Apricot Research Articles

Kayısı Bahçelerinde Kullanılan Bazı Pestisitlerin Laboratuvar Koşullarında Exochomus nigromaculatus (Coleoptera:Coccinellidae)’a Karşı Yan Etkilerinin Araştırılması

Several harmful pest species can cause damage to apricot trees. Chemical control is the often preferred method in controlling these pests. The use of pesticides has generally resulted in pesticide resistance and elimination of natural enemies. Exochomus nigromaculatus is a predatory insect of globose scale and other scale insects. Inappropriate use of pesticides has been linked with adverse effects on non-target organisms (e.g., reduction of beneficial species populations and increase of pest populations). This study evaluated the side effects of five insecticides (Acetamiprid, deltamethrin, spirotetramat, sulfoxaflor, dimethoate) and a plant extract (orange oil) on immature stages of E. nigromaculatus using dry film method. Acetamiprid and deltamethrin caused the highest mortality rate (97.3%) besides standard toxic dimethoate. Sulfoxaflor accounted for approximately 70% mortality to E. nigromaculatus. In contrast, spirotetramat and orange oil caused less than 20% mortality to the predator. As a result of the dry film method applied against the pre-adult stage of E. nigromaculatus; dimethoate was classified as harmful (class 4), acetamiprid and deltamethrin were classified as moderately harmful (class 3), sulfoxaflor were classified as less harmful, (class 2) while spirotetramat and orange oil were classified as harmless. Thus, it was concluded that spirotetramat and orange oil did not have a negative effect on the predatory insect, E. nigromaculatus and could be used safely in IPM programs.

Investigation of Xinomavro Red Wine Aging with Various Wood Chips Using Pulsed Electric Field

This study explored the potential of pulsed electric field (PEF) as an alternative wine-aging method in four Xinomavro red wines with the implementation of several wood chips (apricot, peach, apple, cherry, acacia, and oak trees). The evolution of total polyphenol content (TPC) and sensory properties of the wines were investigated. Sensory evaluation revealed that PEF treatment increased volatile compound extraction from each wood chip, thereby enhancing the overall quality of the wines. The utilization of acacia tree wood chips in Goumenissa wine led to a notable increase of 10.84% in TPC from the control sample, reaching 2334.74 mg gallic acid equivalents/L. A notable outcome was that PEF decreased TPC, a trend that was also verified through correlation analyses. The highest positive impact of PEF was observed in peach tree wood chips in Goumenissa wine, with a significant increase of 11.05% in TPC. The results from the volatile compound analysis revealed an increase in alcohols and esters from 0.24% to 23.82%, with the highest proportion found in 2-phenylethanol (16.92 mg/L) when utilizing peach tree wood chips in the production of Amyndeo wine. This study could provide a benchmark for rapid, efficient, and cost-effective wine aging through the implementation of the PEF process.

АРМИЛЛЯРИОЗНАЯ КОРНЕВАЯ ГНИЛЬ АБРИКОСОВЫХ ДЕРЕВЬЕВ В УСЛОВИЯХ ЗАПАДНОЙ ЧАСТИ АЗЕРБАЙДЖАНА

АРМИЛЛЯРИОЗНАЯ КОРНЕВАЯ ГНИЛЬ АБРИКОСОВЫХ ДЕРЕВЬЕВ В УСЛОВИЯХ ЗАПАДНОЙ ЧАСТИ АЗЕРБАЙДЖАНА

High-quality production of red plum apricot in semiarid Loess Hilly region of China

Red plum apricot is a deciduous fruit tree and the best cash forest in semi-arid Loess hilly regions of China. Since 1995, the distribution area of the apricot has spread in most of the water-limited regions, in China, and the yield and benefits of red plum apricot increase dramatically. Since 2017, China put forward high-quality development, and red plum apricot must carry out high-quality production. But, as the red plum apricot tree grows, low temperatures and frost, hazards of heart-eating insects and soil drying will appear, which seriously influence the yield, quality, and benefits of red plum apricot in turn. However, there are few reports on the method for High-quality production of red plum apricot. In this study, the effectiveness of different methods of controlling low temperature and frost and hazards of heart-eating insects and soil drying was estimated. The results show that the greenhouse method is the better method for controlling Low temperature and frost, spraying Beta-cypermethrin still is the better method for controlling Hazards of heart-eating insects. When the soil water resource in the maximal infiltration depth is lower than the soil water resource use limitation by red plum apricot, the plant water relationship enters the key period of plant water relationship regulation. The ending time of the critical period of plant water relation regulation is the failure time of plant water relation regulation. When the current plant density is more than the soil water vegetation carrying capacity, the plant-water relation should be regulated, and then the vegetative growth and reproductive growth on the appropriate leaf quantity when the current plant density is equal to the soil water vegetation carrying capacity and the leaf fruit relation.

Colonization and population dynamics of total, viable, and culturable cells of two biological control strains applied to apricot, peach, and grapevine crops.

The ecological fitness of the biological control strains Bacillus velezensis A17 and Lactiplantibacillus plantarum PM411 was evaluated in different crops, geographical zones, and growing seasons. Both strains (2 g L-1 of dried formulation) were spray-inoculated on apricot trees, peach trees, and grapevines. Depending on the crop, flowers, fruits, and leaves were picked at several sampling time points. The population dynamics of viable, viable but non-culturable, and dead cells were studied by comparing viability qPCR (v-qPCR), qPCR, and plate counting estimations. A17 showed high survival rates in apricot, peach, and grapevine organs. The A17 viability was confirmed since qPCR and v-qPCR estimations did not significantly differ and were rather constant after field applications. However, higher population levels were estimated by plate counting due to the non-selective characteristics of the medium used. The viability of PM411 was constrained by plant organ, crop, and climate conditions, being higher in apricot than in grapevine. PM411 survival declined after field application, indicating difficulties in its establishment. The PM411 population level was made up of dead, culturable, and viable but non-culturable cells since significant differences between the three methods were observed. In conclusion, A17 and PM411 differ strongly in their survival in grapevine, peach, and apricot.

Integrated Nutrient Management as a Low Cost and Eco-Friendly Strategy for Sustainable Fruit Production in Apricot (Prunus armeniaca L.)

ABSTRACT Prolonged and excessive use of chemical fertilizers has resulted in serious harm to soil health and ecosystems. This study aimed to reduce the cultivation costs for apricot trees, nearly 1/3rd of which are spent on fertilizers. The research was conducted on fully grown apricot trees of the cultivar “New Castle,” in the Solan district of Himachal Pradesh, India. The experiment consisted of fourteen treatment combinations evaluated in triplicate and statistically analyzed using a randomized block design (RBD). Results revealed that treatment T12 [50% Nitrogen (Calcium Nitrate) + 50% Nitrogen (Urea) + Azotobacter + Phosphate Solubilizing Bacteria + Vermicompost] resulted in the highest percent increase in tree trunk girth (6.82%), highest leaf chlorophyll content (3.00 mg g−1 fresh weight), leaf area (58.29 cm), fruit set (61.00%) and total yield (61.9 kg tree−1). In terms of nutrient status, T12 had the highest leaf N (2.95%), leaf K (2.60%), soil N (386.33 kg ha−1), soil P (51.00 kg ha−1) and soil organic carbon (1.81%). The highest net return and profit over recommended dose of fertilizers (RDF) was also recorded in treatment T12. The results of this study show that judicious fertilizer use along with integrated organic manure and bio-fertilizers can reduce cultivation costs, improve soil health, and increase fruit production with minimum ecosystem damage.

First Report of Neofusicoccum ribis Causing Cankers and Dieback Diseases on Apricot Trees in Canada and Worldwide.

Apricot trees (Prunus armeniaca L.) with cankers, gummosi and dieback symptoms were observed in a commercial orchard in Niagara-on-the-Lake, Ontario, Canada. In October 2018, up to 44.9% disease incidence (n = 318) was observed on 2-year-old 'Harostar™' trees grafted onto 'Haggith' rootstocks. Fungal colonies were consistently isolated and purified from small sections of wood collected from canker margins of symptomatic trunk and shoot tissue, as described by Ilyukhin et al. (2023). Purified mycelial isolates sharing similar morphological characteristics were categorized into five distinct morphotypes. One representative isolate from each morphotype was used to inoculate excised apricot shoots as described by Ilyukhin and Ellouze (2023). One morphotype displayed necrotic lesions on the shoots consistently yielded abundant white aerial mycelium that turned grey-brown on PDA after 7 days (Figure S1) and produced black pycnidia three weeks following incubtion at 22°C in the dark. Conidia were hyaline, one-celled, fusiform, with dimensions of 19.7 - 24.2 × 3.6 - 4.8 μm (average 22.1 × 4.3 μm, n = 30), the typical morphology of a Neofusicoccum sp. (Crous et al. 2006). Species identification was verified by extracting genomic DNA of the representative isolate M1-105, amplifying and sequencing the internal transcribed spacer (ITS), translation elongation factor 1-α (EF1-α) and β-tubulin (TUB2) gene regions with primers ITS1/ITS4, EF1-728F/EF1-986R and Bt2a/Bt2b. Nucleotide sequences (GenBank Accession No. ITS: OK287034; EF1-α: OK346636; TUB2: OK346633) have 100%, 99.61% and 99.55% identity with Neofusicoccum ribis isolates from different hosts and countries (MT587514, DQ235142, OL455952, respectively). Randomized accelerated maximum likelihood analysis (Stamatakis et al. 2008), using ITS, EF1-α and TUB2 sequence data, clustered M1-105 with the highest bootstrap support values with the N. ribis ex-epitype CBS 115475 (Figure S2). A living culture of M1-105 was deposited in the Canadian Collection of Fungal Cultures (DAOMC 252247). Pathogenicity was verified using 5 potted healthy 1-year-old 'Haroblush™' apricot cultivar grafted onto 'Krymsk® 86' rootstocks. Trunks and shoots were inoculated in a shallow wound made by a scalpel with mycelial plugs from a 5-day-old culture of M1-105. Five control trees were inoculated with sterile plugs. Trees were put in an open-air area and watered as needed. Canker symptoms appeared 7 days after inoculation, and spread above and below the inoculation point. Fifteen days post-inoculation, the upper portion of inoculated shoots showed necrosis, gummosis and wilt (Fig. S1). Neofusicoccum ribis was re-isolated from all infected trees and species identity was confirmed by sequencing as described above. Controls remained symptom-free and no fungi were isolated from the wood. Therefore, Koch's postulates were completed. Neofusicoccum ribis was reported to cause branch dieback of olive trees in Spain (Romero et al. 2005) and pistachio in Italy (Corazza et al. 1986), stem blight and dieback of blueberry in Michigan (Heger et al. 2023) and Florida (Wright and Harmon 2010) and postharvest decay of apple fruit from cold storage in Pennsylvania (Jurick et al. 2013). To the best of our knowledge, this is the first report of N. ribis causing canker and shoot dieback of apricot trees in Canada and worldwide. This report reveals N. ribis as a potential threat, causing canker and dieback. Without proper management, it could lead to significant losses in apricot orchards and the stone fruit industry. This study paves the way for crucial research on N. ribis outbreaks and effective disease control.

A non-destructive approach in proximal sensing to assess the performance distribution of SPAD prediction models using hyperspectral analysis in apricot trees

A non-destructive approach in proximal sensing to assess the performance distribution of SPAD prediction models using hyperspectral analysis in apricot trees

Use of Biological and Chemical Compounds for the Integrated Management of Apricot Powdery Mildew in Egypt

This study aims to evaluate an integrated management program for powdery mildew caused by Sphaerotheca pannosa in apricot trees Prunus armeniaca, where four fungicides Copper, Carbendazim, Praiz and Topas) and three biocides ( Bio Z , Bio Arc and Activator Yeasts ) were evaluated in the first season 2020 in Ismailia and Beheira governorates in the regions of South Tahrir and Nubariya. All compounds significantly reduced the percentage of disease severity on leaves and flowers compared to the control, and the activator yeasts was among the best treatments, as it recorded in the last spraying a percentage of disease severity on leaves and flower 28.5% and 27.6% respectively compared with control 52.7 %and 56.2%, followed by the biocides Bio Z and Bio Arc.In the second season 2021, the compounds were evaluated during the flowering period, which led to their precipitation and the occurrence of plant toxicity for flowers at their highest rates with copper. As for the biocides compounds, they were completely safe.From here, an integrated control program was designed for two seasons 2022 and 2023 that combines fungicides and biocides. It is applied early before flowering. It gave excellent results, reduced the rate of fungicide use, and was safer and cost-saving.

Spectre and Speculation: Haunting and Uncanniness in Soweto, Under the Apricot Tree by Niq Mhlongo

Niq Mhlongo's collection of short stories, Soweto, Under the Apricot Tree (2018), does not perhaps immediately present itself as speculative fiction. The collection, however, gives the supernatural world of African indigenous knowledge as much weight in shaping characters' lives and experiences as it does contemporary socio-political realities. It troubles established genre distinctions in that it can be seen as a work simultaneously belonging to magical realism, social realism, and horror. This article contends that it is precisely owing to the work's use of supernatural and uncanny aspects that this collection can be viewed as a form of social or sociological realism, which aims at depicting the peculiar contemporary and subjective (sur)realities of many young black South Africans. It is faithful to the contradictory worlds of tradition and globalisation that many South Africans straddle, as well as to the spectres of colonialism and Apartheid, that impinge on the present in both material and immaterial forms. In many ways the collection stages the difficulty of decolonisation and the subjective spectres and doppeigängers that such a process unleashes. This paper will make use of the work of Sigmund Freud, Avery F. Gordon, Eve Tuck and C. Ree to explore instances of haunting and the uncanny in Mhlongo's collection.

The Effects of Globose Scale (Sphaerolecanium prunastri) Infestation on the Growth of Wild Apricot (Prunus armeniaca) Trees

The globose scale (GS) (Sphaerolecanium prunastri Boyer de Fonscolombe) is a sucking insect that feeds on saps of wild apricot tree (Prunus armeniaca L.) in the Xinjiang Uygur Autonomous Region of northwestern China. It feeds on branches of wild apricot leading to poor growth, leaf yellowing and leaf drop, and sometimes mortality. Since the initial infestation in 2018, all the main valleys of wild apricot trees have been affected, but there is little research on the host’s physiological response to GS infestation. We measured the differences in growth between infested and non-infested wild apricots. The results showed that the diameter of shoot branches, the fresh weight, dry weight, length, width, area, and chlorophyll content of leaves, and the longitudinal diameter of fruit, were all significantly less for infested wild apricot trees than for un-infested wild apricot. The branch length of shoots, cross diameter, and weight of fruit also decreased, although the differences were not significant. Overall, GS infestation significantly reduced the growth of wild apricot trees.

Threshold Values of Plant Water Status for Scheduling Deficit Irrigation in Early Apricot Trees

Irrigated agriculture is facing a serious problem of water scarcity, which could be mitigated by optimizing the application of regulated deficit irrigation (RDI) strategies. For this reason, the aim of our study was to determine irrigation thresholds based on direct water status indicators of apricot trees under RDI to maximize water productivity. Three treatments were tested: (i) Control (CTL), irrigated at 100% of the crop evapotranspiration (ETc) during the entire crop cycle; (ii) RDI1, irrigated as CTL, except during fruit growth stages I–II when irrigation was reduced by 20% of CTL, and during late post-harvest, with an irrigation threshold of a moderate water stress of −1.5 MPa of stem water potential (Ψs); and (iii) RDI2, irrigated as RDI1, but during late post-harvest using a severe water stress threshold of −2.0 MPa of Ψs. As the irrigation scheduling of RDI1 and RDI2 did not affect yield and fruit quality, the crop water productivity was increased by 13.2 and 25.6%, respectively. This corresponded to 1124 and 2133 m3 ha−1 of water saved for RDI1 and RDI2. A water stress integral of 30.2 MPa day during post-harvest could be considered optimal since when 41 MPa day was accumulated, vegetative growth was reduced by 35%. The non-sensitive periods to water deficit were delimited by the accumulation of growing degree days (GDD) from full bloom, the end of fruit growth stages I–II corresponded to an accumulation of 640 °C GDD, and the beginning of the late post-harvest to an accumulation of 1840 °C GDD.

Efficacy of Insecticides against the Invasive Apricot Aphid, Myzus mumecola.

The invasive apricot aphid (Myzus mumecola Matsumura) is an important pest of apricot trees (Prunus armeniaca L.). In the presented study, laboratory bioassays using treated leaf disks of apricot were conducted to test the efficacy of twelve insecticides according to the maximum field dose. Additionally, dose-response curves were established for selected insecticides, and the effects on colony development were evaluated. Furthermore, a field trial was conducted to investigate the effectiveness of commonly used insecticides in apricot cultivation. The dose-response curves showed LC50 values ranging from 0.08 mg/L for flupyradifurone, 0.15 mg/L for acetamiprid, 0.70 mg/L for etofenprox, 1.89 mg/L for sulfoxaflor, 2.64 mg/L for pirimicarb, 3.97 mg/L for deltamethrin, up to 6.79 mg/L for tau-fluvalinate. These aforementioned insecticides resulted in mortality rates ranging from 95 to 100% at the field dose. Azadirachtin, flonicamid, and pyrethrins showed mortality rates of 27 to 45%. Spirotetramat reduced the colony development and decreased the number of infested shoots by 86%. Spinosad, which is not recommended against aphids, showed minimal impact; reducing the number of exuviae in nymphs in the colony development bioassay. It can be concluded that the majority of the tested insecticides are effective against M. mumecola.

Features of the anatomical structure of leaves depending on the high-altitude growth of apricot in Dagestan

Background. The adaptive changes during the distribution of Prunus armeniaca L. in Dagestan are important for understanding microevolution, structural and functional differentiation processes of populations along environmental gradients based on the organism’s reaction norm. They can be examined by studying leaf anatomical features, having ecologically differentiating significance in natural populations with contrasting growth conditions. Materials and methods. The material for the study of leaf anatomical features was taken from 7 apricot trees in 3 growing areas of Mountainous Dagestan. Comparative analysis was carried out for 42 morphological, anatomical and index parameters of the lamina and petiole. Results. The anocytic structure type of the stomatal apparatus was found in all apricot samples. The differences were determined by the degree of stomata submergence depending on the cuticle’s development. Trees from greater heights had more trichomes on the leaf’s upper side than on its underside. Significant differences between the extreme height reference points were recorded for the number of stomata, cells of the lower epidermis, layers of the sclerenchyma, and xylem thickness. Most of the traits of the lamina decreased, and those of the petiole increased with the altitude. Conclusion. The traits corresponding to the lower and upper altitude limits of P. armeniaca were identified on the basis of the lamina and petiole anatomical features. More xerophytic leaf traits were recorded for the altitudes of 550 m and 1900 m, and mesophytic ones for 1700 m and 1800 m. Endoderm thickness, number of endosperm layers, petiole index, and stomatal index were identified as stable indicators according to the reaction norm within the scope of altitudes: The differences were proved for more plastic traits (number of cells of the upper and lower epidermis, number of stomata, thickness of the lamina and cuticle, and the petiole’s long axis diameter).

Apricot- A New Source of Chemically Active Constituents: A Medicinal Overview

Apricot is the member of Rosaceae family, belonging to the Prunus Lannesiana, genus of Prunophora Focke, subgenus and section of Armeniaca (Lam) Koch section. commonly apricot trees are small to medium-sized that can reach a height of 14 metres. The wood and spurs of a one-year-old Prunus are thinner, twiggy, and have a shorter lifespan. Apricot is cultivated over a long time ago and it have various chemical and physiological activity, it contains essential amino acids made up of 33–35% of the overall amino acids, in the apricot kernel, Arginine (21.7–30.5) and leucine (16.2–21.6) were the two most important necessary amino acids (mmol/100 g meal), whereas glutamic acid (49.9–68.0) was the most common non-essential amino acid. Apricots has many medicinal values and are also used in a various way, including fresh fruit, vinegar, liquor, wine, flavouring agents in food or baby food, sauce, juice, jam and dried fruit for canning. The dried fruit and concentrate fruit juice of the Japanese apricot is used to make a cancer-preventive and cancer-curing beverage. The apricot kernels are used to make cosmetics, medications, and perfumes, while the pits are utilised for making fuel. A liquid soap containing apricot kernel oil is used to treat dermatitis. In addition, bitter apricot is used in several bakery & confectionery items such as cakes pies cookies pastries along with their derivatives to enhance their taste and aroma. It has high potassium content which helps in controlling blood pressure and cholesterol levels. The product also contains fibre, iron, calcium, and vitamin C & A which helps in lowering the risk of cancer and heart diseases. Apricot kernel oil has been found effective for skin conditions on its own or blended with other carrier oils like sunflower seed oil or argan oil due largely lessening inflammation caused by acne lesions blackheads pimples pustules sores rashes etc.

First report of the plum marbling disease associated agent, plum viroid I, in apricots (Prunus armeniaca) in South Africa.

Plum viroid I (PlVd-I) was recently identified as a new viroid in 2020 present in Japanese plum (Prunus salicina) displaying marbling and corky flesh symptoms (Bester et al. 2020). This viroid is a member of the species Apscaviroid plvd-I (genus Apscaviroid, family Pospiviroidae) (Walker et al. 2022). The first observation of apricot fruits with an uneven, indented surface and irregular shape was in 2003 on Prunus armeniaca cv. Charisma in the Western Cape, South Africa. The symptomatic apricot cv 'Charisma' scions showed symptoms only on the fruits, resembling the marbling disease deformities reported previously on fruits from PlVd-I-infected plum trees (Supplementary material 1). In the summer of 2019, representative leaf samples were collected from 13 'Charisma' apricot trees (seven symptomatic and six healthy trees) from two different apricot orchards on two geographical separate farms in the Western Cape. Total RNA was extracted from 1 g leaf petioles using a modified CTAB extraction protocol (Ruiz-García et al. 2019). Ribo-depleted RNA (RiboMinus™ Plant Kit for RNA-Seq, ThermoFisher Scientific) was prepared, and a sequencing library (Ion Total RNA-Seq Kit v2.0, ThermoFisher Scientific) was constructed from a symptomatic sample (La4) (Central Analytical Facility, Stellenbosch University, CAF-SU). High-throughput sequencing was performed on an Ion Torrent™ Proton™ instrument (CAF-SU). De novo assembly using SPAdes 3.13.0 (default parameters) (Nurk et al. 2013) were performed using 93,760,198 reads (average read length: 143 nt). The 174679 scaffolds obtained were annotated using BLAST+ standalone against a local NCBI nucleotide database. One scaffold (443 nt, read coverage: 23.88) had the highest sequence identity (99.59%) to multiple PlVd-I isolates and two scaffolds of 1440 nucleotides (nt) and 2143 nt had high sequence identity to RNA1 and RNA2 of solanum nigrum ilarvirus 1 (SnIV1) (MN216370: 98%; MN216373: 98%) (Ma et al. 2020). These were the only viral sequences identified in the sample. Consensus sequences for SnIV1 were generated by read mapping using CLC Genomics Workbench 11.0.1 (Qiagen) (default parameters) to SnIV1 (MN216370; MN216373; MN216376) and deposited in GenBank (MT900926-MT900928). To confirm the presence of both PlVd-I and the apricot variant of SnIV1, reverse transcription polymerase chain reactions (RT-PCRs) were performed on the RNA of the 13 samples collected. The samples were tested for PlVd-I using primer set 22F/21R (Bester et al. 2020). Only the symptomatic samples tested positive for PlVd-I providing the first evidence of PlVd-I related symptoms in apricots. Three PlVd-I amplicons were bidirectionally Sanger sequenced (CAF-SU) and submitted to GenBank (MT385845-MT385847). The HTS PlVd-I sequence from sample La4 was 100% identical to MT385845, and 99.37% identical to MT385846 and MT385847. An RT-PCR assay was designed, targeting SnIV1 RNA2 (Ilar_RNA2_402F: CTATCTGCCCGAAGGTCAAC, Ilar_RNA2_1161R: CCTATCAAGAGCGAGCAATGG). All samples tested positive for SnIV1 irrespective of symptom status and therefor SnIV1 appears not be associated with specific symptoms in 'Charisma' apricots. This study is the first to report the presence of PlVd-I in symptomatic apricots presenting with uneven, indented surface morphology in South Africa. This study adds towards the investigation into possible alternative hosts for PlVd-I and will assist the South African certification scheme to assess the incidence and severity in apricots.

SELECTION OF APRICOT VARIETIES

The article provides research observations on the formation of apricot trees to study local and foreign varieties of apricots in the conditions of the Kashkadarya viloti and to select varieties that are promising, as well as the correct formation of pine-Shaba in trees where the shape is given and annual varieties are shortened, the quality of fruits increases, adaptability to external conditions.

Protecting Apricot Orchards with Rain Shelters Reduces Twig Blight Damage Caused by Monilinia spp. and Makes It Possible to Reduce Fungicide Use

Blossom and twig blight, caused by Monilinia spp., is the main disease in apricot trees. In this study, we installed transparent rain shelters in apricot orchards to study their influence on the modification of the microclimate at the level of the tree canopy and on the reduction in moniliosis damage in twigs. Rain shelters significantly reduced the leaf wetness time measured within the foliage compared to the unsheltered trees (a reduction of between 43% and 67%). However, very few differences were observed in the daily averaged air temperature (up to 6%) and daily averaged air relative humidity (up to 1%). In the first experiment, on the apricot variety Bergarouge® (CEP Innovation, Lyon, France), moniliosis damage on twigs in the absence of phytosanitary protection was reduced by up to 62% for the trees provided with rain protection compared to the trees that did not receive rain shelters. A second experiment, involving five apricot tree varieties, made it possible to verify that fungicide protection could be reduced for the trees protected by rain covers, reducing moniliosis damage on twigs compared to full fungicide protection combined without rain protection. Finally, a third experiment comprising two apricot tree varieties has shown that in organic orchards, rain protection provides protection against moniliosis (twig blight) that is equivalent to an organic farming fungicide protection programme based on the use of copper sulphate and calcium polysulphide.

Description of Cephalenchus regia n. sp. associated with Walnut (Juglans regia) from Lawat Kundiyan, District Neelum, Azad Kashmir, Pakistan

Lawat Valley is one of the greenest valleys in Neelum District, situated near the bank of the Neelum River in Azad Kashmir, Pakistan. Surveys were conducted from seven different localities in the Lawat area of Neelum district during 2018-2020. A total of 250 samples of soil and roots were collected from areas where various fruits and vegetables were grown at a depth of 10-20 cm. The main objective of the survey was to study pathogenic nematodes and observe the incidence of diseases caused by parasitic nematodes. From Lawat Kundian, six nematode species were identified in apricot trees, and seven were identified in walnut trees, including a newly identified species, Cephalenchus regia. C. regia n.sp. was found in the soil around the dry fruit of walnut (Juglans regia) in Lawat Kundian. It differs from other species in having a longer stylet, pharynx, and tail (22-24; 115-130; 150-200 µm, respectively), as well as an anteriorly situated vulva (57.4 - 62.5%)

Streptomyces phytophilus sp. nov., an endophytic actinobacterium with biosynthesis potential as an antibiotic producer.

An endophytic actinobacterium, strain PIP175T, was isolated from the root sample of a native apricot tree (Pittosporum angustifolium) growing on the Bedford Park campus of Flinders University, Adelaide, South Australia. This strain is a Gram stain-positive, aerobic actinobacterium with well-developed substrate mycelia. Aerial mycelia rarely produce spores and the spore chain is spiral. Strain PIP175T showed the highest 16S rRNA gene sequence similarity to Streptomyces aculeolatus DSM 41644T (99.4 %). Other closely related phylogenetic representatives include Streptomyces synnematoformans DSM 41902T (98.3 %), Streptomyces albospinus NBRC 13846T (97.6 %), Streptomyces cacaoi subsp. cacaoi NRRL B-1220T (97.5 %) and Streptomyces ruber NBRC 14600T (97.4 %). The major cellular fatty acid of this strain was iso-C16 : 0 and the major menaquinone was MK-9(H6). The whole-cell sugar contained galactose, glucose and mannose. Chemotaxonomic data confirmed that strain PIP175T belonged to the genus Streptomyces. Digital DNA-DNA hybridization, average nucleotide identity based on blast and OrthoANIu results between strain PIP175T and S. aculeolatus DSM 41644T were 60.0, 94.1 and 94.9 %, respectively. Genotypic and phenotypic data and genome analysis results allowed the differentiation of strain PIP175T from its closest species with validly published names. Strain PIP175T showed good activity against methicillin-resistant Staphylococcus aureus 03120385. Genome mining of strain PIP175T revealed biosynthetic genes encoding proteins relating to antibiotic production, plant growth promotion and biodegradation enzymes. The name proposed for the new species is Streptomyces phytophilus sp. nov. The type strain is PIP175T (=DSM 103379T=TBRC 6026T).