Meat Authentication Research Articles

Authentication of camel meat using species-specific PCR and PCR-RFLP.

In India and some of the African countries, one of the unconventional meats receiving the latest attention in meat adulteration is camel meat. So, the objective of this study was to develop a species-specific PCR based on mitochondrial cytochrome b (CYTB) gene and a PCR-RFLP assay of mitochondrial 12S rRNA to identify camel meat in suspected samples. Known sample of camel meat, samples suspected to be from illegally slaughtered camel and known samples of cattle, buffalo, sheep, goat, pork and chicken were used in the study. DNA were extracted from all samples following spin column method and PCR amplification were carried out using both CYTB and 12S rRNA gene primers. The CYTB gene amplification produced amplicon with a size of 435bp without any non-specific spurious amplification towards other species studied. Further, the 12S rRNA PCR products were analysed both by sequencing and by RFLP using enzyme AluI. On BLAST analysis the 448bp sequence obtained from suspected samples showed > 99% sequence homology to previously reported Camelus dromedaries (accession no: AM 9369251.1). On AluI digestion of the 448bp product from both known and suspected camel samples, a specific RFLP pattern with three distinct products of 90, 148 and 210bp size were evident, which were significantly different from the pattern of cattle, sheep, goat, chicken and buffalo. Further, after in-house validation, this cost effective and rapid method of camel meat identification is placed into practice for regular screening of vetero-legal samples in the lab.

Determination of Adulteration and Authenticity of Meat and Meat Products Using Chemical Properties and PCR Technique in Tabriz

Determination of Adulteration and Authenticity of Meat and Meat Products Using Chemical Properties and PCR Technique in Tabriz

Assessment of carbonic anhydrase 3 as a marker for meat authenticity and performance of LC-MS/MS for pork content

In recent years, food fraud is a global issue that has raised wide public concern. Mass spectrometry techniques have a significant advantage of qualitatively and quantitatively analyzing food authenticity, especially for highly processed meat products. In this work, a simple and specific, rapid resolution liquid chromatography-tandem mass spectrometry (LC–MS/MS) method was developed and validated for the determination of pork content in processed meat products according to internal standard (ISTD) method. To improve the efficiency of sample preparation, simplified bead-beating and enzymolysis process were investigated. In contrast with different heat-stable and specific porcine-peptides, EPITVSSDQMAK, GGPLTAAYR, HDPSLLPWTASYDPGSAK from Carbonic anhydrase 3 proved to have an excellent quantitative ability, thus obtaining good linear relationship and satisfactory recovery. This method was successfully applied to different types of meat products, thus demonstrating that complex mixtures of pork content can be accurately quantified.

Analytical approaches of meat authentication in food

SummaryMeat industry sector is likely exposed to illegal practices which involve replacement of meat ingredients with other animal species. Meat products are commonly modified during processing, and the cases have been rampant in certain part of the world. Meanwhile, individual consumption patterns are affected by religious belief and health reason. For instance, Muslims and Jews are prohibited from consuming pork and allergic reaction to certain meat species affects choices of meat products. Thus, food authentication is vital as it offers protection to consumers from fraudulent act. Numerous authentication techniques have been developed to tackle food fraud issues. Authentication methods are categorised mainly as targeted analysis which provides quantitative outcome and non‐targeted analysis which offers qualitative result. In the present review, both targeted and non‐targeted analyses for meat species authentication are discussed based on previous research conducted using these methods and how they serve the purpose for authentication.

Authentication of Meat and Meat Products Using Triacylglycerols Profiling and by DNA Analysis.

Two alternative, complementary analytical strategies were successfully used to identify the most common meat species—beef, pork and chicken—in meat products. The first innovative high-throughput approach was based on triacylglycerols fingerprinting by direct analysis in real time coupled with high-resolution mass spectrometry (DART–HRMS). The second was the classic commonly used DNA analysis based on the use of nuclear or mitochondrial DNA in multiplex polymerase chain reaction (mPCR). The DART–HRMS method represents a rapid, high throughput screening method and was shown to have a good potential for the authentication of meat products. Nevertheless, it should be noted that due to a limited number of samples in this pilot study, we present here a proof of concept. More samples must be analyzed by DART–HRMS to build a robust classification model applicable for reliable authentication. To verify the DART–HRMS results, all samples were analyzed by PCRs. Good compliance in samples classification was documented. In routine practice under these conditions, screening based on DART–HRMS could be used for identification of suspect samples, which could be then examined and validated by accurate PCRs. In this way, saving of both labor and cost could be achieved. In the final phase, commercially available meat products from the Czech market were tested using this new strategy. Canned meats—typical Czech sausages and luncheon meats, all with declared content of beef, pork and chicken meat—were used. Compliance with the label declaration was confirmed and no adulteration was found.

Safety, Quality and Analytical Authentication of ḥalāl Meat Products, with Particular Emphasis on Salami: A Review.

Only some animal species could be transformed into ḥalāl salami and the raw meat must be obtained from ritually slaughtered animals. Several scientific studies have been conducted on ritual slaughtering practices and manufacturing of meat products for Jewish and Muslim religious communities; furthermore, many projects have been funded by the European Community on this topic. The authenticity and traceability of meat is one of the priorities of ḥalāl food certification systems. The pig matrix (meat and/or lard) may be fraudulently present in ḥalāl processed meat, as well as salami, for both economic and technological purposes; in fact, the use of these raw materials reflects the easier availability and their lower cost; furthermore, it allows manufacturers to obtain final products with better quality (sensory properties) and stability (especially with respect to oxidative reactions). The aim of this review is to discuss the qualitative and technological aspects of ḥalāl raw meat for dry fermented sausages (salami); moreover, this study focuses on the most recent studies carried out on the certification system and on the analytical methods performed in order to solve problems such as fraud and adulteration of ḥalāl salami and other halal meat foods.

Detection of some Meat Adulterants in a Raw Minced Meat Product Model using Frozen Tissue Microarray Technique

In recent years, interest in meat authenticity has been increased. Therefore, twelve groups of beef kofta product were formulated as soya bean, skin, skin emulsion and mechanically deboned poultry meat (MDPM); each of these substances was added with three different concentrations (40, 60 and 80%) in addition to control one. All group samples were subjected to two types of histological examination, conventional paraffin embedding method and frozen tissue microarray. The results of histological examination revealed that both techniques were accurate methods for identification of the separate components of the formulated product and considered extremely useful tools to judge its quality. Moreover, frozen tissue microarray was very helpful in obtaining the result in a short time and allows for examination of a large number of samples at the same time comparing to the conventional method. In addition, no hazard materials like formalin is used, also no ethyl alcohol or xylene is required in this technique. Therefore, microarray technique is reliable and practicable technique that could be used in food quality control laboratory to assess the quality and safety of meat products.

Simultaneous detection of pork and wild boar meat in chicken sausages using the combination of a single primer and real-time polymerase chain reaction (qPCR)

The identification of meat species in food products and pharmaceuticals is vital to minimize food adulteration practices. Due to its specificity, polymerase chain reaction (PCR)-based methods are the most commonly reported methods for detection of food adulterants. This study was aimed to evaluate the use of real-time PCR with a species-specific primer to identify two non-halal types of meat, namely pork and wild boar meat (WBM), in chicken sausages. The primer was designed using online software PrimerQuest from NCBI (National Center for Biotechnology Information) to target the mitochondrial ND1 gene of Sus scrofa domestica . The annealing temperature (Ta) of the primer used during real-time PCR analysis was optimized to achieve the highest response fluorescence unit at the lowest cycles. Real-time PCR using the primers of NK-ND1-Ssc1 (Forward: 5’ AAAGGACCCAACGTTGTAGG 3’ and Reverse: 5’ TAGTGCTAGGGATAAGGCTAGG 3’) was validated with several parameters, namely specificity, the limit of detection for sensitivity, linearity, efficiency, and repeatability. The optimum annealing temperature of NK-ND1-Ssc1 was 58.1 o C. The sensitivity evaluation revealed that the limits of detection (LoD) of pork and WBM in reference sausage samples containing 100% pork and WBM were 500 pg and 50 pg, respectively, which correspond to 0.3% meat in sausage products. The efficiency values of real-time PCR amplification were 93.1% and 94.8% for pork and WBM with coefficient variations of 0.2884% and 0.4998%, respectively. The validated method was subsequently applied to analyze the commercial samples, and among the twelve (12) samples evaluated, there was one sample positive of containing non-halal meat (pork or WBM). Real-time PCR using species-specific primers, e.g., NK-ND1-Ssc1, is specific and sensitive; therefore, this method can be used as an alternative technique for authentication of halal meat.

Development of a species-specific PCR coupled with lateral flow immunoassay for the identification of goose ingredient in foods

Meat authenticity testing along food supply chain can be largely improved through fast and integrated DNA-based identification methods. A species-specific polymerase chain reaction (PCR) coupled with lateral flow immunoassay (LFI) was developed for the identification of goose meat. The goose-specific primers that could specifically enrich a fragment on mitochondrial 12s RNA gene were successfully designed. The specificity of the primers was verified against 19 other species associated with meat fraud. The proposed PCR-LFI device was able to detect 0.01% (w/w) of goose in uncooked binary mixtures and 0.1% (w/w) in cooked binary mixtures. The LFI strip as a post-PCR visualization method was more sensitive and faster than gel electrophoresis method. Eight collaborative laboratories verified the reproducibility of fabrication and detection protocols of the developed LFI. This PCR-LFI method has great potential to be used as a fast and cost-efficient counter-measure for food industry and other regulatory bodies to reduce the possibility of fraud of goose products.

Authentication of meat and dairy products using rare earth element labeling and detection by solution based and laser ablation ICP-MS

In order to meet the increasing customer demand for local food products, various methods for verification of food origin by means of region specific trace element fingerprinting have been developed. However, for products from conventional agriculture, without a close relationship to the local soil, other methods for food authentication are required. In an alternative approach, foodstuffs produced in a certain region, by a specific producer or under certain conditions can be safeguarded against imitation by chemical labeling.The objective of the present study was to develop a method for labeling lamb meat and goat milk by selective enrichment of terbium and thulium in the feed for the animals. Therefore, a distinctive rare earth element (REE) pattern is artificially introduced which can be determined in labeled food products. Detection of REE labels was carried out using inductively coupled plasma mass spectrometry (ICP-MS) after acid digestion. Alternatively, laser ablation ICP-MS (LA-ICP-MS) was applied, allowing direct analysis of bone samples and analysis of meat and milk samples after dry ashing and pressing pellets.After three weeks of administering 1000-fold terbium and thulium enriched feed to lambs, terbium and thulium enrichment was detected in all sample types except blood, following the trend bones > kidney > liver > heart > meat > kidney fat. Similarly, goat milk was successfully labeled after three weeks of feeding 500-fold terbium and thulium enriched feed.Hence, the present method allows discrimination of labeled from unlabeled animal products, while REE contents in all labeled products remained low enough to avoid any health risk for the consumer.

Development and validation of a rapid kit for authenticity of murine meat in meat products with a species-specific PCR assay

ABSTRACTAdulteration of meat products with murine meat poses a huge threat to consumer health and leads to serious disruption in food markets. Species authentication of murine meat is still technically challenging. We, therefore, developed a species-specific PCR kit consisting of murine meat DNA extraction, PCR reaction and identifying systems. We designed novel universal primers targeting highly conserved region on mitochondrial cytochrome b gene (cyt b) from four murines (lab rats, lab mice, wild rat and wild mice), as well as specific primers for meat from four widely consumed animal species, cattle, sheep, duck and donkey. Simultaneously, pasmid inserted specific cyt b fragment was cloned and used as the internal positve control in the kit. The kit parameters of specificity, sensitivity, stability and validity were determined using mimic counterfeiting meatball. The specificity of the DNA detection kit was 100% in authentication of the four fraudulent meats of cattle, sheep, duck and donkey mixed murine meat. The minimum detection limit of the sample DNA was 0.1 μg. The kit, which had freeze-thawed up to 20 times and stored for 1 year, also was powerful in detecting an amount of 0.1 mg in artificial counterfeited cattle, sheep, duck and donkey meat products. The murine-species DNA detection kit proposed in this study has proved to be a simple, accurate and effective assay, and can be applied to the identification of murine meat traces in common edible meat, to ensure the realisable implementation of meat product market supervision.

Integration of handheld NIR and machine learning to “Measure & Monitor” chicken meat authenticity

By combining portable, handheld near-infrared (NIR) spectroscopy with state-of-the-art classification algorithms, we developed a powerful method to test chicken meat authenticity. The research presented shows that it is both possible to discriminate fresh from thawed meat, based on NIR spectra, as well as to correctly classify chicken fillets according to the growth conditions of the chickens with good accuracy. In all cases, the random subspace discriminant ensemble (RSDE) method significantly outperformed other common classification methods such as partial least squares-discriminant analysis (PLS-DA), artificial neural network (ANN) and support vector machine (SVM) with classification accuracy of >95%. This study shows that handheld NIR coupled with machine learning algorithms is a useful, fast, non-destructive tool to identify the authenticity of chicken meat. By comparing and combining different protocols to measure the NIR spectra (i.e., through packaging and directly on meat), we show the possibilities for both consumers and food inspection authorities to check the authenticity and origin of packaged chicken fillet.

A sensitive colorimetric immunoassay based on poly(dopamine) modified magnetic nanoparticles for meat authentication

Magnetic nanoparticles as solid substrate and polydopamine as coating polymer were combined for the construction of a sensitive colorimetric immunoassay aimed at the quantification of pork associated with meat fraud. In this study, a competitive assay was conducted between purified IgGs and porcine IgGs covalently immobilized on magnetic nanoparticles, for the binding sites of peroxidase-labelled antibody. The recognition of porcine IgG was monitored by a simple colorimetric method in the presence of peroxidase substrate. The performed immunoassay was successfully employed for the screening of pork in adulterated meat, allowing low level of 0.01% to be detected in short time of analysis. The specificity of the immunoassay was tested against five different meat species (pork, lamb, turkey, chicken and beef) and it was found to be highly specific towards pork. Furthermore, the used magnetic probe has maintained a satisfactory stability enabling sensitive detection of pork within 20 days of storage. With the versatility and facile-preparation of polydopamine modified magnetic nanoparticles as well as the easy handling of the whole assay, this colorimetric method provides a specific and sensitive in-field-test for the detection of pork in adulterated meat and thus verifying halal meat authenticity.

Monitoring of sausage products sold in Sichuan Province, China: a first comprehensive report on meat species\u2019 authenticity determination

Presently, there is growing concern worldwide regarding the adulteration of meat products. However, no reports on determining meat authenticity have been reported in China. To verify labelling compliance and evaluate the existence of fraudulent practices, 250 sausage samples were purchased from local markets in Sichuan Province and analysed for the presence of chicken, pork, beef, duck and genetically modified soybean DNA using real-time and end-point PCR methods, providing a Chinese case study on the problem of world food safety. In total, 74.4% (186) of the samples were properly labelled, while the other 25.6% (64) were potentially adulterated samples, which involved three illicit practices: product removal, addition and substitution. The most common mislabelling was the illegal addition of, or contamination with, duck. Therefore, meat authenticity monitoring should be routinely conducted. Additionally, the strict implementation of the nation’s food safety laws, along with regular surveillance, should be compulsory to alleviate and deter meat adulteration.

Discriminating muscle type of selected game species using near infrared (NIR) spectroscopy

In this study near infrared (NIR) spectroscopy was used to discriminate between different muscle types within each species of selected game animals, and to classify species regardless of the muscle. Muscle steaks from longissimus thoracis et lumborum (LTL) located at the 6th rib of the carcasses, infraspinatus (IS) and supraspinatus (SS) located on the forequarter, and biceps femoris (BF), semitendinosus (ST) and semimembranosus (SM) located on the hindquarter of impala and eland species; and samples from fan fillet (FF), big drum (BD), triangle steak (TS), moon steak (MS) and rump steak (RS) of ostrich species were scanned with a handheld NIR spectrophotometer in the spectral range of 908–1700 nm. Spectra were pre-treated with different pre-processing methods and classification models were developed using partial least squares discriminant analysis (PLS-DA). Classification accuracies were higher when the muscles were grouped according to their anatomical location in the carcass, than attempting to classify them separately. Classification accuracies ranging from 85.0 to 100% were achieved throughout, with forequarter muscles yielding the highest classification accuracy rate for both impala and eland species. Furthermore, when the species were discriminated regardless of muscles, PLS-DA models pre-treated with SNV-Detrend and Savitzky-Golay 1st derivative yielded accuracies of 97, 81 and 92% for eland, impala and ostrich, respectively. These results indicate that NIR spectroscopy can be used for the authentication of game meat, specifically impala, eland and ostrich. Furthermore, it was easier to discriminate species regardless of the muscle used than different muscles within each species.

LIQUID CHROMATOGRAPHY–MASS SPECTROMETRY BOTTOM‐UP PROTEOMIC METHODS IN ANIMAL SPECIES ANALYSIS OF PROCESSED MEAT FOR FOOD AUTHENTICATION AND THE DETECTION OF ADULTERATIONS

This review offers an overview of the current status and the most recent advances in liquid chromatography-mass spectrometry (LC-MS) techniques with both high-resolution and low-resolution tandem mass analyzers applied to the identification and detection of heat-stable species-specific peptide markers of meat in highly processed food products. We present sets of myofibrillar and sarcoplasmic proteins, which turned out to be the source of 105 heat-stable peptides, detectable in processed meat using LC-MS/MS. A list of heat-stable species-specific peptides was compiled for eleven types of white and red meat including chicken, duck, goose, turkey, pork, beef, lamb, rabbit, buffalo, deer, and horse meat, which can be used as markers for meat authentication. Among the 105 peptides, 57 were verified by multiple reaction monitoring, enabling identification of each species with high specificity and selectivity. The most described and monitored species by LC-MS/MS so far are chicken and pork with 26 confirmed heat-stable peptide markers for each meat. In thermally processed samples, myosin, myoglobin, hemoglobin, l-lactase dehydrogenase A and β-enolase are the main protein sources of heat-stable markers. © 2019 John Wiley & Sons Ltd. Mass Spec Rev.

Real‐time PCR based on single‐copy housekeeping genes for quantitative detection of goat meat adulteration with pork

SummaryAdulteration of goat meat with cheaper meat such as pork has been frequently found. Conventional PCR methods to distinguish goat meat from adulteration are qualitative, which easily produce false‐positive results due to contamination but not adulteration. To address this problem, real‐time PCR based on single‐copy housekeeping genes encoding replication protein A1 was developed for goat meat and pork. By calculating the Ct ratio of goat meat/pork, the goat meat content in a suspected adulteration could be deduced by a good linear correlation (R2 = 0.9868) in a range from 5% to 80%. Analysis of the simulated samples of goat meat showed high accuracy with recoveries of 104.91% and 105.00% for the goat meat contents of 40% and 60%, respectively, and coefficient of variations were as low as 9.24% and 9.09%. Thus, the developed assay supplied a useful tool for food regulation authorities to achieve quantitative authentication of goat meat.

Specific PCR method for detection of species origin in biochemical drugs via primers for the ATPase 8 gene by electrophoresis

A PCR method is described to identify the species origin of various animal and human tissue-derived biochemical drugs. Four commercialized drugs, including spermary tablets, compound embryonic bovine liver extract tablets, spleen aminopeptide solution, and placenta polypeptide injection, were used as a proof-of-principle in this study. Primers were designed to amplify conservative regions of mitochondrial cytochrome b and ATPase 8 genes from beef, pork, lamb and human DNA, respectively. The specificity of primers for ATPase 8 gene is found to be higher than those for cytochrome b under the given experimental conditions. The amplicon sizes of ATPase 8 were 212, 271, 293 and 405bp for pork, beef, lamb and human tissue, respectively. The minimum detectable concentration of DNA sample for species identification is 0.05-0.5pg·μL-1. The species origin can be distinguished by this method in extremely low concentrations of template DNAs extracted. Conceivably, this PCR method for meat authentication may be extended to quality control of other biochemical drugs and raw materials. Graphical abstract A specific PCR method was developedfor thedetection of species origin in biochemical drugs via species-specific primers targeting mitochondrial ATPase 8 genes. The PCR products were separated by gel electrophoresis and species origins were indicated by comparison to references.

Improved gel-enhanced liquid chromatography-mass spectrometry by chemometrics for halal proteomics

Numerous analytical methods for the authentication of halal meat are now well established, with gel-enhanced liquid chromatography-mass spectrometry (GeLCMS) being a popular approach. However, the selection of potential protein markers on 1-dimensional gel electrophoresis (1DE) prior to LCMS is considered problematic, because using the optical density for the selection process could introduce human error. In this study, an improved GeLCMS method assisted by multivariate principal component analysis (PCA) was developed to identify the potential protein markers for non-halal pork among halal beef and chicken. The improved GeLCMS technique allowed for the confident excising of identified protein bands prior to in-gel tryptic digestion. The inferential protein markers (myofibrillar proteins), which might be present in the samples, were determined based on the identified sequence of peptides. This chemometric-assisted GeLCMS could potentially be used as a guideline to assist chemists in analysis of any gel-based separation of biomolecules, regardless of the field of study.

Colorimetric Detection of Horse Meat Based on Loop-Mediated Isothermal Amplification (LAMP)

Meat authentication and meat adulteration have become a growing global concern leading to consumers’ demand for accurate meat identification methods. Since existing methods for meat identification are cumbersome and require specialized equipment and/or training, we developed a specific colorimetric detection method that can rapidly identify horse meat as few as 0.1% contamination in xenogeneic meat sources within 1 h with no false-positive signals observed. Specificity analysis revealed no cross-reactivity with 14 other animal species. Therefore, a rapid on-site survey based on our method can be set up to identify undeclared meat in the food supply chain and contributes to an approach on food analysis by meeting the demands for quick and easy-to-perform analytical methods.