon 7 and exon 13 of Badh2 gene. No aromatic rice varieties with different mutation types were found in promoter region, exon 12 and exon 14 of Badh2 gene. Therefore, our results provide important information for understanding the genetic basis of fragrant genes in aromatic rice germplasm resources in Southern Henan and breeding new varieties of high-quality aromatic rice using molecular marker-assisted selection.

Sequence polymorphism in the 7th exon of Badh2 gene in short grain aromatic bengal land races of rice (Oryza sativa L.)

Aroma in rice is associated with increased level of 2-acetyl-1-pyrroline (2AP) controlled by a recessive gene (fgr) located on chromosome 8 encoding betaine aldehyde dehydrogenase 2 (BADH2). An eight bp deletion and three single nucleotide polymorphisms (SNPs) in badh2 gene presumably disable the BADH2 enzyme which results in accumulation of the fragrant compound, 2-acetyl-1-pyrroline (2AP) in fragrant rice. The present study was undertaken to analyze allelic variation of the 7th exon of badh2 gene in four short grain aromatic land races of Bengal (Gobindobhog, Radhunipagal, Khaskani and Tulaipanji). A ∼580 bp DNA fragment was amplified covering 7th exon region and sequenced. Partial gene sequence of all aromatic rice revealed one 8 bp deletion and three SNPs in exon 7 of fgr gene. However, an additional 4 bp deletion just upstream to the 8 bp deletion regions was observed in Gobindobhog, most popular aromatic land race of Bengal.

Whole genome sequencing of Oryza sativa L. cv. Seeragasamba identifies a new fragrance allele in rice.

Fragrance of rice is an important trait that confers a large economic benefit to the farmers who cultivate aromatic rice varieties. Several aromatic rice varieties have limited geographic distribution, and are endowed with variety-specific unique fragrances. BADH2 was identified as a fragrance gene in 2005, and it is essential to identify the fragrance alleles from diverse geographical locations and genetic backgrounds. Seeragasamba is a short-grain aromatic rice variety of the indica type, which is cultivated in a limited area in India. Whole genome sequencing of this variety identified a new badh2 allele (badh2-p) with an 8 bp insertion in the promoter region of the BADH2 gene. When the whole genome sequences of 76 aromatic varieties in the 3000 rice genome project were analyzed, the badh2-p allele was present in 13 varieties (approximately 17%) of both indica and japonica types. In addition, the badh2-p allele was present in 17 varieties that already had the loss-of-function allele, badh2-E7. Taken together, the frequency of badh2-p allele (approximately 40%) was found to be greater than that of the badh2-E7 allele (approximately 34%) among the aromatic rice varieties. Therefore, it is suggested to include badh2-p as a predominant allele when screening for fragrance alleles in aromatic rice varieties.

Haplotype variation of Badh2 gene, unearthing of a new fragrance allele and marker development for non-basmati fragrant rice ‘Velchi’ (Oryza sativa L.)

In the present study, selected indica rice accessions (basmati, non-basmati fragrant, and non-fragrant) were screened for mutations in betaine aldehyde dehydrogenase 2 (badh2) gene to investigate the allelic differences using previously reported functional markers. This screening experiment revealed that non-basmati fragrant accession ‘Velchi’ does not harbour any reported mutation in coding region of badh2. While working with badh2-p-UTR marker we got deviating results. All the non-basmati fragrant and basmati types gave amplicon of 203bp except Velchi, whereas all non-fragrant and ‘Velchi’ gave 456 and 461bp amplicons respectively. The new allele has 253bp deletion in the promoter region of fragrant indica rice accessions compared to non-fragrant rice. Further, the fragrant accession ‘Velchi’ has additional 5bp duplication as compared to non-fragrant accessions. To distinguish Velchi from other non-fragrant indica accessions, a new marker (velbadh2-p-UTR) has been designed to identify this 5bp difference, which could distinguish ‘Velchi’ from non-fragrant rice accessions and can be useful in breeding for development of fragrant rice varieties via marker-assisted selection. The 2AP biosynthesis related metabolites, gene expression and enzyme assay confirmed deletion in badh2 and expression of fragrance in Velchi.

Whole Genome Sequencing Reveals the Islands of Novel Polymorphisms in Two Native Aromatic Japonica Rice Landraces from Vietnam.

Elucidation of the rice genome will not only broaden our understanding of genetic characterization of the agronomic characteristics but also facilitate the rice genetic improvement through marker assisted breeding. However, the genome resources of aromatic rice varieties are largely unexploited. Therefore, the whole genome of two elite aromatic traditional japonica rice landraces in North Vietnam, Tam Xoan Bac Ninh (TXBN), and Tam Xoan Hai Hau (TXHH), was sequenced to identify their genome-wide polymorphisms. Overall, we identified over 40,000 novel polymorphisms in each aromatic rice landrace. Although a discontinuous 8-bp deletion and an A/T SNP just upstream the 5-bp deletion in exon 7 of BADH2 gene were present in both rice landraces, the number of SNP high resolution regions of TXBN was six times higher than that of TXHH. Furthermore, several hot spot regions of novel SNPs and indels were found in both genomes, providing their potential gene pools related to aroma formation. The genomic information of two aromatic rice landraces described in this study will facilitate the identification of fragrance-related genes and the genetic improvement of rice.

Isolation and characterization of BADH2 gene from in vitro propagated Pandanus amaryllifolius Roxb

The 2-acetyl-1-pyrroline (2AP) induced ‘basmati rice’ aroma is plausibly the highest among the plant kingdom in Pandanus amaryllifolius Roxb. The defective/truncated allelic forms of betaine aldehyde dehydrogenase (BADH2) gene is the major contributing factor behind the accumulation of this fragrance. The present study reports the isolation and characterization of the full-length BADH2 gene from P. amaryllifolius Roxb. The in silico analysis involving homology modelling and docking studies revealed the deficiency in catalytic efficiency of Pandanus BADH2 towards its substrate γ-aminobutyraldehyde (GAB-ald) as compared to the functional BADH2 gene of rice. We have also studied the tissue-specific expression of the BADH2 gene in different plant parts of in vivo donor and in vitro propagated P. amaryllifolius Roxb. In addition to the leaves, we are reporting histochemical localization of 2AP for the first time in the roots of P. amaryllifolius.

Haplotype distribution and association of candidate genes with salt tolerance in Indian wild rice germplasm.

The association of natural genetic variations of salt-responsive candidate genes belonging to different gene families with salt-tolerance phenotype and their haplotype variation in different geographic regions. Soil salinity covers a large part of the arable land of the world and is a major factor for yield losses in salt-sensitive crops, such as rice. Different gene families that respond to salinity have been identified in rice, but limited success has been achieved in developing salt-tolerant cultivars. Therefore, 21 salt stress-responsive candidate genes belonging to different gene families were re-sequenced to analyse their genetic variation and association with salt tolerance. The average single nucleotide polymorphism (SNP) density was 16 SNPs per kbp amongst these genes. The identified nucleotide and haplotype diversity showed comparatively higher genetic variation in the transporter family genes. Linkage disequilibrium (LD) analysis showed significant associations of SNPs in BADH2, HsfC1B, MIPS1, MIPS2, MYB2, NHX1, NHX2, NHX3, P5CS1, P5CS2, PIP1, SIK1, SOS1, and SOS2 genes with the salt-tolerant phenotype. A combined analysis of SNPs in the 21 candidate genes and eight other HKT transporter genes produced two separate clusters of tolerant genotypes, carrying unique SNPs in the ion transporter and osmoticum-related genes. Haplotype network analysis showed all the major and few minor alleles distributed over distant geographic regions. Minor haplotypes may be recently evolved alleles which migrated to distant geographic regions and may represent recent expansion of Indian wild rice. The analysis of genetic variation in different gene families identified the relationship between adaptive variations and functional significance of the genes. Introgression of the identified alleles from wild relatives may enhance the salt tolerance and consequently rice production in the salinity-affected areas.

An analysis of variation of the aroma gene in rice (Oryza sativa L. subsp. indica Kato) landraces

The candidature of 8-bp deletion in badh2 gene as the predominant cause for aroma development in rice was investigated in 84 subsp. indica rice landraces. Presence of this functional mutation was detected in 80 % of aromatic samples and in three non-aromatic landraces which were found to be heterozygous at this locus. However, 11 landraces did not show its presence despite being aromatic during qualitative assessment. None of the wild ancestors possessed this deletion. Finally, we have discussed implications of our findings in the broader context of aroma evolution.

Identification of the Second Mutation of BADH2 Gene Derived from Rice Mutant Lines Induced by Gamma Rays

The BADH2 gene acts as suppressor of 2-acetyl-1-pyrolline (2AP) biosynthesis in plants. 2AP is the volatile compound which provides fragrance in rice. Biosynthesis of 2AP occurs when BADH2 loses its function as suppressor gene. Aromatic rice cultivars naturally incur mutation of BADH2 gene at 8 bp. In this experiment, aromatic mutant rice lines derived from irradiation of Sintanur cultivar by gamma rays with dose of 100 Gy were studied in molecular level. These mutant lines were characterized at the M 10 plant generation under the assumption that genetically these aromatic mutant rice lines were homozygotic. Several primers related to aroma in rice have been used for polymerase chain reaction (PCR) in a thermal cycler instrument. Gel electrophoreses were carried out using 1.5% agarose in TAE buffer. DNA fragments at 254 bp and 355 bp (base pair) were taken and amplified by primer for nucleotide sequencing of these fragments. Molecular identification and characterization after electrophoresis showed that the mutant line from AR1020 can be differentiated from AR.1080 at 254 bp. Nucleotide sequence data from of these DNA fragments showed that point mutations (deletions and substitutions) occurred at the BADH2 gene in exon 7; those are called second mutation and were caused by gamma rays effects. The Sintanur variety was used as check cultivar and its DNA sequence was compared to that of the AR.1020 mutant line. The results from both DNA sequences (from cv. Sintanur and AR.1020) derived from fragments at 254 bp show that point mutations occurred within exon 7 and earlier stop codon occurred in the AR.1020 mutant rice line. Further, the use of EA primer in PCR resulted in detection of deletion and substitution of nucleotides in the AR.1020 mutant line .

Single base substitution causing the fragrant phenotype and development of a type-specific marker in aromatic coconut (Cocos nucifera).

The fragrance gene, betaine aldehyde dehydrogenase 2 (Badh2), has been well studied in many plant species. The objectives of this study were to clone Badh2 and compare the sequences between aromatic and non-aromatic coconuts. The complete coding region was cloned from cDNA of both aromatic and non-aromatic coconuts. The nucleotide sequences were highly homologous to Badh2 genes of other plants. Badh2 consisted of a 1512-bp open reading frame encoding 503 amino acids. A single nucleotide difference between aromatic and non-aromatic coconuts resulted in the conversion of alanine (non-aromatic) to proline (aromatic) at position 442, which was the substrate binding site of BADH2. The ring side chain of proline could destabilize the structure leading to a non-functional enzyme. Badh2 genomic DNA was cloned from exon 1 to 4, and from exon 5 to 15 from the two coconut types, except for intron 4 that was very long. The intron sequences of the two coconut groups were highly homologous. No differences in Badh2 expression were found among the tissues of aromatic coconut or between aromatic and non-aromatic coconuts. The amino acid sequences of BADH2 from coconut and other plants were compared and the genetic relationship was analyzed using MEGA 7.0. The phylogenetic tree reconstructed by the Bayesian information criterion consisted of two distinct groups of monocots and dicots. Among the monocots, coconut (Cocos nucifera) and oil palm (Elaeis guineensis) were the most closely related species. A marker for coconut differentiation was developed from one-base substitution site and could be successfully used.