Azospirillum Sp Research Articles

Genome-based reclassification of Azospirillum brasilense Sp245 as the type strain of Azospirillum baldaniorum sp. nov.

Azospirillum sp. strain Sp245T, originally identified as belonging to Azospirillum brasilense, is recognized as a plant-growth-promoting rhizobacterium due to its ability to fix atmospheric nitrogen and to produce plant-beneficial compounds. Azospirillum sp. Sp245T and other related strains were isolated from the root surfaces of different plants in Brazil. Cells are Gram-negative, curved or slightly curved rods, and motile with polar and lateral flagella. Their growth temperature varies between 20 to 38 °C and their carbon source utilization is similar to other Azospirillum species. A preliminary 16S rRNA sequence analysis showed that the new species is closely related to A. brasilense Sp7T and A. formosense CC-Nfb-7T. Housekeeping genes revealed that Azospirillum sp. Sp245T, BR 12001 and Vi22 form a separate cluster from strain A. formosense CC-Nfb-7T, and a group of strains closely related to A. brasilense Sp7T. Overall genome relatedness index (OGRI) analyses estimated based on average nucleotide identity (ANI) and digital DNA-DNA hybridization (dDDH) between Azospirillum sp. Sp245T and its close relatives to other Azospirillum species type strains, such as A. brasilense Sp7T and A. formosense CC-Nfb-7T , revealed values lower than the limit of species circumscription. Moreover, core-proteome phylogeny including 1079 common shared proteins showed the independent clusterization of A. brasilense Sp7T, A. formosense CC-Nfb-7T and Azospirillum sp. Sp245T, a finding that was corroborated by the genome clustering of OGRI values and housekeeping phylogenies. The DNA G+C content of the cluster of Sp245T was 68.4-68.6 %. Based on the phylogenetic, genomic, phenotypical and physiological analysis, we propose that strain Sp245T together with the strains Vi22 and BR12001 represent a novel species of the genus Azospirillum, for which the name Azospirillum baldaniorum sp. nov. is proposed. The type strain is Sp245T (=BR 11005T=IBPPM 219T) (GCF_007827915.1, GCF_000237365.1, and GCF_003119195.2).

English

The objective of this study was to improve rice and maize yields using native Azospirillum-based biofertilizer. To reach this objective, samples of rhizosphere soil, non-rhizosphere soil and roots of maize plants were collected from the particular locations of Samanko and Bamako of the south Mali. Thirty-three different colonies of bacteria were isolated from the different samples. Based on their better growth in nitrogen free semi-solid medium, their morphological, biochemical and plant growth promotion characteristic, ten bacterial isolates were identified as Azospirillum isolates following the Bergey’s Manual of Determinative Bacteriology. Ten isolates were selected: Az1, Az2, Az3, Az4, Az5, Az6, Az7, Az8, Az9 and Az10. Strain Az6 showed great potential on both rice and maize production. Therefore, this strain is suggested for large scale rice and maize fields’ application. While the Azospirillum sp. Az5, Az6 and Az10 strains are suggested for large scale application in maize field, which may reduce production cost. Top dressing with 25% of the recommended nitrogen-fertilizer was found to decrease maize grain yield.   Key words: Azospirillum, Nitrogen-fixing bacteria, plant growth-promoting rhizobacteria (PGPR), biopesticide, maize, rice, Mali.

Protist-enhanced survival of a plant growth promoting rhizobacteria, Azospirillum sp. B510, and the growth of rice (Oryza sativa L.) plants

Application of plant growth promoting rhizo-bacteria (PGPR) is a promising method for sustainably increasing the plant growth; however, survival of PGPR is the most important factor limiting its efficiency. We studied the effects of heterotrophic protists on the survival of introduced PGPR, Azospirillum sp. B510, on indigenous bacterial community structure, and on the growth of the rice (Oryza sativa L.) plant in the early stages. Sterile rice seedlings grown in sterilized soil were inoculated with Azospirillum sp. B510, four protist isolates, and an indigenous protist-free bacterial community. Impact of protists on bacterial community structure was investigated by high throughput sequencing. Heterotrophic protists significantly increased survival of Azospirillum sp. B510. Heterotrophic protists and Azospirillum sp. B510 significantly increased early plant growth and nitrogen uptake, and their simultaneous inoculation had the largest impact on plant biomass (155.1% increase) and nitrogen uptake (226.0% increase). Protists altered the community composition of bacteria. In particular, Sphingobacteriia, Azospirillum, Rodospirillales, Massilia, Caloramator, and Agrobacterium benefited from the presence of protists, while Sphingomonadales, Ralstonia, Burkholderia, and Rhodoferax decreased in the protist-inoculated microcosms. Impact of different protist isolates was differed on early plant growth, nitrogen uptake and bacterial community structure. Our results suggest that protists could be as beneficial as PGPR for early growth in rice plants, and simultaneous inoculation with protist and PGPR may be a key solution for chemical-free sustainable agriculture.

Jasmonic Acid, Not Salicyclic Acid Restricts Endophytic Root Colonization of Rice.

Research on the interaction between the non-nodule-forming bacterial endophytes and their host plants is still in its infancy. Especially the understanding of plant control mechanisms which govern endophytic colonization is very limited. The current study sets out to determine which hormonal signaling pathway controls endophytic colonization in rice, and whether the mechanisms deviate for a pathogen. The endophyte Azoarcus olearius BH72—rice model was used to investigate root responses to endophytes in comparison to the recently established pathosystem of rice blight Xanthomonas oryzae pv. oryzae PXO99 (Xoo) in flooded roots. In the rice root transcriptome, 523 or 664 genes were found to be differentially expressed in response to Azoarcus or Xoo colonization, respectively; however, the response was drastically different, with only 6% of the differentially expressed genes (DEGs) overlapping. Overall, Xoo infection induced a much stronger defense reaction than Azoarcus colonization, with the latter leading to down-regulation of many defense related DEGs. Endophyte-induced DEGs encoded several enzymes involved in phytoalexin biosynthesis, ROS (reactive oxygen species) production, or pathogenesis-related (PR) proteins. Among putative plant markers related to signal transduction pathways modulated exclusively during Azoarcus colonization, none overlapped with previously published DEGs identified for another rice endophyte, Azospirillum sp. B510. This suggests a large variation in responses of individual genotypic combinations. Interestingly, the DEGs related to jasmonate (JA) signaling pathway were found to be consistently activated by both beneficial endophytes. In contrast, the salicylate (SA) pathway was activated only in roots infected by the pathogen. To determine the impact of SA and JA production on root colonization by the endophyte and the pathogen, rice mutants with altered hormonal responses were employed: mutant cpm2 deficient in jasmonate synthesis, and RNA interference (RNAi) knockdown lines of NPR1 decreased in salicylic acid-mediated defense responses (NPR1-kd). Only in cpm2, endophytic colonization of Azoarcus was significantly increased, while Xoo colonization was not affected. Surprisingly, NPR1-kd lines showed slightly decreased colonization by Xoo, contrary to published results for leaves. These outcomes suggest that JA but not SA signaling is involved in controlling the Azoarcus endophyte density in roots and can restrict internal root colonization, thereby shaping the beneficial root microbiome.

Microbial communities and biogenic Mn-oxides in an on-site biofiltration system for cold Fe-(II)- and Mn(II)-rich groundwater treatment

This study investigated relationships between microbial communities, groundwater chemistry, and geochemical and mineralogical characteristics in field-aged biofilter media from a two-stage, pilot-scale, flow-through biofiltration unit designed to remove Fe(II) and Mn(II) from cold groundwater (8 to 15 °C). High-throughput 16S rRNA gene amplicon sequencing of influent groundwater and biofilter samples (solids, effluents, and backwash water) revealed significant differences in the groundwater, Fe filter, and Mn filter communities. These community differences reflect conditions in each filter that select for populations that biologically oxidize Fe(II) and Mn(II) in the two filters, respectively. Genera identified in both filters included relatives of known Fe(II)-oxidizing bacteria (FeOB), Mn(II)-oxidizing bacteria (MnOB), and ammonia-oxidizing bacteria (AOB). Relatives of AOB and nitrite-oxidizing bacteria were abundant in sequencing reads from both filters. Relatives of FeOB in class Betaproteobacteria dominated the Fe filter. Taxa related to Mn-oxidizing organisms were minor members of the Mn-filter communities; intriguingly, while Alphaproteobacteria dominated (40 ± 10% of sequencing reads) the Mn filter community, these Alphaproteobacteria did not classify as known MnOB. Isolates from Fe and Mn filter backwash enrichment studies provide insight on the identity of MnOB in this system. Novel putative MnOB isolates included Azospirillum sp. CDMB, Solimonas soli CDMK, and Paenibacillus sp. CDME. The isolate Hydrogenophaga strain CDMN can oxidize Mn(II) at 8 °C; this known FeOB is likely capable of Mn(II) oxidation in this system. Synchrotron-based X-ray near-edge spectroscopy (XANES) coupled with electron paramagnetic resonance (EPR) revealed the dominant Mn-oxide that formed was biogenic birnessite. Co-existence of amorphous and crystallized Mn-oxide surface morphologies on the Mn-filter media suggest occurrence of both biological and autocatalytic Mn(II) oxidation in the biofilter. This study provides evidence that biofiltration is a viable approach to remove iron, manganese, and ammonia in cold groundwater systems, and that mineralogical and microbiological approaches can be used to monitor biofiltration system efficacy and function.

Microbe population in biofertilizer with vermicompost as a carrier during the process and storage

The main problem with biofertilizer is a short storage life. Carrier materials of biofertilizer include determinants of quality and storage life. This study measured the ability of vermicompost to be used as a carrier of biofertilizers from various beneficial microbes. The study used a factorial randomized block design with 2 factors and 3 replications. The first factor was the worm and microbial application technique consisting of 4 treatments: no worm; worm applied one week after applying microbes; microbial and worm applications were applied simultaneously and microbes applied one week after applying worm. The second factor was the type of beneficial microbes consisting of 4 treatments: Azospirillum sp; Azotobacter chroococcum; Trichoderma asperellum G strains and Talaromyces pinophilus. The results obtained that after 3 and 6 weeks incubation the highest population was found at T.pinophilus (59.5-210.5×1010 CFU mL−1) and at A. chroococcum (83.5-190.5×1010 CFU mL−1, respectively. After 1 year storage, the population of A.chroococum in the carrier biovermi decreased to 50 - 90×105 CFU mL−1, T. asperellum 60 - 210 ×106 CFU mL−1 and Azospirillum 75×107 - 32×108 CFU mL−1, while T.pinophilus 60 ×106 - 45×108 CFU mL−1.

In vitro test for compatibility of biofertilizers containing phosphate solubilizers and nitrogen-fixing bacteria

The quality of biofertilizers is determined by the content of isolates and synergism between isolates. The experiment was aimed to investigate the compatibillty of biofertilizers containing P-solubilizers and N-fixing bacteria. In vitro test using isolates of PSB and N-fixing bacteria was done to study the synergystic character by using streak method on nutrient agar for the bacteria and potato dextrose agar for the fungi. Species of P-solubilizers were Pseudomonas mallei, P. cepaceae, Aspergillus niger, and Penicillium sp., and species of N-fixing bacteria were Azotobacter chroococum and Azospirillum sp. The results revealed that the P-soluilizers microbes and N-fixing bacteria were synergistic and did not antagonistic to each other. Biofertilizers which contain P-solubilizers and N-fixing bacteria can be used for agricultural purposes.

Genome Sequences of Novel Azospirillum sp. Strains B21 and Sh1, Isolated from Raised Sphagnum Bogs, and Type Strains Azospirillum lipoferum 59b and Azospirillum oryzae COC8.

Here, we report the genomic sequences of the novel Azospirillum sp. strains B21 and Sh1, isolated from raised bogs, along with the genome sequences of Azospirillum lipoferum 59bT, the type species of the genus, and Azospirillum oryzae COC8T, which were analyzed to get more knowledge about the genus Azospirillum.

The Effects of Different Plant Activators on Fruit and Seed Yield and Properties of Snack Pumpkin (Cucurbita pepo L.)

Pumpkin consists of the species of the genus Cucurbita in the Cucurbitaceae family. C. pepo and rarely C. moschata species are using as snack seeds growing in Turkey. This study was carried out to examine the effects of different plant activators on the fruit and seed yield and quality of the snack pumpkin which is observed in Cukurova University Pozanti Agricultural Research and Application Center, during 2015 and 2016 growing years. Crop-set (CR), Effective microorganisms (EM1), Endoroots soluble (ERS), Vitormone-Plus Drip (VIT), Bacillus subtilis OSU 142, Bacillus megatorium M3, Azospirillum sp. SP 245, Spirulina platensis (SIP) were used as plant activators. Ecocompost (ECO), Camli Botanica liquid organic fertilizer (BOT) and Zincon (ZIN) were used as organic fertilizer. Organic fertilizer (OF) and conventional fertilizer application (CONV.) were determined as the control group. In the experiment, the plant activators were applied to the plants alone, in combination with each other and with organic fertilizer. As a result of the study, the best result in fruit and seed yield in the snack pumpkin obtained from the applications in combination with organic fertilizers of plant activators. The highest value, fruits diameter, fruit length, fruit circumference were obtained from CONV. application. Finally, the best results in seed width, seed length and seed length/width ratio were obtained from organic fertilizer and EM1 + OG application. Keywords: Snack pumpkin, plant activators, yield DOI: 10.7176/JSTR/5-10-01

Effects of copper on nitrous oxide (N2O) reduction in denitrifiers and N2O emissions from agricultural soils

Biochemical reduction of nitrous oxide (N2O) to dinitrogen (N2) by N2O reductase (N2OR) is the only known sink to consume N2O. Copper (Cu) and pH are two key factors determining the activity of the enzyme N2OR. We hypothesized that changes in the Cu level could enhance the reduction of N2O to N2 in denitrifier strains and decrease the N2O emissions from agricultural soils. To test this hypothesis, Cu-modified culture medium was applied to denitrifier strains, and Cu-modified organic fertilizer was applied to both soil microcosms and fields. Of 46 denitrifier strains, 25 showed higher denitrifying activities and 30N2/(46N2O + 30N2) after the addition of Cu under pure culture conditions. Among 10 genera, Azospirillum and Herbaspirillum were the most responsive to the Cu level changes. The N2O flux was significantly reduced 4 or 8 days onwards after the application of 130 mM CuSO4-modified organic fertilizer (vol:wt = 1:1) into Andosol or Fluvisol, respectively, under soil microcosm conditions. In addition, the cumulative N2O emissions were significantly reduced after the application of 130 mM CuSO4-modified organic fertilizer. They were moderately reduced after the application of 130 mM CuSO4-modified organic fertilizer (vol:wt = 1:1) into a Fluvisol field. They were significantly lower in Azospirillum sp. UNPF1-inoculated soils after the application of 130 mM CuSO4-modified organic fertilizer when compared with that in dual non-inoculated and unmodified soils. Soils inoculated with Herbaspirillum sp. UKPF54 showed results similar to non-inoculated Fluvisol fields. These results suggest that Cu may enhance N2O conversion to N2 in denitrifiers and that Cu-modified organic fertilizer may enhance N2O consumption or decrease N2O emissions in agricultural soils.

Genome Sequences of Two Azospirillum sp. Strains, TSA2S and TSH100, Plant Growth-Promoting Rhizobacteria with N2O Mitigation Abilities.

Azospirillum sp. strains TSA2S and TSH100 are plant growth-promoting rhizobacteria with the capacity to mitigate N2O from agricultural soil. They were isolated from the rhizosphere of paddy soil in Tokyo, Japan. Here, we present the genome sequences of these two strains.

Isolation, Characterization and Identification of Salt Tolerant Nitrogen Fixing Bacteria

The present investigation deals with the isolation and characterization of nitrogen-fixing bacteria (NFB) such as Azotobacter sp. and Azospirillum sp. from paddy field rhizosphere of Damietta governorate, Egypt. Twelve Azotobacter spp. and 12 Azospirillum spp.Were identified based on morphological and physiological characteristics. All isolates were tested for salt tolerance. The highest salt tolerant of Azotobacter spp. Were S2-8, S3-3, S1-3, S3-2, whil they S2-11, S1-1, S5-1, S3-6 in case of Azospirillum spp. were. Nitrogenase activity assay of the highest nitrogen fixing isolates was (S2-8) in case of Azotobacter sp. and (S2-11)in case of Azospirillum sp. Molecular identification showed that isolates were Azotobacter chroococcum and Azospirillm brasilense. Based on this study salt-tolerant isolates of Azotobacter chroococcum and Azospirillm brasilense could be highly used in cultivation of paddy soil in coastal environment.

Influence of Pesticides on Azospirillum sp. Population and Its Nitrogen Fixation in Groundnut (Arachis hypogaea L.) Soils

Aim: To study the impact of selected pesticides on Azospirillum sp. population and its nitrification in groundnut (Arachis hypogaea L.) soils. 
 Study Design: Black clay and red sandy loam soils with known pesticide history were collected from groundnut (Arachis hypogaea L.) cultivated fields and were investigated to elucidate the impact of pesticides on Azospirillum sp. population and its nitrification in both the soils.
 Place and Duration of Study: The soil samples were collected from groundnut cultivated fields of Anantapur District, Andhra Pradesh (A.P) and the study was carried out for 3 months.
 Methodology: Ten gram portions of each soil sample were placed in (25 × 150 mm) test tubes and treated with different concentrations of pesticides, (10, 25, 50, 75 and 100 µg g-1 soil) which were equivalent - 1.0, 2.5, 5.0, 7.5 and 10 kg ha-1. Soil samples without pesticides served as controls. The soils with and without pesticides were incubated at room temperature (28 ± 4°C) in the laboratory and moisture content was maintained at 60% water holding capacity (WHC) throughout the experimental period. After 7 and 14 days of incubation, triplicate soil samples were used to estimate the population size of Azospirillum sp. using the MPN method. Five ml aliquots of semi – solid malate medium were added to five MPN tubes and inoculated with 0.5 ml of a soil suspension from 10-1 to 10-5 soil dilutions, and incubated at 37°C.
 Results: The population of Azospirillum sp. in both soils increased when pesticides were applied @ 2.5 - 5.0 kg ha-1 and incongruity, when the pesticides concentration increased from 7.5 - 10.0 kg ha-1, the Azospirillum sp. population gradually decreased in both soils.
 Conclusion: The present study aimed at determining the influence of selected pesticides such as oxydemeton methyl, emamectin benzoate, dithane Z-78 and benomyl on the population of Azospirillum sp. and nitrogen fixation in black clay soil and red sandy loam soils in groundnut cultivated fields of Anantapur District, Andhra Pradesh, India. Insecticides and fungicides applied up to 5.0 kg ha-1, enhanced the population of Azospirillum sp. and its nitrogen fixation also increased significantly after 7 and 14 days of incubation in both soils. However, the population of Azospirillum sp., decreased with increasing period of soil incubation in both treated and untreated soils.

Role of Indigenous Nitrogen-fixing Bacteria in Promoting Plant Growth on Post Tin Mining Soil

Post tin mining soil is generally marginal with low pH, has poor nutrient content, and is thus unfavorable for plant growth, particularly for Sorghum bicolor , which is a nutrient-demanding plant. Indigenous bacteria are usually used in bioaugmentation to ameliorate environmental degradation due to their ability to adapt well. This research aimed to isolate indigenous nitrogen-fixing bacteria and evaluate its potential for promoting the growth of S. bicolor on post tin mining soil. Nitrogen-fixing bacteria were isolated from post tin mining soil by using specific media and identified by Bergey’s manual. Twenty five isolates were obtained, and eight of them ( Azospirillum sp . , Azospirillum lipoferum , Azotobacter chroococcum , A. paspalii , and Rhizobium sp.) were identified as nitrogen-fixing bacteria. A greenhouse experiment was conducted using factorial completely randomized design with three replications. The first factors were fertilizers, i.e., NPK; A. lipoferum CBT4 + NPK; A. lipoferum CBT4; and without fertilizer (control). The second factors were soil types, i.e., A (fertile soil from Cibinong), B (soil from Bangka Botanical Garden), C (soil from post tin mines two years after mining), and D (soil from active tin mining). Result showed that Azospirillum lipoferum CBT4 isolated from C (soil from post tin mines two years after mining) exhibited the highest IAA, Ca-P solubilizing ability, and PME-ase activity. This species survived up to a population of 10 7 CFU/gram soil in the three types of post tin mining soils and could be a potential plant-growth promoting rhizobacteria (PGPR) species for effectively improving the growth of S. bicolor plant on post tin-mining soil.

Analysis of physico-chemical parameters of soil and population density of Azospirillum isolates from paddy fields of Theni district, Tamilnadu

The rhizosphere region of eight different paddy field areas of Theni district was studied for their physico-chemical analysis of soil and the population density of Azospirillum sp. The study results showed range of values of pH (7.4-7.9), bulk density (1.13g/cm3 -1.60g/cm3), water holding capacity (34.31% - 18.25%), electrical conductivity (1.31 – 1.11), organic carbon (0.93% - 0.71%) . The macronutrient values namely total nitrogen (1.72% - 0.78%), phosphorus content (0.177% - 0.122%) and potassium (1.364% - 1.273%) were observed. Also micronutrients of various paddy fields like Zn (0.9% - 0.5%), Cu (2.3% - 1.7%), Fe (10.9% -8.2%), Mn (6.7% - 5.2%) were recorded, whereas the values of available macronutrients namely nitrogen (295kg/ha - 223kg/ha), phosphorous (89Kg/acre - 49kg/acre), potassium (790kg/acre - 490kg/acre) were noted. The Azospirillum population density was highest in Chinnamanur (192 x105 CFU/g) and lowest in Royyanpatti (91 x105 CFU/g). Thus through this work we were able to isolate and identify novel high yielding Azosprillium sp from paddy fields of Theni district.

Involvement of ethylene signaling in Azospirillum sp. B510-induced disease resistance in rice.

ACC: 1-aminocyclopropane-1-carboxylic acid; EIN2: ethylene-insensitive protein 2; ET: ethylene; ISR: induced systemic resistance; JA: jasmonic acid; RNAi: RNA interference; SA: salicylic acid; SAR: systemic acquired resistance.

English

Random amplification of polymorphic DNA (RAPD) amplification genomic DNA of 23 selected laboratory cultures of bacteria using RAPD revealed their polymorphism. Polymerase chain reaction (PCR) amplification of the bacterial 16SrDNA was performed using 704F GTAGCGGTGAAATGCGTAGA and 907R CCGTCAATTCCTTTGAGTTT primer, sequenced and accessed in NCBI (No. KY636356, KY631488, KY 860028, KX587470, KX665547, KY631489, KX608591, KY636360, KY671245, KY631490, KX587469, KY859856, KX665546, KX608590, KX587468, KY859798, KY636357, KY636361, KY 636359, KY631491, KY 859855, KY636358, KY636362) after submitting the contig. FASTA sequence in NCBI database was seen. All most all 23 bacterial strains (viz. TS-1-16, TS-4-23 DJ-1-22, DS-1-20, AS-1-4, DJ-1-24 , DJ-1-10, DJ-1-46) showed strong homology with free living nitrogen fixing soil bacteria, also showing (98 to 100%) identity and E-value of 00 with Burkholderia spp, Strain-S-9-19, Str-S-9-15, SP-2386, Stenotrophomonas maltophilla, strn-MM-3-3, Str-D-3,LP-05, Bacillus cereus Strn-FORC021and Azospirillum sp TSH51 gene, having good nitrogen fixing capacity. Phylogenetic tree analysis among the 23 isolates and between the different strains from GenBank showed close similarity. Most of the isolated bacterial strain identified as a member of the genus Burkholderia sp, Stenotrophomonas maltophila, Herbaspirillum sp, Acinetobacter johnsonii, Methylobacter, SP-T-20, and Bacillus cereus, Azospirillum sp would be consider to be the most suitable bioferiliser for organic and conventional tea gardens of North Bengal, India. Key words: Molecular phylogeny, RAPD, 16SrRNA sequencing, free living, N2 fixing soil bacteria.

Genome Sequence of Methylotrophic Azospirillum sp. Strain B2, Isolated from a Raised Sphagnum Bog.

ABSTRACTAzospirillum sp. strain B2 is a soil bacterium which was originally isolated from the Sosvyatskoe raised Sphagnum bog in Russia. Here, we present the approximately 8-Mb draft genome sequence of Azospirillum sp. B2, with the aim of providing insight into the genomic basis of its ecological success in peatland settings.

The Structural Similarity of Predicted Chickens MHC Regulatory Factors and Bacterial Organisms

Objective: Pathogen microorganisms use pathogen-encoded factors resembling host factors to elude the host's immune system. Based on molecular mimicry, a hypothesis was developed based on the bioinformatics analysis which represents the microorganism’s interference with chicken MHC regulatory factors. Method: The sequences of chicken NLRC5 and CIITA were retrieved from NCBI and ensemble database; so that the regulatory factors were predicted by using STRING tools. Also, Swiss model tools were used to predict the 3D structure of these molecules. The Cluspro 2.0 tool was used inorder to reveal the intramolecular interaction. Moreover, to find out the sequence and structure similarity with microorganism, UniPortKB, VAST and 3D Match tools were used as the experimental instruments. Result: In summary, Roseomonas cervicalis, Acetobacter aceti, Azospirillum sp CAG239, Roseomonas cervicalis, Rickettsiales_bacterium, Lactobacillus_hilgardii, Lactobacillus sakei, Aciduliprofundum boonei, Geoglobus_acetivorans, Pyrococcus horikoshii, Corynebacterium accolens, Hydrocarboniphaga effusa, Rhodopirellula europaea, Protochlamydia amoebophila and Escherichia coli have the protein subunit with detectable similarity with MHC regulatory factors. Conclusion: Bioinformatics analysis discovered mimicry as the new aspect of immune evasion or immune suppression effects of microbial organism in addition to the molecular similarities in MHC regulatory factors which were revealed between mammals and birds. Keywords: Bacteria, bioinformatics, chicken, MHC, regulatory factors, immune system.

Role of Bioinoculants for Improving Growth and Yield of Okra (Abelmoshuses culentum)

Elevated use of agrochemicals has been the backbone of sustainable crop production. However, the environmental hazards, soaring cost and stagnant production are the foremost issues affiliated with them. Exploitation of stumpy cost and environment friendly plant growth promoting rhizobacteria (PGPR) has certain encouraging results regarding sustainability in agricultural production. A glass house study was conducted at Soil Bacteriology Section, Ayub Agricultural Research Institute, Faisalabad to check the efficacy of different PGPR for growth and yield of okra (Abelmoshuses culentum). Treatments were control, Azotobacter sp inoculation, Azospirillum sp inoculation, Bacillus sp inoculation, Pseudomonas sp inoculation and Rhizobium sp inoculation. Results revealed that there was significant effect of all inoculants on growth and yield of okra crop. An increase of 23.5% and 21.0% in green pod yield was recorded with Pseudomonas sp and Bacillus sp, respectively. Positive consequence was observed in all other parameters where Pseudomonas inoculation was applied as compared to no inoculation. This study suggests that PGPR may be a dynamic biofertilizer to boost the yield of okra and other agricultural crops.