Β-glucuronidase Gene Research Articles

Effect of virus inducible cis-element insertion on transcription properties of improved GWSF promoter in Arabidopsis thaliana

An ideal synthetic promoter can accurately regulate gene expression and the minimal cauliflower mosaic virus 35S promoter (GWSF) is an ideal synthetic pathogen-inducible promoter (SPIP) with several advantages. Three modified SPIPs, named as VGWSF, GWVSF, and GWSFV according to the arrangement of cis-elements, were optimized by inserting the dimer of a virus inducible cis-element (TTGGGAAGGAATTTCCTACT, V-box) upstream, midstream, or downstream the GWSF sequence. The three promoters were used to replace the cauliflower mosaic virus 35S promoter in the plasmid pBI121 in order to control the expression of the β-glucuronidase (gus) gene. Transformation of Arabidopsis thaliana (ecotype Col‑0) plants was performed via the Agrobacterium tumefaciens strain GV3101 by the floral dip method. The five-week-old transgenic T3 lines were histochemically stained for GUS activity to evaluate the transcriptional properties of modified SPIPs. The VGWSF and GWVSF had low basal expressions and could not be induced by low or high temperatures and a low osmotic potential but could be induced by the tobacco mosaic virus (TMV). Although GWSFV had the highest GUS activity, it showed a substantial basal expression. After being treated with TMV, abscisic acid (ABA), salicylic acid (SA), or ethylene (Eth) for12 h, the expressions of modified SPIPs were evaluated by real-time quantitative PCR. With the basal expression of GWSF as a reference, each treatment was represented as log2 (fold to the GWSF basal level). The basal expression of VGWSF and expressions induced by TMV, ABA, SA, and Eth were 1.39, 3.42, 6.01, 4.14, and 2.26, respectively, whereas the corresponding values of GWVSF were 1.16, 4.07, 3.72, 4.65, and 3.98, respectively, and the corresponding values of GWSFV were 4.43, 6.11, 4.83, 3.69, and 3.34, respectively. The results revealed that three modified SPIPs acquired virus induction activity due to the insertion of V-box. The V-box insertion position had a significant impact on transcription properties of modified SPIPs.

An efficient system for Agrobacterium-mediated transient transformation in Pinus tabuliformis

BackgroundFunctional genomic studies using genetics approaches of conifers are hampered by the complex and enormous genome, long vegetative growth period, and exertion in genetic transformation. Thus, the research carried out on gene function in Pinus tabuliformis is typically performed by heterologous expression based on the model plant Arabidopsis. However, due to the evolutionary and vast diversification from non-flowering (gymnosperms) to flowering (angiosperms) plants, several key differences may alter the underlying genetic concerns and the analysis of variants. Therefore, it is essential to develop an efficient genetic transformation and gene function identification protocol for P. tabuliformis.ResultsIn the present study we established a highly efficient transgene Agrobacterium-mediated transient expression system for P. tabuliformis. Using a β-glucuronidase gene (GUS) as a reporter gene expression, the highest transformation efficiency (70.1%) was obtained by co-cultivation with Agrobacterium strain GV3101 at an optical density at 600 nm of 0.8, with 150 μM acetosyringone for 30 min followed by 3 days in the dark at 23 ± 1 °C. This protocol would be applied to other conifers; GUS staining was observed 24 h post-infection.ConclusionsWe report a simple, fast, and resilient system for transient Agrobacterium-mediated transformation high-level expression of target genes in P. tabuliformis, which will also improve transformation efficiency in other conifer species.

The Effect of Translation Promoting Site (TPS) on Protein Expression in E. coli Cells.

The study of translation initiation in prokaryotes assumes that there should be a mechanism different from the canonical model, which postulates the formation of the pre-initiation complex through the interaction of the Shine-Dalgarno sequence (SD) at the 5'-end of mRNA and the anti-Shine-Dalgarno site at the 3'-end of 16S rRNA. In this paper we've studied the effect of TPS (Translation-initiation Promoting Site) on β-glucuronidase expression in E. coli cells at different cultivation temperatures. The examined leader sequences were cloned into the pET23c plasmid upstream the β-glucuronidase gene; protein expression was performed in E. coli BL21 (DE3) cells. β-glucuronidase activity was measured in bacterial cell extracts via paranitrophenyl b-D-glucuronide assay. The quantity of expressed protein was measured by Western blotting with following densitometry. It was shown that TPS increases the level of protein expression at stressful conditions (10°C and 44°C) 5-8 times compared to control. The combination of TPS and SD sites in the 5'-leader sequence of the mRNA created an enhancer that increased the expression level 2-3.6 times compared to a single SD-sequence. Based on the obtained data and the computer modeling of interaction between 16S rRNA and TPS, we proposed an alternative variation of prokaryotic translation initiation.

Agrobacterium-mediated transformation of arthroconidia obtained from the edible mushroom Hypsizygus marmoreus

Using the carboxin resistance gene from Pleurotus eryngii as a selective marker, we introduced foreign DNA into the arthroconidia of Hypsizygus marmoreus through Agrobacterium-mediated transformation. The function of the exogenous GUS (β-glucuronidase) gene driven by the CaMV35S promoter was detected in the transformants.

AtPPRT1 negatively regulates salt stress response in Arabidopsis seedlings

ABSTRACTSalt stress is one of the environmental factors that negatively affect plant growth and development. We have previously reported a putative C3HC4 zinc-finger ubiquitin E3 ligase (AtPPRT1) negatively regulates Abscisic acid (ABA) and drought stress response. According to previous studies, the accumulation of ABA in plants can further regulate the salt stress response. Therefore, in this study, we further analyzed whether AtPPRT1 negatively regulates the salt stress response. The results showed that AtPPRT1 expression was induced by salt stress. Furthermore, under salt stress, the β-glucuronidase (GUS) gene driven by the AtPPRT1 promoter has shown increased activity in the hypocotyl and petioles of Arabidopsis seedlings. Additionally, seedlings of the T-DNA insertion mutant atpprt1 showed significant growth advantage under salt stress, whereas overexpressing AtPPRT1 (OE lines) in Arabidopsis seedlings displayed hypersensitive under salt stress. Etiolated atpprt1 seedlings also demonstrated significantly elongated hypocotyl lengths in salt stress. The elevated or reduced salt tolerance of atpprt1 and AtPPRT1 overexpressing lines was confirmed by the changes in chlorophyll content and 3,3ʹ-Diaminobenzidine (DAB) staining. The above data suggest that AtPPRT1 has a negative effect on salt tolerance in Arabidopsis seedlings.

Breeding of the transgenic chrysanthemum (Chrysanthemum morifolium Ramat.) carrying aphid-resistance gene, Pinellia ternata agglutinin (PTA)

Plasmid pCAMBIA2201-pta, containing the selectable marker neomycin phosphotransferase gene (npt II), Pinellia ternata agglutinin (PTA) gene and β-glucuronidase gene, were transformed into leaf discs of Chrysanthemum (Chrysanthemum morifolium Ramat.) via Agrobacterium tumefaciens-mediated transformation. It was confirmed by GUS (β-glucuronidase) and PCR analysis that the PTA gene had been successfully inserted into the plant genome. Hemagglutination assay was carried out and the expression of PTA gene in transgenic plants in vitro and the aphid-resistance assay result showed that the inhibition rates of the transformed plants were improved than the control. T1 progenies generated through the cuttage breeding from T0 generation had preserved the aphid-resistance and the inhibition rates of T1 generation had no significant difference with T0 generation (P > 0.05). The results suggest that PTA gene can improve aphid resistance of chrysanthemum and its aphid resistance can be generated to T1 generation stably.

A Procedure for Agrobacterium tumefaciens Mediated Genetic Transformation of Sweet Potato

Many sweet potato plants have been successfully transformed but the transgenic plants regenerated, however, have been limited to a few genotypes. Reported in this paper is a procedure in which several explants of three sweet potato genotypes from Papua New Guinea (PNG) were used to transform and regenerate transgenic plants. To achieve stable transformation, an efficient shoot regeneration system for different explants was developed. The shoot regeneration protocol developed enabled for a reproducible stable transformation mediated by Agrobacterium tumefaciens strain 1065. The plasmid pVDH65 contains the npt II gene for kanamycin (km) resistance, hpt gene for hygromycin resistance and Gus-intron reporter gene (GUS) for β-glucuronidase. Explants inoculated with the bacterial strain were co-cultured for 3, 5 and 7 days (d) in the dark on Murashige and Skoog (MS) medium without growth hormones. After co-cultivation, the explants were washed in liquid MS medium containing 500 mg L-1 cefotaxime, rinsed in sterile, deionised water for 10 mins and cultured on km selection medium containing 100 mg L-1 km followed by transfer of explants to 125 mg L-1 km after 14 d of culture. The km-resistant shoots selected on the former km concentration were transferred to the latter for double selection. Km-resistant shoots obtained at 125 mg L-1 were rooted on MS based medium also containing 0.008 mg L-1 IAA, 0.03 mg L-1 kinetin and 0.001 mg L-1 folic acid. This double selection method led to effective elimination of escapes (up to 75%) and successful recovery of transgenic plants from stem explants at more than 25%, leaf discs 10% and petioles 13.3% of each sweet potato cultivar. Polymerase chain reaction (PCR) analysis of the three km-resistant and GUS-positive plants revealed the presence of the expected fragment for npt II. This is the first report of successfully transforming sweet potato plants with bacterial strain 1065 and selection of transgenic plants at km concentrations higher than 100 mg L-1.

Identification of novel MYB transcription factors involved in the isoflavone biosynthetic pathway by using the combination screening system with agroinfiltration and hairy root transformation.

Soybean isoflavones are functionally important secondary metabolites that are mainly accumulated in seeds. Their biosynthetic processes are regulated coordinately at the transcriptional level; however, screening systems for key transcription factors (TFs) are limited. Here we developed a combination screening system comprising a simple agroinfiltration assay and a robust hairy root transformation assay. First, we screened for candidate MYB TFs that could activate the promoters of the chalcone synthase (CHS) gene GmCHS8 and the isoflavone synthase (IFS) genes GmIFS1 and GmIFS2 in the isoflavone biosynthetic pathway. In the agroinfiltration assay, we co-transformed a LjUbi (Lotus japonicus polyubiquitin gene) promoter-fused MYB gene with target promoter-fused GUS (β-glucuronidase) gene constructs, and identified three genes (GmMYB102, GmMYB280, and GmMYB502) as candidate regulators of isoflavone biosynthesis. We then evaluated the functional regulatory role of identified three MYB genes in isoflavone biosynthesis using hairy roots transformation assay in soybean for the accumulation of isoflavones. Three candidate MYB genes showed an increased accumulation of total isoflavones in hairy root transgenic lines. Accumulation of total isoflavones in the three MYB-overexpressing lines was approximately 2-to 4-folds more than that in the vector control, confirming their possible role to regulate isoflavone biosynthesis. However, the significant accumulation of authentic GmCHS8, GmIFS1, and GmIFS2 transcripts could not be observed except for the GmMYB502-overexpressing line. Therefore, the analysis of isoflavone accumulation in transgenic hairy root was effective for evaluation of transactivation activity of MYB TFs for isoflavone biosynthetic genes. Our results demonstrate a simple and robust system that can potentially identify the function of orphan TFs in diverse plant metabolic pathways.

AtSIBP1, a Novel BTB Domain-Containing Protein, Positively Regulates Salt Signaling in Arabidopsis thaliana.

Because they are sessile organisms, plants need rapid and finely tuned signaling pathways to adapt to adverse environments, including salt stress. In this study, we identified a gene named Arabidopsis thaliana stress-induced BTB protein 1 (AtSIBP1), which encodes a nucleus protein with a BTB domain in its C-terminal side and is induced by salt and other stresses. The expression of the β-glucuronidase (GUS) gene driven by the AtSIBP1 promoter was found to be significantly induced in the presence of NaCl. The sibp1 mutant that lost AtSIBP1 function was found to be highly sensitive to salt stress and more vulnerable to salt stress than the wild type WT, while the overexpression of AtSIBP1 transgenic plants exhibited more tolerance to salt stress. According to the DAB staining, the sibp1 mutant accumulated more reactive oxygen species (ROS) than the WT and AtSIBP1 overexpression plants after salt stress. In addition, the expression levels of stress-induced marker genes in AtSIBP1 overexpression plants were markedly higher than those in the WT and sibp1 mutant plants. Therefore, our results demonstrate that AtSIBP1 was a positive regulator in salinity responses in Arabidopsis.

Agrobacterium-Mediated Transformation of Lemna minor L. with Hirudin and β-Glucuronidase Genes

The Agrobacterium-mediated transformation of a duckweed plant (Lemna minor L.) with the use of the organogenic callus and nucleotide sequence of a gene for hirudin-1 optimized for expression in plants has been performed. Eight transgenic plant lines transformed by hirudin and seven lines transformed by the gene for β-glucuronidase were obtained. The expression of the glucuronidase gene was proven by histochemical staining and Western blot. ELISA of the transgenic plants showed that the content of β-glucuronidase in them varied from 0.28 to 1.43% of the total soluble protein. The expression of the hirudin-1 gene was confirmed by RT-PCR, with the maximum hirudin accumulation being equal to 0.02% of the total soluble protein. The results of the study can be used in the development of an expression system using the duckweed plant to obtain hirudin and other recombinant proteins for pharmaceutical use.

Improvement of plant regeneration and <i>Agrobacterium</i>-mediated genetic transformation of <i>Stylosanthes guianensis</i>

As a pioneer tropical pasture legume, stylo (Stylosanthes guianensis) is well adapted to growth-limiting factors in acid soils. Considering the importance of stylo, there is a need to improve Agrobacterium-mediated genetic transformation to enable development of elite cultivars. In this study, S. guianensis cv. RY5 was used to systematically optimize Agrobacterium-mediated transformation based on its plant regeneration. Results showed that Murashige and Skoog (MS) medium containing 0.2 mg/L 2,4-dichlorophenoxyacetic acid (2,4-D) and 2 mg/L 6-benzylaminopurine (6-BA) was the optimal callus induction medium. MS medium supplemented with 2 mg/L 6-BA was suitable for shoot regeneration from cotyledon-derived calluses, and 0.5 mg/L indole-3-acetic acid (IAA) and 0.5 mg/L indole-3-butyric acid (IBA) applications were beneficial for rooting. The highest transformation efficiency (67%) was obtained at an Agrobacterium concentration of optical density = 0.6 combined with an infection time of 15 min and 3 days of co-cultivation. Furthermore, 200 mg/mL carbenicillin (Carb) and 0.6 mg/L Basta® supplements were effective in eliminating excess bacterial growth and selecting transgenic plants, respectively. Subsequent polymerase chain reaction (PCR) analysis confirmed that the β-glucuronidase (GUS) and BAR genes were successfully integrated into the stylo genome. Wider testing of this improved protocol as a means of enhancing genetic improvement and gene function analysis of stylo seems warranted.

Identification and characterization of the GmRD26 soybean promoter in response to abiotic stresses: potential tool for biotechnological application

BackgroundDrought is one of the most harmful abiotic stresses for plants, leading to reduced productivity of several economically important crops and, consequently, considerable losses in the agricultural sector. When plants are exposed to stressful conditions, such as drought and high salinity, they modulate the expression of genes that lead to developmental, biochemical, and physiological changes, which help to overcome the deleterious effects of adverse circumstances. Thus, the search for new specific gene promoter sequences has proved to be a powerful biotechnological strategy to control the expression of key genes involved in water deprivation or multiple stress responses.ResultsThis study aimed to identify and characterize the GmRD26 promoter (pGmRD26), which is involved in the regulation of plant responses to drought stress. The expression profile of the GmRD26 gene was investigated by qRT-PCR under normal and stress conditions in Williams 82, BR16 and Embrapa48 soybean-cultivars. Our data confirm that GmRD26 is induced under water deficit with different induction folds between analyzed cultivars, which display different genetic background and physiological behaviour under drought. The characterization of the GmRD26 promoter was performed under simulated stress conditions with abscisic acid (ABA), polyethylene glycol (PEG) and drought (air dry) on A. thaliana plants containing the complete construct of pGmRD26::GUS (2.054 bp) and two promoter modules, pGmRD26A::GUS (909 pb) and pGmRD26B::GUS (435 bp), controlling the expression of the β-glucuronidase (uidA) gene. Analysis of GUS activity has demonstrated that pGmRD26 and pGmRD26A induce strong reporter gene expression, as the pAtRD29 positive control promoter under ABA and PEG treatment.ConclusionsThe full-length promoter pGmRD26 and the pGmRD26A module provides an improved uidA transcription capacity when compared with the other promoter module, especially in response to polyethylene glycol and drought treatments. These data indicate that pGmRD26A may become a promising biotechnological asset with potential use in the development of modified drought-tolerant plants or other plants designed for stress responses.

Construction of a fusion anti-caries DNA vaccine in transgenic tomato plants for PAcA gene and cholera toxin B subunit.

Chronic bacterial infections in the oral cavity influence the development of dental caries. Mutans streptococci are the major pathogenic cause of dental caries. The World Health Organization (WHO) ranks dental caries, cancer, and cardiovascular diseases as the three major global diseases that need urgent preventative and curative measures. However, substantial evidence suggests that traditional prevention and treatment strategies are inefficient in reducing the prevalence of dental caries. For protection against caries, it is important to develop effective vaccines that induce anticolonizing immunity against Streptococcus mutans infections. In the present investigation, we constructed a fusion anti-caries DNA vaccine (PAcA-ctxB) through fusing A region of cell surface protein PAc (PAcA) coding gene of mutans streptococci with cholera toxin B subunit coding gene (CTB). Afterward, the plasmids were integrated into tomato genomes through agrobacterium-mediated plant transformation technology. The presence of transgenes in the tomato genome was confirmed by PCR, β-glucuronidase gene (GUS), and western blot. The expression of genes was confirmed at transcription and protein level. Altogether, the results presented herein showed that transgenic tomatoes may provide a useful system for the production of human caries antigen.

Application of Beta-Glucuronidase Transient Expression for Selection of Maize Genotypes Competent for Genetic Transformation

Genetic transformation of inbred maize lines and F1 hybrids registered in Ukraine has been carried out. The study employed a biolistic method for genetic transformation of immature maize embryos that formed callus tissue and the pAHC25 vector containing the genes of phosphinothricin-N-acetyltransferase (bar) and β-glucuronidase (uidA). As a result of the transformation of callus tissue of maize genotypes, lines resistant to phosphinothricin and regenerated plants were obtained. The activity of β-glucuronidase in herbicide-resistant calli was detected. The presence of the bar gene in callus DNA was demonstrated by the PCR method. The rate of stable transformation ranged from 2.2 to 30% depending on the genotype. The relationship between the results of transient expression of the β-glucuronidase gene and stable genetic transformation was observed. The proposed protocol for genetic transformation of maize using the study of transient expression of the β-glucuronidase gene makes it possible to significantly simplify the process of selecting genotypes competent for genetic transformation and create transgenic organisms with new traits.

Plant Growth Promoting Rhizobacteria (PGPRs) Alter Plant Host Somatic Mutation Frequencies

Plant growth promoting rhizobacteria (PGPRs) are a group of soil bacteria which can induce positive growth in plants by different mechanisms. This work intends to find the effect of PGPRs on two classes of somatic mutations in the host, frame shift mutation (FSM) and somatic homologous recombination (SHR) and, compare the same with that of a pathogen. Somatic mutations in plants are important as they are an adaptation strategy to overcome stressful conditions and also get passed on to the next generations. The mutation detector Arabidopsis thaliana lines carrying a non-functional β-glucuronidase gene (GUS) were used to score the mutation events. One day-old mutant seedlings were co-cultivated with the PGPRs (Rhizobium leguminosarum and Pseudomonas fluorescens) and the pathogenic strain (P. syringae) for two different post-infection durations (4 h and 48 h). A reversion of the mutated GUS to its functional form resulted in blue spots in the host plant. Based on the number of blue spots seen, the mutation frequencies were estimated. An increase in FSM was observed in plants co-cultivated with R. leguminosarum for 4 h as well as 48 h. R. leguminosarum suppressed SHR frequency 4 h-post infection, which significantly increased at 48 h. In contrast, P. fluorescens infection lead to a temporal suppression of FSM and induction of SHR at 4 h. Subsequently, the SHR rates reduced significantly, i.e. lower than the uninfected controls at 48 h. The pathogenic strain P. syringae temporally increased FSM in plants and also enhanced SHR rates in plants 4 h post-infection, which also subsequently reduced 48 h post infection. To the best of our knowledge, there are no other reports comparing the effect of PGPRs on host somatic mutation rates.

The HKT Transporter Gene from Arabidopsis, AtHKT1;1, Is Dominantly Expressed in Shoot Vascular Tissue and Root Tips and Is Mild Salt Stress-Responsive.

The Arabidopsis high-affinity K+ transporter (AtHKT1;1) plays roles in salt tolerance by unloading Na+ from the root xylem to the xylem parenchyma cells and/or uploading Na+ from the shoot/leaf xylem to the xylem parenchyma cells. To use this promoter for the molecular breeding of salt-tolerant plants, I evaluated the expression profile of the AtHKT1;1 promoter in detail. Approximately 1.1 kbp of sequence upstream from the start codon of AtHKT1;1 was polymerase chain reaction (PCR)-amplified, fused to the β-glucuronidase (GUS) gene, and introduced into Arabidopsis. The resultant transformants were evaluated under nonstressed and salt-stress conditions at the seedling and reproductive stages. Histochemical analysis showed that GUS activity was detected in vascular bundle tissue in roots, hypocotyls, petioles, leaves, and petals, and in root tips. GUS enzyme activity in shoots tended to be higher than that in roots at both stages. After treatment with 50 mM NaCl for 24 h, GUS transcription levels and GUS enzyme activity were enhanced in transgenic lines. These results indicate that the AtHKT1;1 promoter isolated in this study could be useful in expressing transgenes specifically in vascular tissue and root tips, and in a mild salt-stress-responsive manner. The data provide novel insights into the functions of AtHKT1;1.

The ABA- and Stress-Induced Expression of the ArabidopsisthalianaAt4g0180 Gene Is Determined by the Cis-Elements Responsible for Binding the ABA-Dependent Trans-Factors

In silico analysis of the promoter region of the At4g01870 gene of Arabidopsis thaliana (L.) Heynh. showed the presence of ABRE, W-box, RAV1-A, MYB, and LFY cis-elements in the sequence. These regulatory motifs bind the transcription factors involved in responses to abscisic acid (ABA) and stresses. Stable transgenic plants carrying the β-glucuronidase gene under the control of the 5'-deletion fragments of the At4g01870 promoter were obtained. According to the results of histochemical staining of transformants, gene expression was induced by abiotic stress and was most significant in the conductive tissues of the root, leaves, and sepals as well as in flowers. The study of At4g01870 gene expression by RT-PCR confirmed that the gene transcript content increased after the exposure of plants to a solution of NaCl or at 37°C and after ABA treatment; however, hypothermia almost unchanged the level of accumulation of the transcripts. Along with ABA, expression of the At4g01870 gene was induced by indolylacetic and salicylic acids and ethylene precursor 1-aminocyclopropane-1-carboxylic acid; it was hardly regulated by methyl jasmonate and inhibited by cytokinin. The TolB-like protein, encoded by the At4g01870 gene, functions as a type of platform, based on which protein complexes are assembled. Given the previously identified ABA-binding properties of the protein At4g01870 and the presence of the ABA-dependent cis-elements in the promoter of its coding gene, it can be assumed that the protein encoded by the At4g01870 gene allows to control the hormonal signals in the cell, providing a structural platform for the interaction of specific effector proteins, trans-factors and ion channels.

The infiltration efficiency of Agrobacterium-mediated transient transformation in four apple cultivars

Studies of gene function in apple fruits (Malus domestica) have been hindered by the long juvenile period of apple fruit trees. Transient gene expression is a relatively simple method for gene functional analyses, and has been broadly applied to several plant species; however, few studies have reported a method for systematic transient expression in apple fruits. Here, we developed a highly efficient and robust Agrobacterium-mediated transient expression system for apple fruit, which allows rapid analysis of diverse gene functions. Using a β-glucuronidase gene (GUS) as a reporter for Agrobacterium-mediated transformation, we found that the most suitable infiltration pressure for gene function assays in ‘Red Fuji’, ‘Granny Smith’ and ‘Royal Gala’ fruits was −90 kPa, but −70 kPa in ‘Golden Delicious’. The infiltration efficiency of ‘Golden Delicious’ was higher than that of the other apple cultivars. Transient silencing of MdMYB10, an anthocyanin biosynthesis regulator, altered anthocyanin content in ‘Red Fuji’, demonstrating that vacuum infiltration with Agrobacterium can be used for gene functional analysis. Also a significant positive correlation was found between microcrack density and infiltration efficiency. We conclude that this method represents a general tool for efficient and targeted transient regulation of gene expression in apple fruits.

TaEXPB7-B, a β-expansin gene involved in low-temperature stress and abscisic acid responses, promotes growth and cold resistance in Arabidopsis thaliana

Low temperature is one of the primary causes of economic loss in agricultural production, and in this regard, expansin proteins are known to play important roles in plant growth and responses to various abiotic stresses and plant hormones. In order to elucidate the roles of expansin genes in the response of Dongnongdongmai 2 (D2), a highly cold-resistant winter wheat variety, to low-temperature stress, we exposed plants to a temperature of 4℃ and analysed the transcriptome of tillering nodes. Expression levels of TaEXPB7-B were significantly increased in response to both low-temperature stress and abscisic acid (ABA) treatment. To further confirm these observations, we transformed Arabidopsis plants with the β-glucuronidase (GUS) gene driven by the TaEXPB7-B promoter. GUS staining results revealed that TaEXPB7-B showed similar responses to low-temperature and ABA treatments. Our transcriptome data indicated that the AREB/ABF transcription factor gene TaWABI5 was also induced by low temperature in D2. Yeast one-hybrid experiments demonstrated that TaWABI5 binds to an ABRE cis-element in the TaEXPB7-B promoter, and overexpression of TaWABI5 in wheat protoplasts enhanced the expression of endogenous TaEXPB7-B by 7.7-fold, implying that TaWABI5 plays important roles in regulating the expression of TaEXPB7-B. Cytological data obtained from the transient expression of 35S::TaEXPB7-B-eYFP in onion epidermal cells indicated that TaEXPB7-B is cell wall localised. Overexpression of TaEXPB7-B in Arabidopsis promoted a significant increase in plant growth and increased lignin and cellulose contents. Moreover, TaEXPB7-B conferred enhanced antioxidant and osmotic regulation in transgenic Arabidopsis, thereby increasing the tolerance and survival of plants under conditions of low-temperature stress.

FUNCTIONAL ANALYSIS OF THE PERSICARIA MINOR SESQUITERPENE SYNTHASE GENE PROMOTER IN TRANSGENIC ARABIDOPSIS THALIANA

Sesquiterpene synthase is an enzyme involved in sesquiterpene biosynthesis which catalyzed sesquiterpene formation from farnesyl diphosphate (FDP). In this research, the sesquiterpene synthase promoter (PmSS) was isolated from Persicaria minor (P.minor) to identify the functional region of the promoter and possible cis - regulatory element involved in the regulation of sesquiterpene synthase gene. Various putative cis - regulatory element involved in environmental stress and hormones were identified on PmSS promoter. The PmSS promoter and three series of deletion promoter were fused to β-glucuronidase (gus) gene and transformed into Arabidopsis thaliana. This study showed PmSS promoter was regulated in a developmental -specific manner and response to wounding, drought, heat, abscisic acid (ABA) and methyl jasmonate (MeJa) treatment. The results revealed the existence of cis regulatory elements that control the regulation of promoter activity in a developmental specific manner at -1758 to -1078 promoter sequences. The presence of cis-element acting as a repressor is expected to be present at the promoter between -1540 to -1078 bp. The region from -1078 to -855 was critical for maximal PmSS promoter activity. Deletion of promoter region from -1758 to -855 induced regulation of promoter in an organ-specific manner. Drought stress treatment did not induced GUS activity in deleted ABRE motif construct, suggested that ABRE motif is essential cis element during drought stress.