Apical Portion Research Articles

Scanning Electron Microscopy Analysis of the Intratubular Radicular Dentin Penetration of Calcium Hydroxide, Triple Antibiotic Paste, and Nitrofurantoin.

The aim of this study is to assess and analyze the intratubular penetration of the intracanal medications nitrofurantoin (Nit), triple antibiotic paste (TAP), and calcium hydroxide (CH). Sixty freshly extracted single-rooted teeth were acquired and decoronated to a standard length of 15 mm. To prepare specimens up to size F3, rotary ProTaper instrumentation was employed. The prepared teeth were divided into three groups, each of which received one of the tested intracanal medicaments: Group I (calcium hydroxide), Group II (triple antibiotic paste), and Group III (nitrofurantoin). Using a size #30 Lentulo spiral, a freshly prepared therapeutic paste was placed into the canals, and the intracanal medicaments were allowed to set in the incubator at 100% humidity. The samples were subsequently sliced perpendicularly to their long axis using a precision saw and assessed under a scanning electron microscope to assess the depth of penetration of intracanal medicaments at the coronal, middle, and apical portions of the root canal dentin. The data were analyzed using one-way ANOVA and Tukey's post hoc test. The statistical analysis revealed a significant difference between the experimental groups in the quantity and depth of sealer penetration (p < 0.05). In particular, as compared to the Nit group, both the CH and TAP groups had significantly smaller penetration areas (p < 0.05). In conclusion, this ongoing investigation indicates that nitrofurantoin penetrated dentinal tubules better than calcium hydroxide or triple antibiotic paste.

Shaping outcomes of Reciproc Blue and Rotate in roots canals with band-shaped isthmuses: micro-CT study.

This study assessed the outcome of shaping the mesial roots of mandibular first molars containing band-shaped isthmuses with an isthmus floor located at the apical third with Reciproc Blue and Rotate instruments in terms of canal transportation, canal aberrations and unprepared apical canals. Pair-matched mesial roots of mandibular first molars according to their isthmus location (distance from apical foramina) and size were constructed based on quantitative measurements (length, major and minor diameter at isthmus roof and floor) on preoperative micro-CT scanning (n = 10). The pair-matched specimens were prepared either using Reciproc Blue R25 (25.08v) or Rotate (15.04, 20.05, 25.06) instruments and then subjected to a second micro-CT scanning. Micro-CT scans were analysed to evaluate the canal transportation at the apical foramen and isthmus floor levels and the frequency of procedural errors (separated instruments, artificial canal preparation, cross shaping and unprepared apical canals). Canal transportation values were compared using Mann-Whitney U, and the distribution of procedural errors was compared with chi-square tests with a 5% significance threshold. Greater transportation values were detected in the apical foramen level compared to the isthmus floor in both groups. No significant difference was detected between Rotate and Reciproc Blue groups in terms of absolute transportation values and the incidence of procedural errors (p > .05). Preparation of mesial root canals containing a band-shaped isthmus at the apical portion with Reciproc Blue and Rotate instruments caused transportation of the original canal position at the isthmus floor and the apical foramen levels and resulted in procedural errors. This ex vivo micro-CT study using controlled pair-matched specimens showed that presence of a band-shaped isthmus complicates canal preparation procedure irrespective of the preparation systems.

Epidermal and subepidermal changes during the formation of hairy galls induced by Eriophyidae on Avicennia schaueriana leaves.

Leaf-galling Eriophyidae (Acarina) may promote simple or complex alterations in the organs of their host plants, such as an increase in indumentum density or the reorganization of epidermis and ground system tissue patterns. To test if hairy galls of Eriophyidae on Avicennia schaueriana (Acanthaceae) are related to complex changes, leaf galls in distinct developmental phases were compared to non-galled leaves using anatomical, histochemical, and histometric analyses. Quantitative comparisons of preferential gall induction sites and gall area according to distinct leaf portions were made to evaluate if the impacts of gall formation can be related to the distinct potentialities of leaf microsites. The apical portion of the leaves and leaf margins were the sites with the highest occurrence of galls, but no relationship was detected between gall area and induction site. The gall anatomy revealed that epidermal features are influenced the most with the development of abnormal stomata and projected or sunken salt glands. The most striking change is the neoformation of elongated filiform trichomes on the abaxial surface (where the mites occur) that accumulate reducing sugars and proteins. The filiform trichomes may protect the inducers against abiotic stressors and enemies, and the primary metabolites that accumulate are important foods for mites. The mesophyll has simple alterations, only in the spongy parenchyma. Complex alterations occur only in abaxial epidermal cells close to feeding sites of the inducer. The number of inducers per gall seems to be the most important influence on gall size, since gall area is not related to the position in the leaves.

Comparative Evaluation of the Canal Shaping Ability, Pericervical Dentin Preservation, and Smear Layer Removal of TruNatomy, WaveOne Gold, and ProTaper Ultimate—An Ex Vivo Study in Human Teeth

IntroductionInnovative file systems have been recently introduced, claiming improved effectiveness and superior ability to preserve the tooth structure, still allowing an efficient preparation and disinfection up to the apical region. Regardless, few data are available on the comparative effectiveness of the most recently developed systems. Thus, this ex vivo study aimed to comparatively evaluate, for the first time, the functionality of WaveOne Gold (WOG), TruNatomy (TN), and ProTaper Ultimate (PU) file systems regarding canal shaping, dentin preservation, and smear layer removal ability. MethodsHuman maxillary incisors were randomly divided for instrumentation with one of the assayed systems. Canal shaping ability and pericervical dentin preservation were characterized through microtomographic evaluation and morphometric assessment (n = 15). Smear layer removal ability was evaluated by scanning electron microscopy (SEM) (n = 6). ResultsTN and PU presented the lowest canal volume variation upon instrumentation, found to be significantly lower than that attained with WOG (P < .05). Pericervical dentin was reduced in all groups upon instrumentation, with TN evidencing the highest preservation, quantitatively similar to PU, and significantly higher than that attained with WOG (P < .05). SEM imaging revealed the presence of scattered remnants of the smear layer and partially opened dentinal tubules at the apical portion, with no significant differences between systems. ConclusionsTN and PU allowed for the highest tissue preservation, reporting the lowest volume variation and the highest preservation of the pericervical dentin. None of the assessed systems provided a complete removal of the smear layer in the apical region.

Treatment strategy of lateral canals during root canal therapy

Lateral canals are small branches from the main root canal, usually extending from the dentin and cementum into the periodontal ligament, mostly located at the lower 1/3 of the apical portion. Due to the complex and varied anatomical morphology as well as the high incidence, it becomes an important factor affecting the effect of root canal therapy and a difficult point in this process. It is of great clinical significance to master the treatment strategy of lateral canals during root canal therapy. This article reviews the anatomical characteristics of lateral canals, as well as the clinical identification, treatment strategy and the laboratory detection methods of lateral canals in the process of root canal preparation, disinfection, and obturation.

Effects of nutrients and light in aquatic habitat on the growth of Hydrocotyle vulgaris when expanded from terrestrial to aquatic habitat

Many amphibious clonal plants in aquatic-terrestrial ecotones commonly expand from terrestrial to aquatic habitats. Nutrient availability and light intensity are both key factors affecting plant growth in aquatic habitats, but little is known about the role of nutrient availability and light intensity in aquatic habitats during the expansion of amphibious clonal plants from terrestrial to aquatic habitats, when clonal integration is maintained. We conducted a greenhouse experiment to simulate expansion from terrestrial to aquatic habitats of the amphibious clonal plant Hydrocotyle vulgaris. We grew basal portions of clonal fragments in soil and connected the apical portions of the same fragments to water which subjected to three levels of nutrient availability under a low or a high light condition. High nutrient level and light condition increased the growth of the apical portions of H. vulgaris and thus increased the performance of the whole clones. Meanwhile, root-shoot mass ratio of the apical portions and the basal portions were higher at the high light condition and the low nutrient level. Results suggest that the relatively high levels of nutrients and light condition in aquatic habitats can improve the expansion of apical portions from terrestrial to aquatic habitats. Our results also suggest that maintaining clonal integration may benefit the expansion of H. vulgaris via the trade-off of biomass allocation which can optimize the utilization of resources. These results may provide theoretical basis for community dynamics prediction and vegetation restoration in the ecotones such as wetlands.

Structurally compromised teeth. Part I: Clinical considerations and novel classification proposal.

A comprehensive classification of structurally compromised teeth (SCT) was introduced. Dental injuries or operative mismanagement undermine the structural integrity of the tooth abutment, reducing its biomechanical strength and rendering restorative procedures challenging. To standardize the overall pre-operative evaluations and determine the biological and mechanical features, a classification of the coronal and cervical tooth defects, as well as an attentive analysis of the most apical location of the residual cervical tooth structure along the whole perimeter and the most coronal location of the bucco/lingual residual structure was presented. Considering the residual cervical structure, five possible clinical scenarios were individuated with respect to the gingival margin, gingival sulcus, supracrestal tissue attachment and bone crest (BC). The latter prevents the isolation procedures rendering the adhesive restorations unfeasible. Instead, the location of the most apical portion of residual cervical structure within subgingival/intrasulcular depth (>1.5 mm above BC) can be considered restorable. This classification is threefold: to enclose all the possible clinically encountered tooth defects, to identify the apical problems of SCT to appropriately manage the perio-restorative interfaces, and to evaluate the tooth resistance capacity of SCT, as to plan and perform the most adequate biomechanical restorative approach. The present classification is proposed to provide a complete perspective of structurally compromised teeth to standardize the biologic and biomechanical evaluations during planning of restorative procedures.

Effects of Metasomatism on Granite-Related Mineral Systems: A Boron-Rich Open Greisen System in the Highiş Granitoids (Apuseni Mountains, Romania)

Greisenization is typically linked with highly fractionated granites and is often associated with hydrothermal vein systems. Late to postmagmatic metasomatic processes involve the enrichment of volatile components such as boron and halogens as well as several metallic elements. The purpose of this study is to reveal the main metasomatic effects and paragenetic sequences of the related mineralizations in Highiş granitoids, Romania. In a natural outcrop, more than 30 samples were collected from granitoids, felsic veins, and country rocks. We carried out a detailed mineralogical and petrological characterization of carefully selected samples using X-ray powder diffractometry, electron microprobe analysis, and microscopic methods together with K–Ar ages of whole rocks and K-bearing minerals. Several characteristic features of albitization, sericitization, tourmalinization, epidotization, and hematitization were recognized in the studied samples. Crystallization of quartz, K-feldspar, and magnetite represents the first stage during the magmatic-hydrothermal transition. The mineral assemblage of albite, sericite, schorl, and quartz originates from the early and main stages of greisenization. While the subsequent mineral assemblages, which predominantly include dravite, specular hematite, and epidote, are closely related to the late vein-depositing stage. We propose that the study area could belong to a boron-rich open greisen system in the apical portion of Guadalupian A-type granite. Based on a new hypothesis, the previously published Permian crystallization ages (between ~272 Ma and ~259 Ma) could be homogenized and/or partially rejuvenated during the hydrothermal mineralization processes due to uraniferous vein minerals. Additionally, the Highiș granite-related system suffered a Cretaceous thermal overprint (between ~100 Ma and ~96 Ma). The results may help to understand the evolution of highly evolved granite intrusions worldwide and improve our knowledge of the effect of hydrothermal mineralization processes on the emplacement ages.

Merkel-like basal cells in the nasal septal island of dromedaries: Ultrastructure and possible functions

Unlike other Merkel cell types, the morphology and functions of the Merkel-like basal cells remain unclear. The aim of the present study was to investigate the ultrastructural features of Merkel-like basal cells in the nasal septal island (NSI) of dromedaries (Camelus dromedarius) using transmission electron microscopy and to speculate their potential functions. Ten pairs of nasal septal islands obtained from ten heads of dromedary camels were used for the current study. Interestingly, these cells have been identified in the basal layer of the neuroepithelium of the dromedary nasal septal island near the sensory nerve endings. These cells were ovoid to elliptical in shape and rested on the basal lamina. Their surface had spine like cytoplasmic processes which interwined with the adjacent basal cells. Their nuclei were large lobulated with 2–3 deep notches. Moreover, numerous dense-core granules surrounded by electron-lucent halo were aggregated in the basal portion of the cells close to the nerve ending as well as melanin pigments in the apical portion. The ultrastructural characteristics of the Merkel-like basal cells of NSI were typical to those of Merkel cells, but with some morphological differences, including their location, cellular attachments, and connections to other structures. The potential functions were discussed in the light of the cellular context and architecture. The Merkel-like basal cells of the NSI neuroepithelium might play a role in nociception and magnetoreception in dromedaries.

ESEM-EDX Mineralization and Morphological Analysis of Human Retrieved Maxillary Sinus Bone Graft Biopsies before Loading.

This study aimed to analyze the morphology of bone graft granules, the presence of granule demineralization, and bone morphology in retrieved human maxillary sinus bone graft biopsies. Healthy patients underwent sinus bone augmentation using lateral access. Two different dimensions of the antrostomy were performed, a 4 mm or 8 mm height. After 6 months, all sites received one implant using a flap technique, crestal positioning, and submerged healing. Implant biopsies were retrieved after 3 months and were histologically processed. The ESEM analysis was performed on the entire portion of the peri-implant bone (up to 750 µm from the implant thread). Three different regions of interest (ROIs) were selected: the coronal, middle, and apical portions of the implant. In these areas, EDX was performed, and calcium (Ca), phosphate (P), nitrogen (N), and their atomic ratios (Ca/P, Ca/N, and P/N) were calculated. Different bone tissue electron-dense areas were detected through grayscale intensity quantification of ESEM images with different organic (N) or inorganic (Ca,P) compositions. A total of 16 biopsies from 16 healthy patients were analyzed. Bone graft granules were mostly detected in the apical ROI. New bone tissue bridges were detected in the apical and middle ROI. These structures, with lower Ca/N and P/N ratios, were connected and enveloped the bone graft granules. Cortical ROI revealed the most mineralized bone tissue. Conclusions: After 9 months, bone graft resorption was only partially completed and new bone tissue appeared less mineralized in the middle and apical ROI than in the coronal ROI.

First report of pothos latent virus infecting upland cotton (Gossypium hirsutum) in the United States.

Pothos latent virus (PoLV) is a virus with isometric virions and a positive-sense RNA genome, approximately 4.4 kb in size, currently classified in the genus Aureusvirus, family Tombusviridae (Martelli et al. 1998; Rubino et al. 1995). After its original discovery from hydroponic-grown pothos plants (Scindapsus aureus) in Italy (Sabanadzovic et al. 1995), additional PoLV isolates were reported from pigeonpea (Cajanus cajan) and lisianthus (Eustoma grandiflorum) in India and Taiwan, respectively (Chen et al. 2016; Kumar et al. 2001). PoLV has not been previously reported on the American continent. During 2019, we carried out a state-wide, RT-PCR-based survey for cotton leafroll dwarf virus (CLRDV), as previously described (Aboughanem-Sabanadzovic et al. 2019). Plants exhibiting symptoms reported associated with CLRDV (Avelar et al. 2019) were collected from cotton fields throughout Mississippi. Samples consisted of individually bagged, six inch-long, apical portions collected from five to twelve cotton plants per field. At the end of the season, the total RNAs extracted from a subset of CLRDV-infected samples using a Spectrum RNA extraction kit (Sigma, St Louis, MO), were randomly selected for additional characterization by Illumina 150 nt paired-end high-throughput sequencing at the UIUC Core Sequencing Facility (University of Illinois, Urbana, IL). De novo assembly of 46 to 60 million raw reads/sample was performed by metaSPAdes (Nurk et al. 2017). In addition to several CLRDV-specific contigs, analyses of 184,173 contigs assembled from a sample collected in Clay County (lab code CL-112) revealed a large contig # 63556 of 4298 nt in size with identities ranging from 90.5% to 94.3% with three PoLV genome sequences available in GenBank, suggesting that an isolate of this virus (PoLV-cot; GenBank OP584699) was coinfecting the sample along with CLRDV. Sequence analyses showed that contig #63556 represents approx. 97-98% of the entire PoLV-cot genome. To verify HTS data, specific primers (PoLV-F 5'ACATATATCAGAGAGAGCTCAGGTC3' and PoLV-R 5'GCTCCCATGACAGACCTCACT3') were designed on conserved sequences of all four PoLV genomes and used in a single-tube RT-PCR. The initial tests on RNAs from CL-112 and six other samples from the same field confirmed PoLV-cot infections in the original and an additional cotton plant. Sanger sequencing of the two 294 bp-long RT-PCR products revealed >99% nt mutual identity and 97.5-99% with PoLV isolates. However, none of the additional 226 cotton samples collected in 2019 across the state of Mississippi and 12 samples collected in the same field in 2020 tested positive for PoLV-cot. At this moment, it is not clear whether the PoLV infections originated from infected seeds or, more likely, from soil-borne inoculum. Indeed, several aureusviruses are known to be transmitted by soil either involving vectors belonging to the fungal genera Olpidium and/or Polymyxa (i.e., cucumber leaf spot virus, maize white line mosaic virus), or in a vectorless manner (Rochon et al. 2012). Previous studies on this virus demonstrated low-rate experimental transmission through the soil with no apparent involvement of specific vectors (Chen et al. 2016; Kumar et al. 2001; Sabanadzovic et al. 1995). In summary, results of our study indicate an original report of PoLV on the North American continent, along with description of a new host. Possible impact of PoLV-cot on the cotton industry, or any other susceptible crop in the US, is yet to be understood. Funding: This work has been partially supported by financial support from Cotton Inc, Cotton Foundation, USDA-ARS 58-6066-9-033 and 2020 MAFES-SRI grants. NAS and SS acknowledge partial support from the National Institute of Food and Agriculture, US Department of Agriculture, Hatch Projects Numbers 7001412 and1021494, respectively. The author(s) declare no conflict of interest. 1. Aboughanem-Sabanadzovic, N., et al. 2019. Plant Dis 103: 1798. 2. Avelar, S., et al. 2019. Plant Dis 103: 592. 3. Chen, Y-K., et al. 2016. J Phytopath 164: 650. 4. Kumar, P.L., et al. 2001. Plant Dis 85: 208. 5. Martelli, G.P., et al. 1998. Arch Virol 143: 1847. 6. Nurk, S., et al. 2017. Genome Res 27: 824. 7. Rochon, D., et al. 2012. Virus Taxonomy: Ninth Report of the International Committee on Taxonomy of Viruses. Amsterdam, NL, Elsevier Academic Press, pp 1111-1138. 8. Rubino, L., et al. 1995. J Gen Virol 76: 2835. 9. Sabanadzovic, S., et al.1995. Eur J Plant Pathol 101:171.

Untangling the threads: phylogenetic relationships of threadfins (Percomorphacea: Perciformes: Polynemidae)

AbstractThreadfins are primarily marine bony fishes that have part of the pectoral fin modified into specialized sensitive filaments. They compose the Polynemidae, a family with eight genera and 42 extant species. The internal relationships and phylogenetic position of Polynemidae within Percomorphacea are controversial, with highly conflicting hypotheses proposed by both molecular and phenotypic analyses. We performed a cladistic analysis of threadfins based on the most comprehensive sampling of morphological data ever done. The final dataset included 197 characters from external morphology, the laterosensory system, osteology, myology and neurology in representatives of all valid polynemid genera. More than half of the characters are reported here for the first time, notably the myological ones. A sensitivity analysis of 11 different weighting schemes (equal weighting and extended implied weighting parsimony) resulted in a fully resolved tree. Sciaenidae, not Pleuronectiformes, is recovered as sister to Polynemidae. All polynemid genera are resolved as monophyletic except Polydactylus, which is polyphyletic. Filimanus, Pentanemus and Polydactylus s.s. appear as successive sister taxa of all remaining threadfins. Leptomelanosoma, Parapolynemus and Polynemus form a monophyletic group. Eleutheronema and Galeoides appear intercalated with other species of Polydactylus in the apical portions of the polynemid tree.

Effect of separated instruments on periapical pH using calcium hydroxide as an intracanal medicament in curved root canals

Objective: To evaluate the effect of intracanal separated instruments with different lengths on periapical pH levels using calcium hydroxide (CH) as an intracanal medicament in curved root canals.&#x0D; Materials and Methods: 120 teeth (root canal curvature &gt;25˚) were divided into six groups following the root canal preparation. In Group 1, 2 mm and in Group 2, 4 mm NiTi instruments were separated in the apical portion of the root canals and CH paste was applied. In Groups 3 and 4, no separated instrument but CH was applied. In Groups 5 and 6, neither a separated instrument nor CH. The samples were placed inside a glass tubes with distilled water. pH of this distilled water was measured at different time-points.&#x0D; Results: At all-time points, pH values between the experimental groups were similar except at 1-day (Group 1 &lt; Group 2, P&lt;0.05). At the 2-day and 30-day time points, Group 3 showed higher pH values than Group 1 (P&lt;0.05). At 7-day and 14-day points, pH values were similar.&#x0D; Conclusions: The presence of a separated instrument with different lengths in curved root canals did not have a significant effect on the pH increase caused by CH used as an intracanal medicament.

Evaluation of Apically Extruded Debris During Retreatment Procedures Using Various File Systems in Teeth With Simulated Apical Root Resorption: An In Vitro Study.

Aim The aim of this study was to compare the amount of debris produced apically during the removal of root canal obturating material by using various files in extracted teeth with simulated apical root resorption. Materials and methods An in vitro study was conducted in the root canals of 90 extracted mandibular premolar teeth that were prepared with a ProTaper Gold rotary file (Dentsply Maillefer, Ballaigues, Switzerland) and filled with gutta-percha and an AH Plus sealer (Dentsply Maillefer, Ballaigues, Switzerland) using a cold lateral compaction technique. A total of 45 mandibular premolar teeth were randomly assigned to three control groups (i.e., the ProTaper Universal retreatment file (Dentsply Maillefer), the Reciproc Blue file (VDW, Munich, Germany), and the HyFlex Remover file(Coltene/Whaledent, Altstatten, Switzerland)for the removal of root canal filling material, whereas the remaining 45 teeth were treated as the experimental group and their apical portion was modified to simulate apical root resorption. The teeth of this experimental group were randomly divided into three subgroups according to the same three techniques used with the control groups for the removal of root canal filling materials. The apically extruded debris was collected into pre-weighed borosilicate glass tubes and then dried. The mean weight of the apically extruded debris was assessed using an analytical balance to an accuracy of 10-4 g. Further, the data were analyzed using the Kruskal-Wallis test and Tukey's post hoc test. Results In the simulated apical root resorption groups, all file systems were associated with significantly more debris extrusion than the groups without simulated root resorption (a< 0.05). In both the control groups and experimental groups, the ProTaper Universal retreatment file was associated with the least weight of the apically extruded debris (a < 0.05), followed by the Reciproc Blue file and the HyFlex Remover file. Conclusion The amount of debris extruded apically was significantly greater in the teeth with simulated apical root resorption than in those without it. Further, during the removal of the root canal filling materials, HyFlex Remover was associated with significantly more apically extruded debris in all groups.

Sympetaly in the mimosoid clade (Leguminosae, Caesalpinioideae): An unusual trait in the rosid group

Sympetaly is a notable feature within the mimosoid clade (Leguminosae: Caesalpinioideae), specially as it is uncommon in rosids. The way the petals are organized, forming a tubular corolla by the union of the petals directly affects the perception of pollinators. This study examines whether the petal union leading to a sympetalous corolla in the mimosoid clade is widespread and whether there is variation in type and extent. For this purpose, floral buds and flowers of 16 species from 13 genera were collected, fixed, and processed for analysis by light and scanning electron microscopy. Most species studied display a pentamerous sympetalous corolla with free lobes. The petal primordia are individualized and emerge simultaneously on the floral apex, alternating with the sepal primordia. Petals remain free at the beginning of the intermediate stages of development, and subsequently, the petals curve and approach each other, and their margins touch. Epidermal papillae are found on the petals’ apical margin interconnecting the lobes, which enclose the inner organs of the floral bud. The structure of the sympetalous corolla is variable regarding the type and extent of the union. Four different types of sympetaly were found and classified as follows: 1. full connation - petals fully united along their length; 2. connation-coherence - petals genuinely united in the basal portion and coherent in the median and apical portion; 3. full coherence - petals intertwined with papillae throughout; and 4. partial coherence - free petals at the base and intertwined with papillae in the middle and apical portion. Thus, sympetaly of mimosoid legumes results from postgenital union of the petals at the apical, median, and basal regions during their development by tissue union (connation), intertwining of epidermal papillae (coherence), or both processes. The mucilage cells found along the petals guarantee the stabilization and flexibility of the tubes, in addition to contributing to the protection of the internal organs of the flower. Although more studies on floral development are needed to understand the evolution of this unusual trait, connation appears to be a derived trait within mimosoids.

Effect of the Gap between Cemented Posts and Remaining Gutta-Percha on the Clinical Outcome of Endodontically Treated Teeth Managed by Undergraduate Dental Students: A Prospective Study with 4 Years of Follow-Up

It is common to detect a gap between the apical portion of the post and the most coronal part of gutta-percha in a root canal during post and core treatment in endodontically treated teeth. It may compromise the seal that gutta-percha material provides in the root canal filling, leading to apical leakage, which is often thought to be one of the most common causes for failure of endodontic treatment. The prevention of apical leakage to achieve a complete apical seal and its effect on periapical health of endodontically treated teeth of post and core in long term clinical research remains unanswered. Post and core treatment were provided to 100 patients by undergraduate students in the year 2016–2017. A total of 70 patients in all were called back to the Prosthodontic Clinic for follow-up care after 4 years to assess the clinical result in terms of the gap between the post-operative and residual gutta-percha. The cemented posts were divided into three groups depending on the space between the cemented post end and the remaining gutta-percha: group I revealed no gaps, group II revealed gaps between &gt;0.1 and 1 mm, and group III revealed gaps more than 1 mm. The periapical index (PAI) was used to determine the apical condition of each tooth. Chi-square test was used for evaluating the data, and a p-value of 0.05 was considered statistically significant. A total of 28.6% post and core treated teeth were found diseased while 71.4% teeth were found normal. In group I, 90% of the teeth and in group II, 66.7% of teeth were evaluated as normal; however, in group III, 41.2% teeth were found diseased. In endodontically treated teeth restored with a post and core, a gap between the apical end of the post and the coronal section of the residual gutta-percha was associated with a greater prevalence of disease. The post and core treatment by undergraduate students achieved a clinically acceptable outcome in terms of the gap between the post end and the remaining gutta-percha.

RIGHT VENTRICULAR FUNCTION IN ARTERIAL HYPERTENSION (M-MODE ECHOCG STUDY)

Objective: Until recently Researchers underestimated right ventricular (RV) physiological and described it as passive conduit with a little pumping capability which just connects right atrium (RA) with pulmonary artery. Over the last decades, numerous studies have demonstrated the physiological and clinical importance of RV function. Contrary to the LV, the RV has much complex geometry. It consists of an inlet, outlet, and apical trabecular portion which are different structurally and functionally. There is no information about Right ventricular outflow structure and function in patients with Arterial Hypertension (AH). The aim of the research was to study the changes of RV Outflow and Inflow functional parameters in patients with Arterial Hypertension. Design and method: We studied 214 patients AH (male-115, fem-99, mean age 55.6±12.2, mean arterial pressure – systolic 174.1±15.2, diastolic 96.8±11.2). Control group consist from 180 normal persons (male-88, fem-92, mean age 49.7±12.2, mean arterial pressure – systolic 122.1±12.2, diastolic 71.8±10.2). All participants undergone standard EchoCG examination. Two-dimensional echocardiograms of the parasternal short axis view at the level of the aortic root were obtained for the RVOT sizes and fractional shortening (RVOT-FS) values. M-mode recordings of the RVOT were obtained and dimensions were measured at end -diastole and end systole. RV outflow Fractional Shortening (RVoutFS%, calculated with formula (RVoutDiastD-RVoutSystD)/RVoutDiastD%). Results: 12 patients had stage-1 AH, 138- stage 2 and 64 stage 3 AH. In AH group RV wall thickness (4.2±0.9 mm versus 3.5±0.7mm), RV outflow tract systolic and diastolic diameters (32.8±4.8mm and 14.7±3.2mm versus 30.8±4.7 and 13.2±2.8mm) where greater and RVoutFS% (55.1±4.8% versus 58.8±4.3%) Pulmonary flow acceleration time (121.6±17.1versus 132.6±12.2 msec) lesser then in control. On the other hand, there was no difference in TAPSE between the groups. Conclusions: Despite any differences in RV inflow function There are prominent changes in RV outflow tract function and structure in patients with AH. RVoutFS% is a marker of early functional changes of RV in patients with AH

C83 BEHIND MYOCARDITIS DIAGNOSIS

Abstract Background Myocarditis is an inflammatory disease of myocardium, with a wide range of clinical presentation. Myocarditis may mimic acute coronary syndrome (ACS), but it is also possible an overlap between these two different syndromes, as we considered the close relationship between wide inflammatory systemic condition and coronary atherosclerotic plaque instability Case report: We report the case of 29 years old man admitted to emergency department for burning chest pain changed with breathing and in different positions of the body, associated to dyspnea on mild–moderate exertion. Symptoms had begun to arise a week earlier, with flu–like symptoms, and got worse in the last 48 hours. In his clinical history the patient reports: previous myocarditis, dyslipidemia, hyperhomocysteinemia, overweight, family history of cardiovascular disease and a previous COVID infection. Blood tests found a rise of Troponin I HS. Electrocardiogram showed diphasic T wave in antero–lateral leads. An echocardiogram showed left ventricle with normal cavitary dimensions and preserved global systolic function, apical segment of interventricular septum and inferior wall hypokinetic; minimal pericardial detachment with leaflet hyperecogenicity. The patient was admitted to Cardiology ward, and he was given a medical therapy with colchicina 0.5 mg 1 cp x 2/die and AcetylSalicilic Acid 1000 mg x 3 /die. Cardiac Magnetic Resonance showed epi–mesocardial LGE in inferior and lateral distal segments, compatible with myocarditis. CT coronary angiography exhibited a calcified plaque determining partial caliber reduction in anterior descending coronary proximal segment, the coronary in its apical portion appeared ectatic, hypodense and poorly dulled likely for steno–occlusion. Therefore, it was performed a coronary angiography that revealed an anterior descending coronary artery occluded at the apical tract, the OCT showed plaque erosion with thrombotic apposition at the mid–proximal tract of the vessel. Finally, considered results of instrumental exams, a second antiplatelet agent, a hypolipidemic drug were added Discussion According to the cardiac MRI findings and the coronary angiography, it was hypothesized a picture of acute coronary syndrome triggered by erosion of the unstable coronary plaque, induced by the massive myocardial inflammation related to the myocarditis. The relationship between acute infections and myocardial infarction has been already established in COVID–19 patients

P421 INTRA–CARDIAC AND ALL LAYERS CARDIAC INVOLVEMENT BY SQUAMOUS NON–SMALL CELL LUNG CANCER

Abstract A 73 year–old man was referred by his general practitioner to our ambulatory for worsening dyspnea. He also reported substantial weight loss (almost 20 kg during the last three months), new onset dysphonia and dry cough. The patient’s medical history also included a former tobacco addiction, arterial hypertension and dyslipidemia. There was not history of cardiomiopathy. Electrocardiogram, showed: sinus rhythm, 60/min with inferior and anterior–lateral abnormality of repolarization. No laboratory exams were available at the first visit. An echocardiogram was performed, showing: marked septal hypertrophy (IVSd= 23 mm), septal hypokinesia, with an ejection fraction at lower limits of normality (EF= 54%), neither systolic anterior motion of the mitral valve. Minimal pericardial effusion was seen. We required a CT scan of the chest, that showed a large (5x8x11cm) mass in the left upper lobe with ipsilateral mediastinal lymphadenopathy. The mass directly extended into the mediastinum with infiltration of pericardial leaflet, left atrium and the left wall of the aortic arch. A hypodense formation of approximately 4 cm in the interventricular septum in the apical portion was reported. PET–CT with FDG was performed, which documented hypercaptation of the radioactive tracer at the level of the above–mentioned lesions. The patient underwent fine–needle aspiration biopsy of the lung mass and the histological examination led to the diagnosis of squamous cell carcinoma of the lung. Systemic treatment with carboplatin plus placlitaxel and pembrolizumab was subsequently started. A cardiac CMR was performed, which documented an area of 30x17x31 mm located at the septal (mid–apical portion), apex and parapical portion of the free wall of the right ventricle with transmural extension. At this area, extensive late gadolinium enanchement (LGE) at marginal level with a central non–capillary core and hyperintense in T2 sequences (compatible with central necrotic lesion). The pericardium also showed LGE and a mild pericardial effusion (maximum 8 mm); left atrium involvement, seen on CT, was not documented . After he completed the third cycle of CHT, at 5 months from the diagnosis, the echocardiogram showed a substantial disappearance of the mass infiltrating the interventricular septum without evidence of pericardial effusion. The ecg was substantially unchanged. The patient stopped carboplatin and paclitaxel after 3 cycles and kept maintenance pembrolizumab still ongoing.

P137 STEMI IN YOUNG MAN: A "CHALLENGE" CASE OF SPONTANEOUS CORONARY DISSECTION

Abstract A 21–years old male patient presented to the emergency department complaining chest pain in the night. There was no family history of cardiovascular events; he did not have any known risk factors and denied drug abuse. Pathological history was positive for allergic asthma. On admission, he was paucisyntomatic. The physical examination was normal. Blood pressure was slightly elevated. The EKG showed sinus rhythm, ST segment elevation in high lateral leads and reciprocal ST depression in inferior leads. The echocardiogram showed anterolateral and mid–apical septal akinesia of the left ventricle with ejection fraction of 45%. The urgent coronary angiography showed suspected coronary artery dissection of the first diagonal branch with TIMI flow grade 2 and myocardial brigde of the middle segment of the left anterior descending artery (fig.1). An initial conservative management with beta–blockers, dual antiplatelet therapy, statin and ACE–inhibitors was adopted: the patient was asymptomatic and the EKG became normal during the coronary angiography. In addition the young age, the suspicion of Spontaneous Coronary Artery Dissection (SCAD) and TIMI flow grade 2 in the culpit vessel provided support of conservative treatment. The hospital stay was unremarkable. Troponin T peak value was 1542 pg/ml (n.v. &amp;lt; 13 pg/ml). Thrombophilia screening showed mild hyperhomocysteinemia and homozygous MTHFR mutation. Autoimmunity screening was negative. The subsequent echocardiogram showed mid–distal hypokinesia of the anterolateral, inferolateral and anterior wall of the left ventricle with normal ejection fraction. The CT angiography of the cerebral and abdominal vessels was normal. The cardiac magnetic resonance imaging (MRI) confirmed a recent acute myocardial infarction of the mid–apical portions of the anterior and anterolateral wall and normal global contractile function of the left ventricle (fig. 2, 3). At 30 days follow up, the echocardiogram remained unchanged; the coronary AngioCT scan confirmed the dissection of the ostium and proximal section of the first diagonal branch; the cardiac MRI showed transmural fibrosis of the anterolateral wall with normal left ventricular ejection fraction. SCAD is an under–reported pathology. It can lead to acute coronary syndromes and life–threatening consequences. Diagnosis and treatment are still under debate. The presented clinical case, effectively treated with conservative therapy, represented a "challenge" in the acute phase.