Average Coverage Research Articles

Lymphatic Filariasis Elimination in Kerala: A Success Story

National Filaria Control Programme has been running in the country since the year 1955 with the strategy of parasite detection, treatment and vector control mainly in urban areas. In the year 1997, the fiftieth World Health Assembly Resolution listed Lymphatic Filariasis (LF) for elimination by 2020 which now has been aligned with Sustainable Development Goal to be achieved by 2030. India also started its campaign to eliminate LF in 2004. The main strategy of the elimination programme is the Annual Mass Drug Administration (MDA) to progressively reduce and ultimately interrupt LF transmission. The other pillar of the strategy is morbidity management and disability prevention. Kerala state also started its LF elimination campaign in 11 endemic districts out of a total of 14 districts. The average population coverage during MDA in Kerala was reported to be more than 90% from 2004 to 2013, however, drug compliance during independent assessment was reported to be 40%-60% which improved in subsequent years due to a multipronged approach. The main reason of low consumption was the fear of side effects and the same was resolved through massive IEC activities highlighting its benefits compared to side effects, which are mostly self-limiting. The innovative strategic approach of extending the MDA period from 3 days to 3 weeks was undertaken to ensure that all the target population was covered. The results have been encouraging as compliance improved to above 65% and many districts have been validated for having achieved the elimination threshold through successfully clearing transmission assessment survey (TAS).

Twist exome capture allows for lower average sequence coverage in clinical exome sequencing

BackgroundExome and genome sequencing are the predominant techniques in the diagnosis and research of genetic disorders. Sufficient, uniform and reproducible/consistent sequence coverage is a main determinant for the sensitivity to detect single-nucleotide (SNVs) and copy number variants (CNVs). Here we compared the ability to obtain comprehensive exome coverage for recent exome capture kits and genome sequencing techniques.ResultsWe compared three different widely used enrichment kits (Agilent SureSelect Human All Exon V5, Agilent SureSelect Human All Exon V7 and Twist Bioscience) as well as short-read and long-read WGS. We show that the Twist exome capture significantly improves complete coverage and coverage uniformity across coding regions compared to other exome capture kits. Twist performance is comparable to that of both short- and long-read whole genome sequencing. Additionally, we show that even at a reduced average coverage of 70× there is only minimal loss in sensitivity for SNV and CNV detection.ConclusionWe conclude that exome sequencing with Twist represents a significant improvement and could be performed at lower sequence coverage compared to other exome capture techniques.

First report of ash shoestring-associated virus (ASaV) infecting European ash (Fraxinus excelsior L.) in France.

Ash shoestring-associated virus (ASaV) is a recently described Emaravirus with five genome segments identified in Germany and Switzerland from European ash (Fraxinus excelsior) or South European flowering ash (F. ornus) trees with chlorotic spots or mosaics and leaf curling or leaf shoestring symptoms [1]. In summer 2021 several European ash trees with severe leaf mosaic and deformation were observed 50 km south east of Bordeaux (France). Double stranded RNAs were purified from the leaves of one of the trees (2021-432) and analyzed by Illumina high throughput sequencing (HTS, 2x150 nt) as described [2]. Following quality trimming, reads were assembled de novo (CLC Genomics Workbench 21, Qiagen) and contigs annotated by BlastX analysis. Contigs homologous to ASaV genomic RNAs 2 to 5 were identified. For ASaV RNA2, four contigs were identified which could be manually assembled to yield a single scaffold while a single contig was obtained for RNAs 3, 4 and 5. The RNA2 scaffold assembled 1,206 reads for an average coverage of 58.2x, while the corresponding values for RNAs 3 to 5 were respectively 21,381 reads (1,529x), 18,146 reads (1,266x) and 1,234 reads (97.4x). While no contig was identified for ASaV RNA1 (or for other viruses), mapping of reads on an RNA1 reference (OU466880) allowed to identify 25 reads for this genomic segment (average coverage 0.4x). In total, ASaV reads represented 3.9% of the ca. 1 million reads obtained from the ash sample. The RNAs 2 to 5 scaffolds for isolate 2021-432 have been deposited in GenBank (OP501824-7). They show between 94.6% and 97.6% nucleotide identity with the corresponding RNAs of a reference isolate (OU466881-4). In order to validate the presence of ASaV in the original tree, PCR primers were designed based on RNAs 1 and 3 sequences. Primers ASaV1-F (5'-ATTATTCACAGTATGAAAGGG-3') and ASaV1-R (5'-GGTGTGGAGAATATCAAACC-3') amplify a 286 nt RNA1 fragment, while primers ASaV3-F (5'-GCTATACCCAGCTGAGGTGC-3') and ASaV3-R (5'-GTGTGCAATTCTATCAGCCTC-3') amplify a 322 nt RNA3 fragment. Amplicons of the expected size were obtained and directly sequenced. The RNA3 amplicon sequence was identical to the corresponding region of the HTS contig, while the RNA1 amplicon was 97.5% identical to the OU466880 reference sequence. The same primer pairs and a third one, ASaV4-F (5'- GAGGTTGCTTTGATGTCAGG -3') and ASaV4-R (5'- TGCCTCTCCGATGGTGATG -3'), amplifying a 411 nt RNA4 fragment, were used to test a European ash (2022-91) showing similar mosaic and shoestring symptoms collected in spring 2022 about 170 km south of Bordeaux. Again, amplifications were positive and the sequences of the amplicons showed 94.3 to 96.5% nt identity with the corresponding regions of the reference ASaV isolate and 93.9 to 94.3% identity with the French 2021-432 isolate. The PCR amplicon sequences for the two French isolates have been deposited in GenBank (OP501828-32). To our knowledge, these results represent the first report of a natural infection of ASaV in European ash in France. Identification of the virus in two ash populations about 150 km apart suggests the virus maybe widespread. The finding of ASaV in an ash tree with severe leaf symptoms and in which no other virus was identified by HTS supports its role as the causal agent of the symptoms observed. Ash trees in Europe are already threatened by the invasive ash dieback agent [3] and ASaV represents a further potential threat that deserves to be evaluated.

Interaction between the animal-based dietary pattern and green space on cognitive function among Chinese older adults: A prospective cohort study.

Green space is associated with better cognition, while the animal-based dietary pattern can be a risk factor. We aimed to verify the associations and explore their interaction among the elderly. The China Longitudinal Healthy Longevity Survey (CLHLS) cohort including 17,827 participants was used. The average green space coverage rate was used to measure green space exposure. The animal-based diet index (ADI) was scored based on the non-quantitative frequency questionnaire of ten types of food intake (three types of animal foods and seven types of plant foods). We used the Mini-Mental State Examination (MMSE) to assess cognitive function. The Cox proportional hazard regression was applied to explore the correlations and interactions. In the models, we gradually adjusted for the potential risk factors. Compared with participants living in the area with the lowest green space, those living with the highest were associated with a 20% decrease in the risk of cognitive impairment (hazard ratio (HR): 0.80, 95% CI: 0.73, 0.89). As for ADI, the highest group was related to a 64% increase in the risk of cognitive impairment (HR: 1.64, 95% CI: 1.38, 1.95). The protective effect of the highest green space group on cognitive impairment was more evident among participants with low ADI (HR=0.72, 95% CI: 0.62, 0.83), compared to those with high ADI. Green space was positively associated with cognition, while the animal-based dietary pattern was a cognitive disadvantage. The animal-based dietary pattern may mitigate the beneficial effects of green space on cognition.

Apostasia Mitochondrial Genome Analysis and Monocot Mitochondria Phylogenomics.

Apostasia shenzhenica belongs to the subfamily Apostasioideae and is a primitive group located at the base of the Orchidaceae phylogenetic tree. However, the A. shenzhenica mitochondrial genome (mitogenome) is still unexplored, and the phylogenetic relationships between monocots mitogenomes remain unexplored. In this study, we discussed the genetic diversity of A. shenzhenica and the phylogenetic relationships within its monocotyledon mitogenome. We sequenced and assembled the complete mitogenome of A. shenzhenica, resulting in a circular mitochondrial draft of 672,872 bp, with an average read coverage of 122× and a GC content of 44.4%. A. shenzhenica mitogenome contained 36 protein-coding genes, 16 tRNAs, two rRNAs, and two copies of nad4L. Repeat sequence analysis revealed a large number of medium and small repeats, accounting for 1.28% of the mitogenome sequence. Selection pressure analysis indicated high mitogenome conservation in related species. RNA editing identified 416 sites in the protein-coding region. Furthermore, we found 44 chloroplast genomic DNA fragments that were transferred from the chloroplast to the mitogenome of A. shenzhenica, with five plastid-derived genes remaining intact in the mitogenome. Finally, the phylogenetic analysis of the mitogenomes from A. shenzhenica and 28 other monocots showed that the evolution and classification of most monocots were well determined. These findings enrich the genetic resources of orchids and provide valuable information on the taxonomic classification and molecular evolution of monocots.

A novel SNP panel developed for targeted genotyping-by-sequencing (GBS) reveals genetic diversity and population structure of Musa spp. germplasm collection

The Philippines is situated in the geographic region regarded as the center of diversity of banana and its wild relatives (Musa spp.). It holds the most extensive collection of B-genome germplasm in the world along with A-genome groups and several natural hybrids with A- and B-genome combinations. Management of this germplasm resource has relied immensely on identification using local names and morphological characters, and the extent of genetic diversity of the collection has not been achieved with molecular markers. A high-throughput and reliable genotyping method for banana and its relatives will facilitate germplasm management and support breeding initiatives toward a marker-based approach. Here, we developed a 1K SNP genotyping panel based on filtering of high-quality genome-wide SNPs from the Musa Germplasm Information System and used it to assess the genetic diversity and population structure of 183 accessions from a Musa spp. germplasm collection containing Philippine and foreign accessions. Targeted GBS using SeqSNP™ technology generated 70,376,284 next-generation sequencing (NGS) reads with an average effective target SNP coverage of 340 × . Bioinformatics pipeline revealed 971 polymorphic SNPs containing 76.9% homozygous calls, 23.1% heterozygous calls and 4% with missing data. A final set of 952 SNPs detected 2,092 alleles. Pairwise genetic distance varied from 0.0021 to 0.3325 with most pairs of accessions distinguished with 250 to 300 loci. The SNP panel was able to detect seven (k = 7) genetically differentiated groups and its composition through Principal Component Analysis (PCA) with k-means clustering algorithm and Discriminant Analysis of Principal Components (DAPC). Accession-specific SNPs were also identified. The 1K SNP panel effectively distinguishes between genomic groups and provides relatively good resolution of genome-wide nucleotide diversity of Musa spp. This panel is recommended for low-density genotyping for application in marker-assisted breeding and germplasm management, and could be further enhanced to increase marker density for other applications like genetic association and genomic selection in bananas.

Biological soil crusts decrease infiltration but increase erosion resistance in a human-disturbed tropical dry forest.

Under continuous human disturbance, regeneration is the basis for biodiversity persistence and ecosystem service provision. In tropical dry forests, edaphic ecosystem engineering by biological soil crusts (biocrusts) could impact regeneration by influencing erosion control and soil water and nutrient fluxes, which impact landscape hydrology, geomorphology, and ecosystem functioning. This study investigated the effect of cyanobacteria-dominated biocrusts on water infiltration and aggregate stability in a human-modified landscape of the Caatinga dry forest (NE Brazil), a system characterized by high levels of forest degradation and increasing aridity. By trapping dust and swelling of cyanobacterial filaments, biocrusts can seal soil surfaces and slow down infiltration, which potentially induces erosion. To quantify hydraulic properties and erosion control, we used minidisc-infiltrometry, raindrop-simulation, and wet sieving at two sites with contrasting disturbance levels: an active cashew plantation and an abandoned field experiencing forest regeneration, both characterized by sandy soils. Under disturbance, biocrusts had a stronger negative impact on infiltration (reduction by 42% vs. 37% during regeneration), although biocrusts under regenerating conditions had the lowest absolute sorptivity (0.042 ± 0.02 cm s-1/2) and unsaturated hydraulic conductivity (0.0015 ± 0.0008 cm s-1), with a doubled water repellency. Biocrusts provided high soil aggregate stability although stability increased considerably with progression of biocrust succession (raindrop simulation disturbed: 0.19 ± 0.22 J vs. regenerating: 0.54 ± 0.22 J). The formation of stable aggregates by early successional biocrusts on sandy soils suggests protection of dry forest soils even on the worst land use/soil degradation scenario with a high soil erosion risk. Our results confirm that biocrusts covering bare interspaces between vascular plants in human-modified landscapes play an important role in surface water availability and erosion control. Biocrusts have the potential to reduce land degradation, but their associated ecosystem services like erosion protection, can be impaired by disturbance. Considering an average biocrust coverage of 8.1% of the Caatinga landscapes, further research should aim to quantify the contribution of biocrusts to forest recovery to fully understand the role they play in the functioning of this poorly explored ecosystem.

Exploration of the diversity of multi-drug resistant Mycobacterium tuberculosis complex in Lagos, Nigeria using WGS: Distribution of lineages, drug resistance patterns and genetic mutations

Multidrug-resistant (MDR) or extensively drug-resistant (XDR) Tuberculosis (TB) is a major challenge to global TB control. Therefore, accurate tracing of in-country MDR-TB transmission are crucial for the development of optimal TB management strategies. This study aimed to investigate the diversity of MTBC in Nigeria. The lineage and drug-resistance patterns of the clinical MTBC isolates of TB patients in Southwestern region of Nigeria were determined using the WGS approach. The phenotypic DST of the isolates was determined for nine anti-TB drugs. The sequencing achieved average genome coverage of 65.99X. The most represented lineages were L4 (n = 52, 83%), L1 (n = 8, 12%), L2 (n = 2, 3%) and L5 (n = 1, 2%), suggesting a diversified MTB population. In term of detection of M/XDR-TB, while mutations in katG and rpoB genes are the strong predictors for the presence of M/XDR-TB, the current study also found the lack of good genetic markers for drug resistance amongst the MTBC in Nigeria which may pose greater problems on local tuberculosis management efforts. This high-resolution molecular epidemiological data provides valuable insights into the mechanistic for M/XDR TB in Lagos, Nigeria.

SERS assisted sandwich immunoassay platforms for ultrasensitive and selective detection of human Thyroglobulin

We developed an immunoassay platform for the detection of human Thyroglobulin (Tg) to be integrated with fine-needle aspiration biopsy for early detection of lymph node metastases in thyroid cancer patients. The sensing platform detects Tg by a sandwich immunoassay involving a self-assembled surface-enhanced Raman scattering (SERS) substrate assisted by functionalized gold nanoparticles that provide additional Raman signal amplification and improved molecular specificity. Specifically, the SERS-active substrates were functionalized with Tg Capture antibodies and fabricated either on-chip or on optical fiber tips by nanosphere lithography. Gold nanoparticles were functionalized with Detection antibodies and conjugated with 4-mercaptobenzoic acid, which serves as a Raman reporter. The sandwich assay platform was validated in the planar configuration and a detection limit as low as 7 pg/mL was successfully achieved. Careful morphological examination of the SERS substrates before and after Tg measurements further assessed the effective capture of nanoparticles and correlated the average nanoparticle coverage with the Tg concentration obtained by SERS measurements. The sandwich assay was successfully demonstrated on washout fluids of fine needle aspiration biopsies from cancer patients and confirmed the high specificity of the proposed methodology when complex biological matrices are considered. Finally, SERS optrodes were fabricated and successfully used to detect Tg concentration by applying the same bio-recognition strategy and Raman interrogation through an optical fiber. This opens the possibility of transferring the Tg detection approach to the optical fiber tip to develop point-of-care platforms that can be directly integrated into fine needle aspiration biopsies.

Understanding Trends in Health Communication and Appropriate Design for Outstanding Research Outcome in Nigeria

This study evaluated the frequency of health communication issues published in Journal of Communication and Media Research (JCMR) as a percentage of the total publications, the dominant themes on health communication in the JCMR and the dominant research designs used in the studies on health communication in the JCMR. A qualitative research design was employed in this study with survey of literature in the JCMR. The study found that the average coverage of health communication by health communication scholars in JCMR. was the predominant thematic area of health communication covered by JCMR. It established that the theme of assessment and evaluation of health interventions and campaigns and the theme of Doctor-Patient Communication is the lowest area of attention. This can be justified by the fact that it is relatively a new area of health communication research in Nigeria. It was discovered that majority of researchers did not specify the research design employed in the various articles in JCMR while case study research was the dominant design that scholars used in JCMR.

Gaps in measles immunisation coverage for pre-school children in Aotearoa New Zealand: a cross-sectional study.

To evaluate gaps in measles immunisation coverage for children <5 years in Aotearoa New Zealand. In this cross-sectional study, we extracted coverage rates for the first measles, mumps and rubella (MMR1) vaccine and second MMR vaccine (MMR2) from the National Immunisation Register for birth cohorts 2017 to 2020. We described measles coverage rates per birth cohort, and stratified per district health board (DHB), ethnicity and deprivation quintile. Coverage for MMR1 declined from 95.1% for those born in 2017 to 88.9% for those born in 2020. The coverage for MMR2 was below 90% for all the birth cohorts, with the lowest MMR2 coverage in the birth cohort of 2018 (61.6%). MMR1 coverage was lowest for children of Māori ethnicity and coverage declined over time: 92.8% for those born in 2017 to 78.4% for those born in 2020. Six DHBs had average MMR1 coverage <90% including Bay of Plenty, Lakes, Northland, Tairāwhiti, West Coast and Whanganui. Immunisation coverage rates for measles are insufficient to prevent a potential measles outbreak in children <5 years. Concerningly, the coverage for MMR1 is declining, especially in Māori children. Catch-up immunisation programmes are urgently needed to improve immunisation coverage.

Impact of Paddy Field Reservoirs on Flood Management in a Large River Basin of Japan

The flood retention capacity of paddy fields is well-recognized in Japan, and all the existing flood control practices via paddy field management achieve reductions in peak flood discharge. However, the previous studies have not assessed the flood management potential of paddy fields in a large river basin with average paddy coverage, and the existing hydrological models are not quite suitable for simulating river discharge from closed-drainage paddy reservoir storage. We herein attempt to improve the watershed-scale version of global hydrological model H08 to simulate a reduction in the peak discharge from paddy reservoirs in the Abukuma River basin of Japan. The NSE and R2 index showed fair reliability of the H08 model during the calibration and validation stages. The simulated results from the improved model show 11% and 6% peak reductions in high paddy coverage areas for a normal year (2018) and a major typhoon year (2019), respectively. The peak-reduction percentage increased with decreasing rainfall, depending on the overflow from the paddy reservoirs. The results indicate that the paddy reservoir is not highly effective in a large river with less than 20% paddy coverage, but the peak discharge reduction capacity shows that paddy reservoirs can make some contribution when used in combination with dam operation.

International trade resilience with applied welfare economics: an analysis on personal protective equipment

A global crisis such as a pandemic causes a decrease in the global trade of medical supplies. One of the most significant issues healthcare workers and people face is the shortage of personal protective equipment (PPE) items. This study constructs the first international trade model to link infectious disease dynamics and global trade networks, considering the important relationship between government preparedness, domestic manufacturers, and consumers. We examine social welfare measures here in the presence of quantity controls and taxes on the global trade flows. An equilibrium coverage among countries is investigated that integrates net government revenue, purchasing cost, transportation cost, and the health cost caused by the shortage of PPE supply. We develop an optimisation model that balances domestic firms and the global trade network to satisfy the total demand for each traded PPE product. The proportional change in value-added on domestic production is also studied by considering the marginal manufacturing costs of a face mask. The results obtained from testing our model show that the average quantity coverage by the global trade networks among four countries decreased by up to using the proposed trade policy. Hence, a large amount of demand is met by relying on domestic production.

Comparison of chromatographic conditions for the targeted tandem mass spectrometric determination of 354 mammalian metabolites

Metabolomics is becoming increasingly popular in livestock research, but no single analytical method can cover the entire metabolome. As such, we compared similar and complementary chromatographic methods with respect to analyte coverage and chromatographic properties of mammalian metabolites. We investigated 354 biologically relevant primary metabolites from 19 compound classes including amino acids, bile acids, biogenic amines, carboxylic acids, lipids, nucleotides and sugars. A total of 2063 selected reaction monitoring transitions were optimized on a triple quadrupole mass spectrometer. We then determined the retention profiles and peak parameters of our compounds using an anion exchange chromatography (AIC), three reversed-phase (RP) and three hydrophilic interaction liquid chromatography (HILIC) methods. On average, HILIC methods covered 54% of all metabolites with retention factors >1, while average RP coverage was 41%. In contrast to RP, HILIC methods could also retain polar metabolites such as amino acids and biogenic amines. Carboxylic acids, nucleotides, and sugar related compounds were best separated by AIC or zwitterionic pHILIC with alkaline eluents. Combining two complementary HILIC and RP methods increased the library coverage to 92%. By further including important short chain fatty acids, a combination of HILIC, RP and AIC methods achieved a coverage of 97%. The resulting dataset of LC and MS/MS parameters will facilitate the development of tailor-made quantitative targeted LC-MS/MS methods to investigate the mammalian metabolome.

Bayesian sample size determination for coefficient of variation of normal distribution

Sample size determination is an active area of research in statistics. Generally, Bayesian methods provide relatively smaller sample sizes than the classical techniques, particularly average length criterion is more conventional and gives relatively small sample sizes under the given constraints. The objective of this study is to utilize major Bayesian sample size determination techniques for the coefficient of variation of normal distribution and assess their performance by comparing the results with the freqentist approach. To this end, we noticed that the average coverage criterion is the one that provides relatively smaller sample sizes than the worst outcome criterion. By comparing with the existing frequentist studies, we show that a smaller sample size is required in Bayesian methods to achieve the same efficiency.

Abstract 721: Vaccination barriers for HPV vaccine initiation and completion: A perception analysis using the Association of Immunization Managers annual survey

Abstract Background: Human Papillomavirus (HPV) is the most common sexually transmitted infection in the United States of America (USA) and it is associated with six types of cancers. Vaccines that protect against HPV infection have been introduced since 2006. Despite many national efforts, vaccination rates remain under 80% and many individual and systematic barriers influence HPV vaccine uptake and completion. Addressing the stem of these barriers at a national level and their regional differences, will help in understanding necessary policies for the acceptance of HPV vaccine. Objective: This study aims to describe the frequency of immunization program managers’ perceptions of the most relevant barriers to HPV vaccination in each national jurisdiction. Methods: Immunization Program Managers (IPMs) in the USA were surveyed from August 2021 to February 2022 as part of the Implementation of School-Entry Policies for Papilloma Virus Vaccination (HPV-PIVac) study with the collaboration of the Association of Immunization Managers. We gathered IPMs perceptions on the most relevant barriers to HPV vaccination within their jurisdiction. Four vaccine barriers were evaluated; for each one, IPMs reported the level (moderate, significant, no barrier) in a three-item scale. The three-item scale was merged into a two-item scale (low/high) and multiple answers from the same state were grouped. Descriptive analysis was performed for each question and results were mapped. Fisher’s exact test was performed to determine the relation between barriers. IPMs that refused or didn’t know their jurisdiction’s barriers were removed from the analysis. Results: 49 IPMs from 31 states and territories participated, resulting in a 53.4% participation rate. For the cost barrier to complete HPV vaccination of children, most IPMs perceived low barriers (51.7%) within their jurisdiction. For the perception of geographical difficulties to complete HPV vaccination, higher barriers (67.9%) were reported among participants. Limited number of providers offering the HPV vaccine was perceived equally as low or high level (50.0%), whereas lack of a strong provider recommendation or failure of providers to discuss and strongly recommend the HPV vaccine was the most significant barrier with a higher level (96.7%). Fisher’s exact test indicated independency between all barriers (p&amp;gt;0.05). For most variables, the Western region reported a greater level of barriers. Conclusion: This analysis documents the IPMs perception of prevalent HPV vaccine barriers for vaccine initiation and completion nationally. These results confirmed the need of further engagement for the accessibility of the vaccine, as preliminary data from NIS-Teen 2021 shows an average adolescent HPV vaccine initiation and UTD coverage of 78.2 and 62.7, respectfully. Funding: NCI Grant #R01CA232743 Citation Format: Alondra Katerina Mercado-Andino, Erick L. Suárez-Pérez, Olga L. Díaz-Miranda, Diana T. Medina-Labees, Ana P. Ortiz, Katelyn Wells, Vivian Colón-López. Vaccination barriers for HPV vaccine initiation and completion: A perception analysis using the Association of Immunization Managers annual survey [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2023; Part 1 (Regular and Invited Abstracts); 2023 Apr 14-19; Orlando, FL. Philadelphia (PA): AACR; Cancer Res 2023;83(7_Suppl):Abstract nr 721.

Abstract 3134: Calling somatic variants from UG100 data using deep learning

Abstract UG100 is a novel next-generation sequencing platform that combines high throughput with significantly lower sequencing cost. Previous studies have demonstrated broad applicability of UG100 data for whole-genome germline variant calling, single cell transcriptomics and whole-genome methylation analysis, as well as for recalling cancer signatures from cfDNA at very low fraction of circulating tumor DNA. Somatic variant calling is a natural application for this platform as it can benefit from lower sequencing cost to enable deeper sequencing coverage. Here, we describe the implementation and evaluation of a somatic calling pipeline from UG100 whole genome sequence data. Since deep-learning-based variant calling methods currently outperform statistical variant calling methods for germline variant calling on UG100 data, we cast somatic variant calling as a classification problem. Specifically, we trained a classifier to distinguish if a candidate at a particular location is a somatic variant or a sequencing error. We used a version of DeepVariant optimized for UG100 data to train the deep-learning classifier in three scenarios: tumor only, tumor with an unmatched background sample and matched tumor-normal samples. The labeled truth set for training was generated by mixing whole genome sequenced samples from the genome-in-a-bottle project in a wide range of proportions (0-100% mixing ratio) to simulate various allele frequencies, with an average genome coverage of 100x. The tumor/normal model was the best-performing of the three models with a recall of &amp;gt;98% for SNPs and 90% for Indels at allele fraction &amp;gt; 10%. Notably, the model also showed high specificity as well with 16 false positive SNPs and 19 false positive indels at AF over 10% called on the chromosome that was not part of the training (chr20). We then applied the model for calling from the WGS data on three well characterized pairs of matched tumor and normal cell lines: HCC1143, COLO829 and HCC1395. We evaluated the performance on the pre-defined UG-HCR (Ultima Genomics - High Confidence Region), which includes 95% of the human genome. DeepVariant models performed very well on calling SNPs (&amp;gt;92% recall at allele frequencies above 10%) and indels (&amp;gt;90% recall). The calls were also highly specific, with less than 1/Mb variants absent in the ground truth across the UG-HCR. Lastly, we applied the models to 8 unpaired cell lines with known driver mutations and observed that we call 34/34 driver mutations of length &amp;lt;=20 bp that appear in COSMIC (100% recall). We expect the UG100 sequencer to become an important tool for somatic genome analysis and to enable deep whole-genome sequencing to become a routine assay in clinical oncology. Citation Format: Maya Levy, Doron Shem-Tov, Hila Benjamin, Sima Benjamin, Ilya Soifer, Shlomit Gilad, Danit Lebanony, Nika Iremadze, Eti Meiri, Doron Lipson, Omer Barad. Calling somatic variants from UG100 data using deep learning [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2023; Part 1 (Regular and Invited Abstracts); 2023 Apr 14-19; Orlando, FL. Philadelphia (PA): AACR; Cancer Res 2023;83(7_Suppl):Abstract nr 3134.

Abstract 213: Phylogenetic reconstruction across 303 metastatic tumor samples using Ultima whole-genome sequencing dramatically increases subclonal resolution

Abstract Comprehensive characterization of tumor evolution is essential for understanding the drivers of metastasis and treatment resistance, which are still largely unknown. Studying evolution and resistance requires large cohorts of patients; for each patient, a comprehensive phylogenetic tree is used to follow clones over time and space. Deep whole-genome sequencing (WGS) enables the creation of more robust phylogenies, since (i) each clone is characterized by far more clone-specific mutations (compared to whole-exome or panel sequencing); and (ii) WGS yields more accurate clonal and sub-clonal allelic copy-number estimates, enabling more precise estimation of the fraction of cancer cells that harbor each mutation. Due to recent development of more affordable WGS by Ultima Genomics, we set out to test our ability to construct phylogenetic trees based on Ultima WGS. Ultima sequencing has demonstrated high sensitivity and specificity for detecting germline polymorphisms, but its performance on somatic mutation calling has not yet been rigorously studied. First, we adjusted our somatic mutation detection pipeline to work with Ultima-generated WGS data and tested its performance using well-studied cell line tumor/normal pairs. We assembled a ground truth set of somatic mutations based on deep sequencing data from multiple platforms for the breast cancer cell line pairs (HCC1954/HCC1954-BL and HCC1143/HCC1143-BL) and the melanoma tumor/normal cell line pair (COLO829/COLO829-BL). We found that mutation detection performance was on-par with other platforms for single nucleotide variations. Next, we identified 32 patients from various cancer types (breast, lung, cholangiocarcinoma, and melanoma) treated with a variety of therapies. We collected between 4 to 14 samples per patient at autopsy (total of 303), and sequenced them with Ultima to an average coverage of 63x (range 48x-91x). We identified mutations using our Ultima-adjusted WGS pipeline and constructed phylogenetic trees using our PhylogicNDT suite of tools. We then compared the results to trees previously constructed from mostly whole-exomes (and a few whole-genomes) sequenced on Illumina. We demonstrate that the trees generated from Ultima WGS data are consistent with the previously generated trees, and proved to be much more detailed. At commercialization, we anticipate that WGS for projects like this will be performed at ~1/6th the cost of current NGS offerings (on par with current WES costs). Therefore, it will enable larger studies and more accurate phylogenetic reconstruction, which will advance the study of tumor evolution and resistance. Citation Format: Julian Hess, Elizabeth Martin, Ilya Soifer, Hila Benjamin, Mendy Miller, Carrie Cibulskis, Brian P. Danysh, Matthew Coole, Stacey Gabriel, Dejan Juric, Doron Lipson, Gad Getz. Phylogenetic reconstruction across 303 metastatic tumor samples using Ultima whole-genome sequencing dramatically increases subclonal resolution [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2023; Part 1 (Regular and Invited Abstracts); 2023 Apr 14-19; Orlando, FL. Philadelphia (PA): AACR; Cancer Res 2023;83(7_Suppl):Abstract nr 213.

A review paper: optimal test cases for regression testing using artificial intelligent techniques

&lt;span lang="EN-US"&gt;The goal of the testing process is to find errors and defects in the software being developed so that they can be fixed and corrected before they are delivered to the customer. Regression testing is an essential quality testing technique during the maintenance phase of the program as it is performed to ensure the integrity of the program after modifications have been made. With the development of the software, the test suite becomes too large to be fully implemented within the given test cost in terms of budget and time. Therefore, the cost of regression testing using different techniques should be reduced, here we dealt many methods such as retest all technique, regression test selection technique (RTS) and test case prioritization technique (TCP). The efficiency of these techniques is evaluated through the use of many metrics such as average percentage of fault detected (APFD), average percentage block coverage (APBC) and average percentage decision coverage (APDC). In this paper we dealt with these different techniques used in test case selection and test case prioritization and the metrics used to evaluate their efficiency by using different techniques of artificial intelligent and describe the best of all.&lt;/span&gt;

Ultrasensitive Circulating Tumor DNA Pilot Study Distinguishes Complete Response and Partial Response With Immunotherapy in Patients With Metastatic Renal Cell Carcinoma.

Circulating tumor DNA (ctDNA) has been validated across multiple indications in the adjuvant and surveillance settings. We evaluated whether targeted digital sequencing (TARDIS) may distinguish a partial response (PR) from a complete response (CR) among patients with metastatic renal cell carcinoma (mRCC) receiving immune checkpoint inhibitor (ICI) therapy. Eligible patients had mRCC that yielded a PR or CR to ICI therapy. Peripheral blood was obtained at a single time point for ctDNA analysis. TARDIS was used for quantification of average variant allele fractions (VAFs). Our primary objective was to determine the association between VAFs and depth of response (PR v CR). A secondary objective was to determine whether VAFs were associated with disease progression. Twelve patients were analyzed, nine of whom achieved a PR (75%). Patients received either nivolumab monotherapy (50%) or nivolumab plus ipilimumab (50%). ctDNA analysis incorporated an average of 30 patient-specific mutations (range, 19-35); average coverage depth was 103,342 reads per target. TARDIS quantified a significant difference in VAFs between PR and CR (median, 0.181% [IQR, 0.077%-0.420%] v 0.007% [IQR, 0.0%-0.028%], respectively [P = .014]). Of the 12 patients in the series, six patients demonstrated radiographic progression subsequent to ctDNA assessment. Patients who progressed on subsequent scans had significantly higher ctDNA than those who maintained their response (median, 0.362% [IQR, 0.181%-2.71%] v 0.033% [IQR, 0.007%-0.077%], respectively [P = .026]). In this pilot study, TARDIS accurately differentiated PR from CR among patients with mRCC receiving immunotherapy, and also prospectively identified patients at risk for subsequent progression. Given these findings, we envision subsequent studies that validate these results and investigate the utility of this assay to discern appropriate candidates for discontinuation of immunotherapy.