Areas Of Lebanon Research Articles

Understanding the routes of contamination of ready-to-eat vegetables in the Middle East

In the developing countries, inaccessibility to safe water, lack of agricultural infrastructures and limitations to implementing good agricultural practices (GAP) are persistent challenges. To understand the spread of hazards and identify critical areas of transmission in the food chain, a total of 90 samples of raw salad vegetables (parsley, lettuce, radish) were collected from farms and post-harvest washing facilities (n = 12) in an extensively cultivated area in Lebanon, the Bekaa Valley and from wholesale market stalls traced back to surveyed fields. Our results showed high geometric mean indicator levels ranging from <0.7 to 7 log CFU/g (Escherichia coli), 1.69–8.16 log CFU/g (total coliforms), <0.7–8.39 log CFU/g (Staphylococcus aureus). The mean counts of total coliforms and E. coli on fresh produce followed an increasing trend from fields to the markets indicating potential sources of faecal contamination throughout the food chain. Of more concern was the presence of pathogens Listeria monocytogenes (14%) and S. aureus (45.5%) in fresh produce from harvest to retail, and Salmonella spp. was detected in 6.7% of the raw vegetables from the post-harvest washing areas. These results along with our observations highlight shortfalls in hygienic farming and postharvest practices, including the use of inappropriately treated manure and chicken litter to fertilize the crops on the fields which contributed to the high levels of S. aureus in the product at retail. Unregulated use of wash water, inadequate transportation and storage conditions with risks of cross contamination was also identified. Suggested control measures should mitigate the risks at the source and put emphasis on developing strict policies on monitoring the safety of water sources and on the application of the good agricultural and hygienic practices (GAP, GHP) on primary production stages, washing, transportation and storage at retail.

Trends in mammography utilization for breast cancer screening in a Middle-Eastern country: Lebanon 2005–2013

IntroductionIn Lebanon, annual national breast awareness campaigns were started in 2002 during the international breast month of October to promote the utilization of mammography for women aged ≥40. The impact of the campaigns has been assessed periodically since 2003. Results of 2003–2005 campaigns have been published previously. ObjectivesTo measure the prevalence of two behavioral outcomes of interest: ever-use of mammography, and repeat mammography in the previous 12 months among ever-users. The prevalence was described by region and age group. The aim was to document the effectiveness of the program towards reaching a nationally defined goal of 80% screening coverage. MethodsThe survey’s sampling frame was developed incrementally, and since 2005 it has included women aged ≥40 from all areas of Lebanon. The sample size has also increased incrementally from 1200 in 2005 to 2400 in 2013. Results have been tabulated biannually and presented as historical trends with regional and demographic variations covering a 9-year period. ResultsIn all six consecutive surveys presented here, the mean age of participating women was about 50 years. Year-by-year increases in utilization indicators were detected, with consistent differences in favor of the more urban areas in and around the capital city Beirut and its suburbs (Greater Beirut or GB). By 2013, ever-utilization had reached 43% (41–45) and recent mammography 20% (18–22) nationwide. Utilization was significantly more important in the age group 50–59 compared with the age group 40–49 or ≥60. While recent rates have increased nationwide, they have reached a plateau of about 25% in GB and are tending to the same level in other areas. Discussion and conclusionsWhile initial progress was slow, it has been accelerating in the last 4–5 years, indicating that the message is being accepted by a larger audience of targeted women at each iteration. However, concern remains that women between 40 and 50 and those >60 are not responding as well as desired to the screening message, for reasons currently under investigation.

Regional Landsat-Based Drought Monitoring from 1982 to 2014

Drought is a serious natural hazard with far-reaching impacts including soil damages, economic losses, and threatening the livelihood and health of local residents. The goal of the present work was to monitor the vegetation health across Lebanon in 2014 using remote sensing techniques. Landsat images datasets, with a spatial resolution of 30 m and from different platforms, were used to identify the VCI (Vegetation Condition Index) and TCI (Temperature Condition Index). The VCI was based on the Normalized Difference Vegetation Index (NDVI) datasets. The TCI used land surface temperature (LST) datasets. As a result, the VHI (Vegetation Health Index) was produced and classified into five categories: extreme, severe, moderate, mild, and no drought. The results show practically no extreme drought (~0.27 km2) in the vegetated area in Lebanon during 2014. Moderate to severe drought mainly occurred in the north of Lebanon (i.e., the Amioun region and the plain of Akkar). The Tyr region and the Bekaa valley experienced a low level of drought (mild drought). This approach allows decision makers to monitor, investigate and resolve drought conditions more effectively.

Perceptions and Practices Regarding Herbal Medicine Prescriptions among Physicians in Greater Beirut

This survey aimed at assessing the perceptions of physicians regarding the appropriateness of prescribing herbal medicines (HM), their prescribing patterns and their knowledge regarding the interaction between HM and conventional drugs. No data are currently available in Lebanon concerning the frequency of HM prescription and indications. HM poorly prescribed can affect the overall quality of health among patients taking conventional drugs. This descriptive survey study was conducted in the Greater Beirut area in Lebanon during May-June 2009. All Primary Health Care (PHC) physicians in private community-based solo practice were identified from the Lebanese Order of Physicians listing, contacted and invited to participate. Those who agreed had to complete a pre-piloted face-to-face questionnaire. Of two hundred twelve participating physicians, 45% routinely prescribed HM to their patients. Between 64 to 67% prescribers believed that HM have more benefits, faster results and fewer side effects than conventional drugs. In addition, 58% thought that HM were less expensive, and 76% that they were easier to take than conventional drugs. More importantly, in a series of eight questions concerning the physicians' knowledge about the possible mechanism of drug-herb interactions, the general tendency was towards poor knowledge. A good percentage of PHC physicians who routinely prescribe HM do not know their mechanism of action or their possible interactions with the conventional drugs. Knowledge about mechanism of drug-herb interactions should be an integral part of the medical curriculum. The knowledge about HM should be an integral part of the medical curriculum as they are frequently prescribed by PHC physicians.

RACIAL DIFFERENCES POTENTIALLY INFLUENCING SELF-IDENTIFICATION OF MILD COGNITIVE IMPAIRMENT

per se, particularly oily fish rich in omega 3 fatty acids, further limits the potential protective effect on dementia(3-4). Given the role of diet modification in dementia prevention, understanding the link between diet and dementia in Lebanon can be an important dementia prevention intervention for Lebanon and for the Middle East.Methods: 510 participants 65 years old residing in Beirut and Mount Lebanon governorates were included in a cross-sectional survey. Data collection by trained interviewers took place in randomly selected clusters from the capital Beirut andMount Lebanon area. The 10/66 Dementia Research Group diagnostic assessment for dementia and risk factor questionnaires were administered to the participants and their caregivers. Results: Preliminary analysis was carried on 303 participants, 174 females (57.4%) and 129 males (42.6%). The mean age was 72.28 years (SD 7.03). 24 participants were diagnosed with dementia (8%). There was a high prevalence of overweight (54.4%) and obesity (27.7%) among the study population. Neither fish nor meat consumption in this sample was related to dementia prevalence (OR: 0.83; 95%CI: 0.30, 2.33; and OR: 1.48; CI: 0.33,6.56, respectively). Conclusions: Preliminary findings do not support the protective effect of fish consumption, but more definitive conclusions can be made once the entire sample of 510 randomly selected individuals are analyzed. Still, the trends of a lower odds of dementia among older people who consumed fish, and a higher odds of dementia amongmeat consumers is consistent with the results of the large 10/66 study carried out in five LMIC. The latter finding, combined with the nutritional transitions observed in Lebanon and the Arab region and the mounting evidence of the role of diet on dementia, warrants further investigation on a larger national and regional scale.

Wave energy potential in the Eastern Mediterranean Levantine Basin. An integrated 10-year study

The main characteristics of wave energy potential over Eastern Mediterranean Levantine Basin, an area of increased interest for energy resources exploration/exploitation, is presented in this work. In particular, an integrated hindcasting platform consisting of state-of-the-art wind-wave numerical models at a very high resolution mode is utilized to produce a 10-year database for the wave energy potential in the Levantine Basin and the environmental parameters that affect it. The numerical results are analyzed by means of a variety of statistical measures focusing, apart from the conventional statistical information, on the potential impact of extreme values and the probability distribution functions that optimally describe the spatial and temporal distribution of the wave power potential over the Eastern Mediterranean sea area. The regions with increased values of wave energy potential are mainly the western and southern coastlines of Cyprus island, the sea area of Lebanon and Israel, as well as the coastline of Egypt especially around Alexandria. Over these areas, relatively low but also stable, and hence exploitable, wave energy potential is revealed. However, non-trivial impact of infrequent values is also recorded.

CP-108 Evaluation of clinical pharmacist interventions in a university hospital located in a rural area in Lebanon

BackgroundThe clinical pharmacist’s role has grown considerably in recent years due to its prominence in coordinating with healthcare professionals to achieve optimal health outcomes.Few studies have been published regarding clinical...

Capacity Building in Alzheimer's Disease (AD): Lessons Learned from a Pilot Study in Six Distinct Areas of Lebanon

Aims: To report the results of a week-long Alzheimer’s Disease (AD) pilot training and capacity building program for community caregivers in Lebanon. Study Design: Using mixed methods instruments, we collected participant demographics, measured participant understanding of baseline issues affecting the local aging population, the role of caregivers, and confidence in community supports. Knowledge gaps and challenges in AD care were identified. Place and Duration of Study: Six distinct areas of Lebanon including Tripoli, Keserwan/Jbeil, Beirut, Bekaa Valley, Sarafand and Nabatieh, from August 1-6, 2011. Methodology: Using mixed methods instruments, we measured participant understanding of baseline issues affecting the local aging population, the role of caregivers, and confidence in community supports. We also examined the usefulness of existing AD resources, identified characteristics of these front-line providers, and elicited details about educational and clinical needs in distinct religious and ethnic regions. Results: Of workshop participants, 94% were women, of whom 36% were 31 to 40 yearsof-age. Of the participants, 80% were social workers or nurses, and 65% were government employees. Participant motivation included a desire to mentor others (71%), Case Study Bazzi et al.; JSRR, Article no. JSRR.2014.009 186 improve communication with elders (69%), and better elderly care (61%). Participants said they learned most age-sensitivity training (74.4%), positive behavioral supports (60%), and strategies for difficult behaviors (55.6%). Incomplete evaluations and workshop fatigue negatively impacted data outcomes. Conclusion: Cross-cultural understanding of AD training in diverse settings is critical to developing appropriate training programs. Results underscore that community workers, the primary caregivers of AD patients in Lebanon, are sensitized to the disease, and through training, felt empowered to advance elders’ quality of care. Study challenges included group heterogeneous backgrounds, unfamiliarity with evaluation methods and the timing of the workshop, the summer heat and time of fasting.

Green Mobile Telecommunication: Assessment and Implementation A Consumer Perspective in Lebanon

Mobile telecommunications’ sector is one of the fastest developing sectors in the world. Both high usage and demand gather to show how this sector is increasing especially with the energy resources it requires to operate. Mobile telecommunications has a direct effect on the environment related to the usage (users’ behavior, network’s interaction, power and energy saving, etc.). The main objectives of this research are to assess the consumers’ awareness and willingness to pay in order to go green in mobile telecommunication, while measuring the attitudes, perceived behavioral control, and subjective norms that affect the consumers’ intentions to go green in mobile telecommunications. The theory of planned behavior is used as the conceptual framework to assess the consumers’ intention and behavior towards green telecommunication. A Questionnaire on the theory of planned behavior was built, translated and face to face self-administered interviews were conducted four areas in Lebanon (Jdeideh, Haret Hreik, Roueis, and Maameltein) that were selected based on the traffic profile (voice and data), number of distinct users, locations, population, and workplaces. Results show that most of the Lebanese consumers are aware of the negative environmental and health impacts of telecommunications. Result show that most of the Lebanese consumers are ready to pay higher mobile fees if green telecom systems are to be applied in Lebanon; and that variables such as attitudes, perceived behavioral control, and subjective norms affect the consumers’ intention to go green in mobile telecommunications.

A national study on nurses' retention in healthcare facilities in underserved areas in Lebanon.

BackgroundNursing shortages and maldistribution are priority issues for healthcare systems around the globe. Such imbalances are often aggravated in underserved areas, especially in developing countries. Despite the centrality of this issue, there is a dearth of studies that examine the retention of nurses in underserved areas in the Middle East Region. This study investigates the characteristic and the factors associated with the retention of nurses working in rural areas in Lebanon.MethodsThis study uses a non-experimental cross-sectional design to survey nurses working in underserved areas of Lebanon. Underserved areas in Lebanon were identified using WHO definition. A total of 103 health facilities (hospitals and primary healthcare centers) located in these areas were identified and all nurses working at these facilities received a copy of the survey questionnaire. The questionnaire included five sections: demographic, work-life, career plan, job satisfaction, and assessment of work environment. Analysis included univariate and bivariate (chi-square, Student’s t-test and ANOVA) tests to describe the respondents and examine the significance between nurses’ characteristics and their intent to stay. A logistic regression model was constructed to identify factors associated with nurses’ intent to stay in underserved areas.ResultsA total of 857 nurses from 63 Primary Healthcare (PHC) centers and hospitals responded to the questionnaire (75.5% response rate). Only 35.1% of nurses indicated their intent to stay in their current job over the coming one to three years. Surveyed nurses were most satisfied with relationship with co-workers and least satisfied with extrinsic rewards. Rural nurses working in PHC centers were more satisfied than their hospital counterparts on all aspects of work and had significantly higher intention to stay (62.5% compared to 31.5% in hospitals, P < 0.001). Regression analysis revealed that nurses less likely to report intent to stay were younger, unmarried, with less years of work experience and were not working towards a higher degree. Analysis reveals a directly proportional relationship between nurses’ reported job satisfaction and their intent to stay.ConclusionThis study reveals poor retention of nurses in rural and underserved areas in Lebanon, especially in the hospital sector. The status quo is disquieting as it reflects an unstable and dissatisfied nursing workforce. Developing targeted retention strategies for younger nurses and those working in hospitals as well as the offering of professional development opportunities and devising an incentive scheme targeting rural nurses is pivotal to enhance nurses’ job satisfaction and retention in rural settings.

FIRST REPORT OF HOP STUNT VIROID IN LEBANESE FIG TREES

In the course of a survey carried out in 2010 in the main fig-growing areas of Lebanon (Bekaa and Mount Lebanon), a total of 100 samples representative of 15 dif- ferent cultivars were collected and tested by RT-PCR for the presence of Hop stunt viroid (HSVd) using viroid-spe- cific primers (Sano et al., 2001). Distinct PCR products of the expected size (303 bp) were amplified from 12 fig trees of cvs Houmairi (6), Bayadi (5) and Sweidi (1), all originat- ing from the Bekaa valley. This result was further con- firmed by dot blot molecular hybridization using a HSVd- specific riboprobe. Only seven infected plants showed symptoms resembling those typical of Fig mosaic disease, the remaining being symptomless. Five of these HSVd iso- lates were sequenced (accession Nos HE662802- HE662806) and compared with the other HSVd isolates from GenBank. In Blast analysis, all the sequenced HSVd isolates showed 99-100% nucleotide identity among them and 94-95% identity with the HSVd type member (X0009). The only exception was the isolate D1, which confirmed the 94% identity with HSVd type but showed a lower identity level (94-95%) with the other HSVd Lebanese fig isolates. In a phylogenetic tree constructed with whole viroidal sequences the Lebanese fig isolates, ex- cept for D1, clustered in a separate group together with fig isolates from Syria and mulberry isolates from Lebanon (Elbeaino et al ., 2012a, 2012b). To our knowledge this is the first report of HSVd in Ficus carica in Lebanon.

Infant Feeding Practices and Challenges: A Pilot‐Study in Lebanon

The improvement of infant feeding practices has been reported as an effective preventive strategy for reducing the burden of Non Communicable Diseases (NCDs). While high rates of NCDs are reported from Lebanon, little is known on child feeding practices in the country. This paper is based on a pilot‐study investigating feeding practices and nutritional status among 0–2 years old children, in one of the main rural areas of Lebanon (Beqaa). Subjects (n=150) were recruited from selected villages by cluster random sampling. Data on feeding practices, anthropometric measurements and 24‐hour dietary recalls were collected. Stunting, underweight and wasting were identified in 16.8, 9.1 and 4.1% of children, respectively; overweight and obesity were documented in 11.5 and 2.7%, respectively. Less than 10% of infants were exclusively breastfed for the first 6 months, with 52.6% being introduced to complementary foods at less than 4 months of age. Approximately, 45% of subjects did not meet the WHO indicators for Minimum Dietary Diversity and Minimal Acceptable Diet. Inadequate nutrient intakes were noted, particularly for iron, calcium, vitamin D and folate. Findings highlight the need for nationwide investigations of feeding practices and child nutritional status in Lebanon. Evidence‐based interventions can then be spearheaded to enhance early childhood nutrition, thus potentially reducing the burden of NCDs.

Multimedia-Assisted Learning among Lebanese Teachers

Multimedia learning consists of graphics and texts. Learning occurs when the learners create mental representations from combining the text and relevant graphics in the lessons. Incorporation of multimedia learning in teaching can lead education to a higher level than traditional teaching techniques. The aim of this study is to investigate the extent to which multimedia is incorporated in classroom teaching among Lebanese educators. A small scale survey from 50 middle school teachers of 10 different schools selected from various areas in Lebanon was undertaken. The survey results were compared and tested in order to evaluate whether or not the teachers integrate multimedia in classroom teaching. If they do, this study aims to identify the multimedia elements they frequently use. However, if not, this study aims to find out the causes for not adopting multimedia in their classroom teaching.

‘My pain was stronger than my happiness’: Experiences of caesarean births from Lebanon

Objectivethe rising trends in caesarean section have been partially attributed to women's requests. Many studies in developed and very few in developing countries have attempted to understand this phenomenon. This qualitative study explores experiences of women having caesarean section on demand in a middle-income country with a private health-care system. Designan inductive qualitative design, using face-to-face semi-structured interviews. Settingwomen were identified and recruited through a perinatal database and selected obstetricians' clinics in the Greater Beirut area in Lebanon. Participantsa purposive sample of women who had a caesarean childbirth within the four months preceding the interview, were visited for an interview at home using a semi-structured interview guide. Thematic content analysis was conducted on a sub-sample of 22 women who requested a caesarean birth. Findingslack of information about caesarean sections fosters women's fear from labour pain and acts as the main impetus for women to consider caesareans as the pain free alternative. Findings reveal health-care providers' role in reinforcing beliefs about caesarean sections being the way for pain free deliveries by overestimating the safety of the procedure and disregarding postpartum health issues. Key conclusion and implications for practicecaesarean birth is presented to women as a safe option for ‘pain free’ childbirth. This needs to be considered within the cultural context of understanding safety and pain as well as the dynamics of power in maternity care. Health-care professionals need to explore these dimensions and promote women's informed choice as well as encouraging the normality of birth.

The Hygiene Hypothesis : Aeroallergen Sensitization in Allergic Rhinitis Patients Living in Rural and Urban Areas of Lebanon

The Hygiene Hypothesis : Aeroallergen Sensitization in Allergic Rhinitis Patients Living in Rural and Urban Areas of Lebanon

Sewage of Tripoli: a review of the current situation and of the future planning

Tripoli represents a major urban area in Lebanon with about 350,000 people in the city, which may swell by additional 100,000 when the city surrounding population is counted. It used to be a dominant agricultural region, but the last three decades witnessed a rapid development of urban construction. The goal of this paper was to present the current situation regarding the sewage disposal, contaminating the adjacent coastal areas. Furthermore, the future planning for the Tripoli area was also examined with specific technical recommendations put forward. It is expected that the wastewater treatment plant, as proposed for the city of Tripoli, will solve the problems related to the treatment and discharge of wastewater. However, the wastewater treatment scheme is not without controversies, such as sludge handling and disposal; odour control; the re-use and/or sea dispersal of the treated effluent, and the high costs of the proposed type of treatment.

‘We don't want you to walk the streets we walked’: youth reflections on themselves and relationships that help them grow and thrive

Research on adolescent health is emphasising positive youth development. Most research on the Developmental Assets framework has occurred in developed countries using quantitative methods. This paper explores the validity of the concept of youth Developmental Assets in Lebanon. Thirteen focus group discussions were conducted with 7th–12th-graders (n = 162 youth) from eight private and public schools in four areas of Lebanon (two urban and two rural). Six themes emerged from the thematic analysis: parent–youth relationship; relationships with others; behaviours, attitudes and values; role of schools; country and community context; and recreational needs, opportunities, and recommendations. These were closely linked to the Developmental Assets framework. These results can guide interventions to strengthen internal assets, and provide a supportive environment to help young people in Lebanon grow and thrive.

First Report of Squash leaf curl virus in Cucurbits in Lebanon.

During the second squash cropping season, which coincides with high whitefly populations, a high incidence of plants with severe leaf curl symptoms was observed. Many farmers reported yield losses ranging from 70 to 80%. Surveys were conducted over five cropping seasons (2008 to 2010) and covered the coastal areas of Lebanon. A total of 675 samples were collected, including cucumber (Cucumis sativus), squash (Cucurbita sp.), melon (Cucumis melo), and watermelon (Citrullus lanatus). All squash samples had leaf curl symptoms, whereas 75 to 85% of cucumber, melon, and watermelon samples showed yellowing symptoms. The remaining 15 to 25% were asymptomatic. Total nucleic acids were extracted according to a small-scale CTAB protocol (4). PCR assays were initially conducted using the universal degenerate primers PAL1v1978 and PAR1c496, designed to detect DNA-A of several begomoviruses (3). Following sequencing of 22 randomly selected amplicons, BLASTN analysis showed that 19 samples were infected with Squash leaf curl virus (SLCV). SLCV specific primers: (SqA1R: 5'AGCTGTATCTTGGGCAACAGA3' and SqA2F: 5'TATCTCCCATCTTGGCAAGG3'; amplicon size: 601 bp) were used for detection in the 675 samples. SLCV was detected in 223/249 (89%), 83/145 (57%), 129/229 (56%), and 25/52 (48%) of squash, cucumber, melon, and watermelon samples, respectively. The SLCV genome from a symptomatic squash plant collected from Akkar, North Lebanon, was amplified by rolling circle amplification (RCA) using the TempliPhi Amplification Kit (GE Healthcare). The product was used for biolistic inoculation of squash and cucumber as described (2). Severe leaf curl symptoms were observed on 7/10 of the squash seedlings (cv. Camelia F1) within 2 weeks of inoculation. However, no symptoms were observed on cucumber (cv. Beit alpha) 1 month after inoculation, even though 6/11 (54%) of the plants were positive for SLCV in PCR assays. Several primer sets were used for sequencing the full SLCV genome using the RCA product as template. The sequences were submitted to GenBank under accession numbers HM368373 and HM368374 (SLCV DNA A and B, respectively). Phylogenetic analysis showed that SLCV DNA A was most closely related to SLCV isolates from Egypt (DQ285019) and Israel (HQ184436) with 99% nucleotide identity; SLCV DNA B was most closely related to the same SLCV isolate from Israel (HQ184437) with 99% nucleotide identity. SLCV was first observed on squash in California in 1977, but was introduced during the last decade to the Mediterranean region (1) and currently is widespread all over Lebanon, posing a great threat to squash production.

Public perception and economic implications of bottled water consumption in underprivileged urban areas

This paper presents a comparative assessment of public perception of drinking water quality in two underprivileged urban areas in Lebanon and Jordan with nearly similar cultural and demographic characteristics. It compares the quality of bottled water to the quality of the drinking water supplied through the public network and examines the economic implications of bottled water consumption in the two study areas. Participants' perception of the quality of drinking water provided via the public network was generally negative, and bottled water was perceived to be of better quality in both areas, thus affecting drinking water preferences and consumption patterns. The results reveal that the quality of bottled water is questionable in areas that lack enforcement of water quality standards, thus adding to the burden of an already disadvantaged community. Both areas demonstrated a considerable cost incurred for purchasing bottled water in low income communities reaching up to 26 % of total income.

Measurement Properties of the Arabic Lebanon Version of the Pediatric Quality of Life Inventory 4.0 Generic Core Scales for Young Child (5 - 7 years), and Child Aged 8 - 12 Years: Quality of Life of in Urban and Rural Children in Lebanon

Background: Health-related quality of life (HRQOL) is recognized as an important health outcome measurement for pediatric patients. HRQOL in children are needed to gain a better understanding of the impact of public policies, interventions, therapies, and the prediction of health and social care need. In view of the lack of reliable HRQOL instruments for children in Arabic, the present study aims to translate the PedsQLTM4.0 self-report and proxy-report for young children (ages 5-7 years), and Children (ages 8-12), evaluate psychometric properties of the Arabic Lebanon version; and to evaluate HRQOL of children in rural and urban areas in Lebanon. Methods: PedsQLTM4.0 was translated and adapted into Arabic using the standard approach provided by Varni JW. The Arabic version was administered to a representative sample of 368 children aged 5-12 years and their parents. The psychometric properties were then evaluated. Results: The rate of missing data for self-report and proxy-report was very low (0.51% and 0.46% of items). All child self-report, and parent proxy-report subscales exceeded the minimum reliability standard of 0.70 for alpha coefficient, except emotional subscale of young child self-report and proxy-report, and, the social subscale of child self-report (alphas ranging from 0.60 to 0.66). Factor analysis yielded patterns of factor correlation comparable to the original version. The emotional functioning of children is low, where most children feel afraid, sad, and angry. Children resident in rural areas had higher social scores than those in urban areas. The HRQOL of girls is higher than boys; Children undergoing treatment for cancer rated their HRQOL as poorer in all dimensions. Conclusions: The results support the validity of the PedsQLTM4.0 self-report and proxy-report Arabic version. Habitat has a minor influence on HRQOL of children. Further psychometric evaluation in a larger sample of children, in other departments of Lebanon is recommended to provide firmer conclusions.