Asymmetric PCR Research Articles

TaqMan probes as blocking agents for enriched PCR amplification and DNA melting analysis of mutant genes.

Asymmetric PCR and DNA melting analysis with TaqMan probes applied for mutation detection is effectively used in clinical diagnostics. The method is simple, cost-effective, and carried out in a closed-tube format, minimizing time, labor, and risk of sample cross-contamination. Although DNA melting analysis is more sensitive than Sanger sequencing (mutation detection thresholds are ~5% and 15%-20%, respectively), it is less sensitive than more labor-intensive and expensive techniques such as pyrosequencing and droplet digital PCR. Here, we demonstrate that, under specially selected conditions of asymmetric PCR, TaqMan probes can play the role of blocking agents. Preferential blocking of the wild-type allele brings about enriched amplification of mutant alleles. As a result, an ~10-fold increase in the detection sensitivity for mutant BRAF and NRAS genes was achieved.

BioSpotlight / Citations

BioSpotlight / Citations

Poly(A) polymerase I participates in the indole regulatory pathway of Pantoea agglomerans YS19.

Pantoea agglomerans YS19 is a preponderant endophytic bacterium isolated from rice. It is characterized by the formation of symplasmata, a type of multicellular aggregate structure, contributing to a strong stress resistance and specific adaptation of YS19 in endophyte-host associations. Indole is an important signal molecule in intra- or interspecies relationships, regulating a variety of bacterial behaviours such as cell aggregation and stress resistance; however, the regulatory mechanism remains an ongoing area of investigation. This study selected YS19 as a model strain to construct a mutant library, utilizing the mTn5 transposon mutagenesis method, thus obtaining a positive mutant with an indole-inhibited mutation gene. Via thermal asymmetric interlaced PCR, the mutational site was identified as the gene of pcnB, which encodes the poly(A) polymerase I to catalyse the polyadenylation of RNAs. The full length of the pcnB sequence was 1332 bp, and phylogenetic analysis revealed that pcnB is extremely conserved among strains of P. agglomerans. The expression of the gene was significantly inhibited (by 36.6 % as detected via quantitative PCR) by indole (0.5 mM). Many physiological behaviours of YS19 were affected by this mutation: the cell decay rate in the post-stationary growth phase was promoted, symplasmata formation and motility were inhibited in the late stationary growth phase and the colonization ability and growth-promoting effect of YS19 on the host plant were also inhibited. This study discusses the indole regulatory pathways from the point of RNA post-transcriptional modification, thus enriching our knowledge of polyadenylation and expanding current research ideas of indole regulation.

Essential strategies to optimize asymmetric PCR conditions as a reliable method to generate large amount of ssDNA aptamers.

Asymmetric PCR, a simple method to generate single-stranded DNA (ssDNA) aptamers in systematic evaluation of ligand by exponential enrichments rounds, is coupled with limitations. We investigated the essential strategies for optimization of conditions to perform a high-quality asymmetric PCR. Final concentrations of primers and template, the number of PCR cycles, and annealing temperature were selected as optimizing variables. The qualities of visualized PCR products were analyzed by ImageJ software. The highest proportion of interested DNA than unwanted products was considered as optimum conditions. Results revealed that the best values for primers ratio, final template concentration, annealing temperature, and PCR cycles were, respectively, 30:1, 1 ng/μL, 55°C, and 20 cycles for the first and 50:1, 2 ng/μL, 59°C, and 20 cycles for other rounds. No significant difference was found between optimized asymmetric PCR results in the rounds of two to eight (P > 0.05). The ssDNA quality in round 10 was significantly better than other rounds (P < 0.05). Generally, the ssDNA product with less dimers, double-stranded DNA (dsDNA), and smear are preferable. The dsDNA contamination is the worst, because it can act as antidote and inhibits aptameric performance. Therefore, to choose the best conditions, the lower amount of dsDNA is more important than other unwanted products.

Scanning for KRAS, NRAS, BRAF, and PIK3CA mutations by DNA melting analysis with TaqMan probes

Scanning for mutations by DNA melting analysis (DMA) is based on asymmetric PCR followed by the melting of duplexes formed by single-stranded amplicons with TaqMan probes. The method is optimally suited for clinical genetic testing; it is easy to perform, high-throughput, and sensitive. The detection limit of mutant alleles by the DMA method is about 3%, which is much higher than the sensitivity of Sanger sequencing. In addition, the DMA method is realized in a closed-tube format, while 2-h assay is carried out in a single tube without any intermediate or additional procedures thereby minimizing the risk of cross contamination of the samples. The validation of the DMA method was performed by scanning for mutations of clinically significant genes KRAS, NRAS, BRAF, and PIK3CA in 324 DNA samples from tumors of patients with melanoma, colorectal and lung cancer. DNA was isolated either directly from tumor tissues, or from formalin-fixed paraffin-embedded tumor tissues. The detected mutations were verified by Sanger sequencing. The spectra of mutations identified in each tumor type correspond to the literature data and, thus, validate the use of DMA.

Rare allele enrichment and detection by allele-specific PCR, competitive probe blocking and melting analysis

Protocol Summary We have combined allele-specific PCR, competitive probe blocking, asymmetric PCR, and melting analysis to enhance rare allele detection in a homogeneous system. Unlabeled, dual hybridization or molecular beacon probes were used for competitive blocking of the wild-type allele at a concentration 10 times that of the allele-specific primer. In each case, rare alleles were detected by probe melting analysis at a sensitivity of &gt;0.001% (1 variant copy within 100,000 wild-type copies), providing single copy detection in typical PCRs. Ninety-one thyroid biopsies were tested for the BRAF mutation p.V600E (c.1799 T &gt; A) by both dual hybridization probes without enrichment and an allele-specific, competitive blocking melting analysis with unlabeled probes. Eighty-seven samples were concordant between methods (43 positive, 44 negative), while 4 samples that were negative by direct analysis became positive after enrichment. Probes that both block wild-type amplification and detect rare variants by melting analysis improve the detection sensitivity of allele-specific PCR for rare alleles. In particular, melting analysis using unlabeled probes and amplification by rapid-cycle PCR provides cost-effective and fast enrichment and detection of rare alleles.

Digitally encoded silica microparticles for multiplexed nucleic acid detection.

A robust high throughput suspension array was proposed to analyze biomolecules. To exploit its capacity for nucleic acid detection, we designed a multiplex nested asymmetric PCR (MNAS PCR) that can produce single stranded DNA (ssDNA) efficiently without complicated optimization. Multiplexed HPV genotyping was demonstrated with high selectivity, high sensitivity and rapid hybridization within 20 minutes.

Implications of Stisa2 catalytic residue restoration through site directed mutagenesis

Abstract Objective Restoration of catalytic activity of Isa2 from Solanum tuberosum (Stisa2) through restoration of conserved catalytic residues by site directed mutagenesis. Methods The six conserved amino acid residues absent in the Stisa2 gene were restored by mutation using the overlap extension PCR and the asymmetrical overlap extension PCR methods. Next, mutant Stisa2 with restored catalytic residues was expressed in E. coli Rosetta 2 under optimized conditions. Evaluation of debranching activity on starch, amylopectin and β-limit dextrin was carried out by measuring the amount of glucose equivalents released using the bicinchoninic acid assay. Results Both qualitative and quantitative analysis showed that the restoration of the conserved residues in the catalytic site did not restore starch debranching activity. Molecular modeling showed greater than expected distances between the catalytic triad in mutant Stisa2. These additional distances are likely to prevent hydrogen bonding which stabilizes the reaction intermediate, and are critical for catalytic activity. Conclusions These results suggest that during evolution, mutations in other highly conserved regions have caused significant changes to the structure and function of the catalytic network. Catalytically inactive Isa2, which is conserved in starch-producing plants, has evolved important non-catalytic roles such as in substrate binding and in regulating isoamylase activity.

Agrobacterium tumefaciens-mediated transformation as an efficient tool for insertional mutagenesis of Cercospora zeae-maydis

An efficient Agrobacterium tumefaciens-mediated transformation (ATMT) approach was developed for the plant pathogenic fungus, Cercospora zeae-maydis, which is the causative agent of gray leaf spot in maize. The transformation was evaluated with five parameters to test the efficiencies of transformation. Results showed that spore germination time, co-cultivation temperature and time were the significant influencing factors in all parameters. Randomly selected transformants were confirmed and the transformants were found to be mitotically stable, with single-copy T-DNA integration in the genome. T-DNA flanking sequences were cloned by thermal asymmetric interlaced PCR. Thus, the ATMT approach is an efficient tool for insertional mutagenesis of C. zeae-maydis.

An innovative SNP genotyping method adapting to multiple platforms and throughputs.

An innovative genotyping method designated as semi-thermal asymmetric reverse PCR (STARP) was developed for genotyping individual SNPs with improved accuracy, flexible throughputs, low operational costs, and high platform compatibility. Multiplex chip-based technology for genome-scale genotyping of single nucleotide polymorphisms (SNPs) has made great progress in the past two decades. However, PCR-based genotyping of individual SNPs still remains problematic in accuracy, throughput, simplicity, and/or operational costs as well as the compatibility with multiple platforms. Here, we report a novel SNP genotyping method designated semi-thermal asymmetric reverse PCR (STARP). In this method, genotyping assay was performed under unique PCR conditions using two universal priming element-adjustable primers (PEA-primers) and one group of three locus-specific primers: two asymmetrically modified allele-specific primers (AMAS-primers) and their common reverse primer. The two AMAS-primers each were substituted one base in different positions at their 3' regions to significantly increase the amplification specificity of the two alleles and tailed at 5' ends to provide priming sites for PEA-primers. The two PEA-primers were developed for common use in all genotyping assays to stringently target the PCR fragments generated by the two AMAS-primers with similar PCR efficiencies and for flexible detection using either gel-free fluorescence signals or gel-based size separation. The state-of-the-art primer design and unique PCR conditions endowed STARP with all the major advantages of high accuracy, flexible throughputs, simple assay design, low operational costs, and platform compatibility. In addition to SNPs, STARP can also be employed in genotyping of indels (insertion-deletion polymorphisms). As vast variations in DNA sequences are being unearthed by many genome sequencing projects and genotyping by sequencing, STARP will have wide applications across all biological organisms in agriculture, medicine, and forensics.

Cloning, expression and characterization of a cold-adapted endo-1, 4-β-glucanase from Citrobacter farmeri A1, a symbiotic bacterium of Reticulitermes labralis.

BackgroundMany biotechnological and industrial applications can benefit from cold-adapted EglCs through increased efficiency of catalytic processes at low temperature. In our previous study, Citrobacter farmeri A1 which was isolated from a wood-inhabiting termite Reticulitermes labralis could secrete a cold-adapted EglC. However, its EglC was difficult to purify for enzymatic properties detection because of its low activity (0.8 U/ml). The objective of the present study was to clone and express the C. farmeri EglC gene in Escherichia coli to improve production level and determine the enzymatic properties of the recombinant enzyme.MethodsThe EglC gene was cloned from C. farmeri A1 by thermal asymmetric interlaced PCR. EglC was transformed into vector pET22b and functionally expressed in E. coli. The recombination protein EglC22b was purified for properties detection.ResultsSDS-PAGE revealed that the molecular mass of the recombinant endoglucanase was approximately 42 kDa. The activity of the E. coli pET22b-EglC crude extract was 9.5 U/ml. Additionally, it was active at pH 6.5–8.0 with an optimum pH of 7.0. The recombinant enzyme had an optimal temperature of 30–40 °C and exhibited >50% relative activity even at 5 °C, whereas it lost approximately 90% of its activity after incubation at 60 °C for 30 min. Its activity was enhanced by Co2+ and Fe3+, but inhibited by Cd2+, Zn2+, Li+, Triton X-100, DMSO, acetonitrile, Tween 80, SDS, and EDTA.ConclusionThese biochemical properties indicate that the recombinant enzyme is a cold-adapted endoglucanase that can be used for various industrial applications.

Construction and optimization of an efficient amplification method of a random ssDNA library by asymmetric emulsion PCR.

Construction of a random ssDNA sublibrary is an important step of the aptamer screening process. The available construction methods include asymmetric PCR, biotin–streptavidin separation, and lambda exonuclease digestions, in which PCR amplification is a key step. The main drawback of PCR amplification is overamplification increasing nonspecific hybridization among different products and by‐products, which may cause the loss of potential high‐quality aptamers, inefficient screening, and even screening failure. Cycle number optimization in PCR amplification is the main way to avoid overamplification but does not fundamentally eliminate the nonspecific hybridization, and the decreased cycle number may lead to insufficient product amounts. Here, we developed a new method, “asymmetric emulsion PCR,” which could overcome the shortcomings of conventional PCR. In asymmetric emulsion PCR, different templates were separated by emulsion particles, allowing single‐molecule PCR, in which each template was separately amplified, and the nonspecific hybridization was avoided. Overamplification or formation of by‐products was not observed. The method is so simple that direct amplification of 40 or more cycles can provide a high‐quality ssDNA library. Therefore, the asymmetric emulsion PCR would improve the screening efficiency of systematic evolution of ligands by exponential enrichment.

Rapid Construction of Recombinant Plasmids by QuickStep-Cloning.

QuickStep-Cloning is a novel molecular cloning technique that builds upon the concepts of asymmetric PCR and megaprimer-based amplification of whole plasmid. It was designed specifically to address the major drawbacks of previously reported cloning methods. The fully optimized protocol allows for a seamless integration of a long DNA fragment into any position within a plasmid of choice, in a time-efficient and cost-effective manner, without the need of a tedious DNA gel purification, a restriction digestion, and an enzymatic ligation. QuickStep-Cloning can be completed in less than 6 h, significantly faster than most of the existing cloning methods, while retaining high efficiency.

Development and evaluation of an unlabeled probe high-resolution melting assay for detection of ATP7B mutations in Wilson's disease.

Wilson's disease (WD) is a rare autosomal recessive disorder characterized by the deposition of copper mainly in the liver or nerve system that leads to their dysfunction. Mutations in the gene encoding ATPase, Cu+ transporting, beta polypeptide (ATP7B) are causative for WD. The aim of this study was to develop a rapid and convenient assay for detection of the three most common causative ATP7B mutations, p.R778L, p.P992L, and p.V1106I. Plasmids containing DNA fragments harboring each of the three ATP7B mutations were constructed. High-resolution melting (HRM) analysis was conducted by asymmetric polymerase chain reaction (PCR) amplification with paired primer and unlabeled probe, performed in a 96-well plate formatted LightCycler 480 Real-Time PCR System. The assay was evaluated for accuracy and reproducibility by genotyping of 41 WD cases. The unlabeled probe HRM assays performed on constructs with the p.R778L, p.P992L, and p.V1106I mutations in the ATP7B gene resulted in additional melting peaks. According to the unlabeled probe HRM molecular signature, we could differentiate homozygous mutations from wild-type with the ΔTm (difference between melting temperatures) >4°C, and the coefficient of variation in repeatability tests was <5%. In the validation assay using our method to examine clinical samples, a 100% accuracy rate was achieved. The newly developed assay to rapidly genotype the ATP7B mutations is convenient, accurate, and reproducible, and represents a favorable alternative to Sanger sequencing in the identification of specific ATP7B mutations.

Rapid Detection of FKS-Associated Echinocandin Resistance in Candida glabrata.

A novel and highly accurate diagnostic assay platform was established for rapid identification of FKS mutations associated with echinocandin resistance in Candida glabrata The assay platform uses allele-specific molecular beacon and DNA melt analysis following asymmetric PCR. A dual assay for FKS1 and FKS2 was developed to identify within 3 h the most common and clinically relevant resistance-associated mutations, including 8 FKS1 HS1 (wild type [WT], S629P, F625S, D632Y, D632E [T1896G], D632E [T1896A], I634V, and F625F) and 7 FKS2 HS1 (WT, F659del, F659S, F659V, F659L, S663P, and S663F) genotypes. A blinded panel of 188 C. glabrata clinical isolates was tested by both assays. The molecular diagnostic results from the dual assay were 100% concordant with data obtained from DNA sequencing. This platform has the potential to overcome the deficiencies of existing in vitro susceptibility-based assays to identify echinocandin-resistant C. glabrata and holds promise as a surrogate diagnostic method to better direct echinocandin therapy.

A signal-amplified electrochemical DNA biosensor incorporated with a colorimetric internal control for Vibrio cholerae detection using shelf-ready reagents

A novel enzyme/nanoparticle-based DNA biosensing platform with dual colorimetric/electrochemical approach has been developed for the sequence-specific detection of the bacterium Vibrio cholerae, the causative agent of acute diarrheal disease in cholera. This assay platform exploits the use of shelf-stable and ready-to-use (shelf-ready) reagents to greatly simplify the bioanalysis procedures, allowing the assay platform to be more amenable to point-of-care applications. To assure maximum diagnosis reliability, an internal control (IC) capable of providing instant validation of results was incorporated into the assay. The microbial target, single-stranded DNA amplified with asymmetric PCR, was quantitatively detected via electrochemical stripping analysis of gold nanoparticle-loaded latex microspheres as a signal-amplified hybridization tag, while the incorporated IC was analyzed using a simplified horseradish peroxidase enzyme-based colorimetric scheme by simple visual observation of enzymatic color development. The platform showed excellent diagnostic sensitivity and specificity (100%) when challenged with 145 clinical isolate-spiked fecal specimens. The limits of detection were 0.5ng/ml of genomic DNA and 10 colony-forming units (CFU)/ml of bacterial cells with dynamic ranges of 0–100ng/ml (R2=0.992) and log10 (1–104 CFU/ml) (R2=0.9918), respectively. An accelerated stability test revealed that the assay reagents were stable at temperatures of 4–37°C, with an estimated ambient shelf life of 200 days. The versatility of the biosensing platform makes it easily adaptable for quantitative detection of other microbial pathogens.

A novel amidase from Brevibacterium epidermidis ZJB-07021: gene cloning, refolding and application in butyrylhydroxamic acid synthesis.

A novel amidase gene (bami) was cloned from Brevibacterium epidermidis ZJB-07021 by combination of degenerate PCR and high-efficiency thermal asymmetric interlaced PCR (hiTAIL-PCR). The deduced amino acid sequence showed low identity (≤55%) with other reported amidases. The bami gene was overexpressed in Escherichia coli, and the resultant inclusion bodies were refolded and purified to homogeneity with a recovery of 22.6%. Bami exhibited a broad substrate spectrum towards aliphatic, aromatic and heterocyclic amides, and showed the highest acyl transfer activity towards butyramide with specific activity of 1331.0±24.0U mg(-1). Kinetic analysis demonstrated that purified Bami exhibited high catalytic efficiency (414.9mM(-1) s(-1)) for acyl transfer of butyramide, with turnover number (K cat) of 3569.0s(-1). Key parameters including pH, substrate/co-substrate concentration, reaction temperature and catalyst loading were investigated and the Bami showed maximum acyl transfer activity at 50°C, pH 7.5. Enzymatic catalysis of 200mM butyramide with 15μgmL(-1) purified Bami was completed in 15min with a BHA yield of 88.1% under optimized conditions. The results demonstrated the great potential of Bami for the production of a variety of hydroxamic acids.

Abstract 497: PIK3CA mutational status in circulating tumor cells (CTCs) and corresponding circulating tumor DNA in breast cancer patients

Abstract AIMS: Molecular characterization of Circulating Tumor Cells (CTCs) and analysis of circulating tumor DNA (ctDNA) in cancer patients holds promise as an extremely powerful and reliable non-invasive clinical tool for the individual molecular profiling of each patient in real time. The phosphatidylinositol 3-kinase (PI3K)/AKT signaling pathway is implicated in human cancers, and somatic mutations in the p110α catalytic subunit of PI3K, are very frequent and play a crucial role in response to molecular targeted therapies in breast cancer. In this study, we analyzed PIK3CA hotspot mutations (1633 G&amp;gt;A, 3140 A&amp;gt;G) in CTCs and corresponding ctDNA of early and metastatic breast cancer patients. We also examined whether there is a correlation between the presence of PIK3CA mutations in CTCs and ctDNA. METHODS: We used our highly sensitive methodology for the detection of PIK3CA hotspot mutations in exons 9 (1633 G&amp;gt;A) and 20 (3140 A&amp;gt;G), based on a combination of allele-specific PCR, asymmetric rapid PCR and high resolution melting analysis (HRMA) (Markou et al, CCR 2014). We analyzed PIK3CA hotspot mutations in the EpCAM-positive CTCs fraction and the corresponding plasma samples of: i) a group of 19 patients with operable breast cancer, ii) a group of 40 breast cancer patients with verified metastasis and iii) 30 healthy female volunteers. All ctDNA samples (extracted from 2 ml plasma) were examined for their DNA quality; to verify DNA quality, primers specific for the wild type in exactly the same PIK3CA gene region for exon 9 were used to assess for hotspots mutations. The mutation status of PIK3CA gene in ctDNA samples was detected by the developed methodology exactly as previously described. All samples were analyzed in triplicate. RESULTS: The assay is highly sensitive as it can detect 0.05% of mutated dsDNA in the presence of 99.95% wtDNA for both exons (9 and 20) and highly specific (0/30 healthy donors). PIK3CA hotspot mutations were identified in ctDNA in 12/40 (30%) of metastasis-verified breast cancer patients and 4/19 (21%) of operable breast cancer patients. In metastasis-verified breast cancer patients, the concordance between EpCAM- positive CTCs and ctDNA for 1633 G&amp;gt;A mutation was 72.5%, whereas the corresponding concordance for the 3140 A&amp;gt;G mutation was 97.5%. In operable breast cancer patients, the concordance between EpCAM-positive CTCs and ctDNA for the 1633 G&amp;gt;A mutation was 80%, whereas the corresponding concordance for the 3140 A&amp;gt;G mutation was 100%. CONCLUSIONS: Detection of PIK3CA hotspot mutations in EpCAM-positive CTCs and corresponding ctDNA has shown a correlation both in metastasis-verified and operable breast cancer patients. We will further evaluate our findings in a large cohort of patients before and after treatment, to evaluate response to molecular targeted therapies in breast cancer. Citation Format: Elena Tzanikou, Athina Markou, Nikos Malamos, Vasilis Georgoulias, Evi S. Lianidou. PIK3CA mutational status in circulating tumor cells (CTCs) and corresponding circulating tumor DNA in breast cancer patients. [abstract]. In: Proceedings of the 107th Annual Meeting of the American Association for Cancer Research; 2016 Apr 16-20; New Orleans, LA. Philadelphia (PA): AACR; Cancer Res 2016;76(14 Suppl):Abstract nr 497.

Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

Increase in the Prevalence of Resistance Determinants to Trimethoprim/Sulfamethoxazole in Clinical Stenotrophomonas maltophilia Isolates in China.

AimsThis study was carried to reveal the genetic mechanisms of trimethoprim/sulfamethoxazole (SXT) resistance.MethodsAmong 300 clinical Stenotrophomonas maltophilia isolates from China, resistance determinants such as sul and dfrA genes, integrons and transposase were examined using PCR, DNA sequencing and thermal asymmetric interlaced PCR (TAIL-PCR). Data were analyzed using SPSS 20.0.ResultsOf the 300 isolates, 116 (38.7%) were resistant to SXT. An alarming trend of increased resistance to SXT were found over the 10-year period. The positive rates of sul and class 1 integrase (intI1) increased gradually with the development of SXT resistance over the 10-year period. Multiple logistic regression analyses indicated that the genes of qacEΔ1-sul1 (81% vs 46.2%, p = 0.000), sul2 (50.9% vs 9.8%, p = 0.000), intI1 (83.6% vs 65.8%, p = 0.000), dfrA12 (25% vs 3.3%, p = 0.000), dfrA17 (15.5% vs 3.8%, p = 0.000) and dfrA27 (4.3% vs 1.6%, p = 0.01) were more prevalent in SXT-resistant isolates than SXT-susceptible isolates except dfrA1(p = 0.83) and dfrA5(p = 0.18). Sequencing data revealed 12 types of resistance gene cassettes (aar-3-dfrA27, dfrA12–aadA2, dfrA17–aadA5, cmlA1, aacA4, aadA5, arr-3-aacA4, aadA1, aadB–aadA4, aacA4–catB8–aadA1, aadB–aac(6′)-II–blaCARB-8 and aac(6′)-II–blaCARB-8) located in the class 1 integron in 163 isolates (87% SXT-resistant vs 33.7% SXT-susceptible isolates, p = 0.000). A novel finding was the aar-3-dfrA27 (KC748137) gene cassette. The gene of sul2 linked to transposase in 50 SXT- resistant and 7 SXT- susceptible isolates was detected by TAIL-PCR.ConclusionsThe findings demonstrated a higher prevalence of sul, dfrA, intI1 and resistance gene cassettes in class 1 integron in SXT-resistant clinical S. maltophilia isolates in China. The sul1 and dfrA genes located in integrons and the sul2 linked to transposase may imply wide and rapid dissemination of resistance gene in bacteria.