Archaebacterium Thermoplasma Acidophilum Research Articles

Structure of thermoplasmaquinone fromThermoplasma acidophilum

The structure of the methyl-substituted menaquinone (designated thermoplasmaquinone) from the extremely thermophilic and acidophilic archaebacterium Thermoplasma acidophilum was investigated by mass spectrometry and proton nuclear magnetic resonance spectrometry. The results of the present study show that the novel quinone from T. acidophilum corresponds to 2,[5 or 8]-dimethyl-3-heptaprenyl-1,4-naphthoquinone.

Histone-like protein in the Archaebacterium Sulfolobus acidocaldarius

The Archaebacterium Thermoplasma acidophilum contains a basic chromosomal protein remarkably similar to the histones of eukaryotes. Therefore, it was of interest to examine a different Archaebacterium for similar proteins. We chose to examine Sulfolobus acidocaldarius because it is thermophilic, like T. acidophilum, but nevertheless the two organisms are not particularly closely related. Two major chromosomal proteins were found in S. acidocaldarius. The smaller of these was soluble in 0.2 M H 2SO 4 and had a molecular weight of 14500. The larger was acid-insoluble and had a molecular weight of about 36000. Together, the proteins protected about 5% of the DNA against nuclease digestion and stabilized about 50% against thermal denaturation. Overall, the properties of these proteins were intermediate between those of the Escherichia coli protein HU and T. acidophilum protein HTa.

Ribosome specificity of archaebacterial elongation factor 2: Studies with hybrid polyphenylalanine synthesis systems

Polyphenylalanine synthesis with ribosomes and two separated, partially purified elongation factors (EF) was measured in cell-free systems from the archaebacteria Thermoplasma acidophilum and Methanococcus vannielii, in an eukaryotic system from rat liver and an eubacterial one with Escherichia coli ribosomes and factors from Thermus thermophilus. By substitution of heterologous EF-2 or EF-G, respectively, for the homologous factors, ribosome specificity was shown to be restricted to factors from the same kingdom. In contrast EF-1 from T. thermophilus significantly cooperated with ribosomes from T. acidophilum.

Occurrence of diphthamide in archaebacteria.

We examined the nature of the diphtheria toxin fragment A recognition site in the protein synthesis translocating factor present in cell-free preparations from the archaebacteria Thermoplasma acidophilum and Halobacterium halobium. In agreement with earlier work (M. Kessel and F. Klink, Nature (London) 287:250-251, 1980), we found that extracts from these organisms contain a protein factor which is a substrate for the ADP-ribosylation reaction catalyzed by diphtheria toxin fragment A. However, the rate of the reaction was approximately 1,000 times slower than that typically observed with eucaryotic elongation factor 2. We also demonstrated the presence of diphthine (the deamidated form of diphthamide, i.e., 2-[3-carboxyamide-3-(trimethylammonio)propyl]histidine) in acid hydrolysates of H. halobium protein in amounts comparable to those found in hydrolysates of similar preparations from eucaryotic cells (Saccharomyces cerevisiae and HeLa). Diphthine could not be detected in hydrolysates of protein from the eubacterium Escherichia coli. Whereas both archaebacterial and eucaryotic elongation factors contain diphthamide, they differ importantly in other respects.

Component E of the DNA-dependent RNA polymerase of the archaebacterium Thermoplasma acidophilum is required for the transcription of native DNA.

The role of component E of the DNA-dependent RNA polymerase of the archaebacterium Thermoplasma acidophilum in the transcription of Thermoplasma DNA has been analyzed. Component E (Mr 22000) is released upon formation of the binary complex of the polymerase with the DNA. Enzyme not containing component E is inactive on DNA but active on poly[d(A-T) X d(A-T)]. The activity on DNA can be restored by addition of component E. Two states of the binding complex between RNA polymerase and DNA, differing in their ionic strength stabilities, have been distinguished both in the presence and absence of component E. The transition temperature between the two states is 43 degrees C. Component E appears to open productive binding sites in native DNA in addition to the non-productive strong binding sites available for component-E-deficient enzyme.

Organization of rRNA structural genes in the archaebacterium Thermoplasma acidophilum.

In the archaebacterium Thermoplasma acidophilum, each of the structural genes for 5S, 16S and 23S rRNA occur once per genome. In contrast to those of eubacteria and eukaryotes, they appear unlinked. The distance between the 16S and the 23S rDNA is at least 7.5 Kb, that between 23S and 5S rDNA at least 6 Kb and that between 16S and 5S rDNA at least 1.5 Kb. No linkage between those genes has been found by the analysis of recombinant plasmids carrying Bam HI and Hind III rDNA fragments as by hybridizing those plasmids to fragments of Thermoplasma DNA generated by 6 individual restriction endonucleases, recognizing hexanucleotide sequences.

The nucleotide sequence of the 5S rRNA from the archaebacterium Thermoplasma acidophilum.

The complete nucleotide sequence of the 5S ribosomal RNA isolated from the archaebacterium Thermoplasma acidophilum has been determined. The sequence is: pG GCAACGGUCAUAGCAGCAGGGAAACACCAGAUCCCAUUCCGAACUCGACGGUUAAGCCUGCUGCGUAUUGCGUUGUACU GUAUGCCGCGAGGGUACGGGAAGCGCAAUAUGCUGUUACCAC(U)OH. The homology with the 55 rRNA from another archaebacterial species, Halobacterium cutirubrum, is only 60.6% and other 55 rRNAs are even less homologous. Examination of the potential for forming secondary structure is revealing. T. acidophilum does not conform to the usual models employed for either procaryotic or eucaryotic 5S rRNAs. Instead this 5S rRNA has a mixture of the characteristic features of each. On the whole this 5S rRNA does however appear more eucaryotic than eubacterial. These results give further support to the notion that the archaebacteria represent an extremely early divergence among entities with procaryotic organization.