Anticancer Immunity Research Articles

Abstract 3919: Targeting tissue-resident macrophage progenitors by anti-IL34 restores anti-tumor immunity and suppresses tumor growth

Abstract Macrophages play important roles in tumor microenvironment, where they can promote immune suppression, tumor growth and resistance to checkpoint inhibitor therapy and are the focus of efforts to develop novel cancer therapeutics. Strategies to inhibit macrophage accumulation to suppress tumor growth by blocking their recruitment from circulation have been only partially effective, leading to the identification of roles in tumor progression for tissue resident macrophages that are seeded during embryonic development. We examined the origins of lung tumor associated macrophages using lineage tracing, flow cytometry, and single cell sequencing. By comparing gene expression profiles of resident F4/80hi Lyve1+ Ly6C- macrophages and Ly6C+ F4/80lo CCR2+ recruited macrophages in subcutaneous, lung, central nervous and renal normal and tumor tissues, we identified generic tissue resident macrophage and recruited macrophage transcriptomic signatures, revealing that resident macrophages are characterized by signatures of Myc driven proliferation, fatty acid and cholesterol metabolism and immune suppression, while recruited macrophages are characterized by signature of inflammation and immune stimulation. Resident macrophages were associated with worse outcomes in cancer patients than recruited macrophages. Single cell sequencing and flow cytometry of genetically engineered mouse models of CC10-Cre KrasG12D;p53-/- and SPC-Cre KrasG12D lung cancer revealed that lung tumor progression was characterized by extensive expansion of immune suppressive, Ki67+ resident alveolar macrophages and loss of T cells in the lung. Single cell transcriptomics identified IL-34 expressed exclusively by tumor cells as a possible driver of alveolar macrophage proliferation and IGF1 expressed by tumor associated alveolar macrophages as a possible regulator of tumor cell proliferation. Accordingly, blockade of IL-34 profoundly reduced tissue resident macrophage proliferation, stimulated recruitment of activated T cells, and suppressed growth of KrasG12D driven tumors. Analysis of TCGA data sets revealed that expression of IGF1 or IL34 was associated with reduced survival in lung, kidney, liver, head and neck and ovarian cancer. These studies identify key roles for IL-34 and IGF1 in solid tumor progression and suggest new therapeutic targets for the development of therapeutic strategies to stimulate anti-cancer immunity. Citation Format: Hui Chen, Jaroslav Zak, Mark Paradise, Guangfang Wang, John Teijaro, Mark Onaitis, Judith Varner. Targeting tissue-resident macrophage progenitors by anti-IL34 restores anti-tumor immunity and suppresses tumor growth [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 3919.

Abstract 2716: The O-glycan epitope targeting anti-human carcinoma monoclonal antibody (mAb) NEO-201 can also target human regulatory T cells (Tregs)

Abstract Introduction:NEO-201 is a humanized IgG1 mAb that targets Core 1 and/or extended Core 1 O-glycans expressed by several human solid and blood tumors, as well as neutrophils, but it does not bind to most normal tissues and human immune cell subsets (B cells, CD4+ T cells, CD8+ T cells, NK cells, monocytes). Functional analysis revealed that NEO-201 mediates the killing of its target cells through ADCC and CDC. Previous study has shown that approximately 4.6% of CD4+ T cells express NEO-201 target antigen and that those CD4+ T cells have Tregs phenotype. In addition, in a recent published phase 1 study we observed that NEO-201 binds to CD4+/CD25+/, CD127−/, Foxp3+/, CD15s+ cells from peripheral blood mononuclear cells (PBMCs) from cancer patients with solid tumors. The purpose of this study was to further characterize the phenotype of the specific subset of CD4+ T cells expressing the NEO-201 target antigen. Experimental Design: Human PBMCs were obtained from 7 healthy donors (HD) collected at Osaka University and 6 cancer patients from our ongoing phase II clinical trial (Clinical Trial NCT03476681) evaluating the efficiency of the combination of NEO-201 with pembrolizumab in adults with solid tumors resistant to checkpoint inhibitors. Phenotypic analysis was performed by flow cytometry using NEO-201 and antibodies CD3, CD4, CD25, CD45RA, FoxP3, and CD15s. The same gating strategy was applied for both normal donors and patients to evaluate which fraction of CD4+ T cells is recognized by NEO-201. Fraction (Fr) 1 is naïve Treg, Fr ll is effector Treg, Fr lll is non-Treg, Fr lV is effector CD4 T cells and Fr V is naïve CD4 T cells. Results: Flow cytometry analysis of PBMCs revealed that NEO-201 recognizes naïve Tregs (nTregs: CD3+/CD4+/CD45RA+/Foxp3low cells) while it does not bind to effector Tregs (eTregs: CD3+/CD4+/CD45RA−/Foxp3high cells) in both HD and cancer patients. The % of nTregs in cancer patients was higher than HD. Preliminary results from the ongoing Phase II clinical trial showed that subjects with durable SD had a reduction of circulating nTregs after treatment with NEO-201 compared to baseline levels. Conclusions: NEO-201 binds to human Tregs with significantly higher % of binding to Fr l and a greater % of Tregs expressing NEO-201 target antigen in cancer patients compared to HD. It is conceivable that naïve Tregs in cancer patients express high levels of Core 1 O-glycans. Furthermore, when subjected to TCR stimulation, naïve Tregs undergo proliferation and differentiate into eTregs. eTregs can then infiltrate into tumor microenvironment (TME). These data suggest that depletion of circulating nTregs in cancer patients after NEO-201 treatment may prevent the differentiation of nTregs into eTregs and their accumulation in the TME. This study suggests the potential use of NEO-201 to reduce the Treg-mediated suppression of anticancer immunity. Citation Format: Atsushi Tanaka, Massimo Fantini, Philip M. Arlen, Christina M. Annunziata, Kwong Y. Tsang, Shimon Sakaguchi. The O-glycan epitope targeting anti-human carcinoma monoclonal antibody (mAb) NEO-201 can also target human regulatory T cells (Tregs) [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 2716.

Abstract 2476: Electroporation-mediated novel albumin-fused Flt3L DNA delivery promotes cDC1-associated anticancer immunity

Abstract Introduction: Dendritic cells (DCs) constitute a distinct type of immune cell found within tumors, serving a central role in mediating tumor antigen-specific immunity against cancer cells. Frequently, DC functions are dysregulated by the immunosuppressive signals present within the tumor microenvironment (TME). Consequently, DC manipulation holds great potential to enhance the cytotoxic T cell response against cancer diseases. The Fms-like tyrosine kinase receptor 3 ligand (Flt3L) is a pluripotent growth factor that regulates the maturation and differentiation of DCs in hematopoiesis. The in vivo administration of Flt3L itself is limited by its short serum half-life. To overcome this major drawback, our group developed a novel fusion protein albumin-Flt3L (alb-Flt3L), which is the conjugation of albumin to Flt3L. Our hypothesis is that the Flt3L, which has extended bioavailability, is a feasible therapeutic strategy to overcome these treatment limitations. Method: A novel alb-Flt3L DNA, a plasmid encoding the alb-Flt3L protein, was administrated for its anti-tumor effect on TC-1 tumor-bearing C57BL/6 mice. For the generation of pcDNA3-albFlt3L, mouse Flt3 ligand was amplified by PCR using cDNA template of pcDNA3-Flt3L1 and a set of primers, 5′- TTTGAATTCGGGACACCTGACTGTTACTTC-3′ and 5′- AAACTTAAGCTACTGCCTGGGCCGAGGCTCTGG -3′. alb-Flt3L DNA (10ug), Flt3L DNA (10ug) or vehicle control was injected intratumorally followed by electroporation for a total of three times in 5-day intervals. Peripheral blood mononuclear cells and tumor-infiltrated immune cells were isolated after treatment. Flow cytometry was performed for immune cell analysis. Results: In this current study, the electroporation-mediated delivery of alb-Flt3L DNA demonstrated the ability to induce an anti-tumor immune response. This albumin fusion construct possesses more persistent bioactivity in targeted organs. Furthermore, mice receiving alb-Flt3L DNA treatment presented better tumor control and superior survival. Cellular analysis revealed that alb-Flt3L DNA administration displayed greater systemic DC population. In addition, robust cDC1 expansion, which is associated with superior antigen cross-presentation and cellular immunity against tumors, developed extensively in the tumor, lymph node, and blood. In addition, increased levels of IFN-γ-secreting CD8+ lymphocytes and tumor-infiltrated immune cells were found in correlation to greater cDC1 population. Conclusion: Our data showcases a novel DC-based immunotherapy using electroporation to administer alb-Flt3L DNA. The treatment effect is revealed by a controlled tumor response, characterized by enhanced DC mobilization and accumulation in both the lymph nodes and TME, coupled with an increase in the expansion of cDC1 subsets and a heightened level of CD8+ T cell activation. Citation Format: Ming-Hung Hu, Tzyy-Choou Wu, Chien-Fu Hung. Electroporation-mediated novel albumin-fused Flt3L DNA delivery promotes cDC1-associated anticancer immunity [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 2476.

Abstract 6662: Modified oncolytic viruses with immunomodulatory genes enhance anti-tumor efficacy

Abstract While chemotherapy and radiotherapy are considered first-line treatments for most cancers, their significant side effects have prompted ongoing innovation and the discovery of novel cancer treatment strategies. Oncolytic viruses (OV) as one of the most advanced cancer treatments have shown promising results in treating otherwise untreatable types of cancer in last two decades. After selectively targeting tumor cells, OVs could directly kill cancer cells, and induce a powerful anti-cancer immunity. Recently, we evaluated the anti-tumor effect of a modified OV (mOV) in vitro and in vivo. Firstly, the expression of the transgenes were validated on different tumor cells by FCM and ELISA assay. The results showed that a susceptible cell line was identified which has high expression efficiency of transgenes. In order to evaluate the cytotoxicity of mOV, CCK-8 assay was performed on 30+ tumor cell lines. It indicated that mOV has stronger killing effect on susceptible cells through inducing cellular apoptosis. To further evaluate the biological activity of the transgenes on immune cells, mOV-infected tumor cells and supernatant were collected to treat T cell, NK cell or MoDC. The results demonstrated that mOV infection could significantly promote T cell and NK cell activation, and increase the maturation of moDC cells, resulting in the secretion of IFN-γ by CD8+ T cells. In the in vivo efficacy study, MC38 syngeneic model was used to test the anti-tumor effect of mOV. The result showed that mOV could significantly inhibit the growth of the treatment side tumor, and reduce the contralateral tumor to a certain extent. Blood FCM analysis revealed that the percentage of IFN-γ+CD3+, IFN-γ+CD4+ and IFN-γ+CD8+ T cells were markedly increased by mOV treatment compared with vehicle. In addition, IHC analysis of tumor showed that mOV treatment could promote the infiltration of CD4+, CD8+ and CD86+ positive cells. To study the safety or PK of the mOV, viral bio-distribution and shedding assay were performed to detect viral genome at different tissues or excreta. It indicated that mOV was almost undetectable or at very low levels for 14 days after administration. In conclusion, our study revealed that modified OVs with immunomodulatory genes have good anti-tumor efficacy both in vitro and in vivo, which could obviously induce the activation of several immune cells. Moreover, the mOV genome was almost undetectable or at very low levels in mouse tissues and excreta. Keywords: Oncolytic virus, immunotherapy, immunomodulatory genes Citation Format: Zhongbao Song, Guangxu Ding, Anran Xia, Wanqing Ma, Qiuhong Li, Chenhui He, Xu Chen, Zhixiang Zhang, Qingyang Gu. Modified oncolytic viruses with immunomodulatory genes enhance anti-tumor efficacy [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 6662.

Abstract 5269: Evaluation of mitotic spindle inhibitors as cell autonomous inflammatory stimulants in MYC overexpressing breast cancers

Abstract The oncogenic transcription factor MYC is overexpressed in most cancer types, including difficult to treat human malignancies such as receptor triple-negative breast cancers (TNBC). MYC overexpression induces aneuploidy and suppresses anticancer immunity. Elevated levels of MYC can induce mitotic spindle assembly defects and chromosomal instability (CIN) events, exemplified by an increase in cells with micronuclei. These defects are partially mitigated by concomitant upregulation of various mitotic spindle genes. Micronuclei result in cytosolic DNA which can activate cGAS-STING signaling, activating an interferon regulatory transcriptional program responsible for mounting an inflammatory immune response that potentially enhances immune cell recognition. We hypothesized that pharmacological inhibition of specific MYC deregulated mitotic spindle genes will further exacerbate mitotic defects in MYC high cells resulting in synthetic-lethal cell death and additional CIN to activate robust cGAS-STING activation. Interferon activation can increase surface expression of antigen presentation machinery, such as MHC-I, restoring the immunogenicity of MYC high cells. Here, we used mouse breast tumor cells in which MYC expression is conditionally expressed as well as human breast cancer cell lines with different levels of MYC expression. We assessed the anti-proliferative and cytotoxic effects of 9 mitotic small molecular inhibitors that affect spindle function. cGAS-STING activation in inhibitor treated and untreated samples was measured by immunoblotting for pathway proteins phosphorylated TBK1, total TBK1, and IFIT1. Differences in MHC-I cell surface expression was quantified using flow cytometry. Our findings revealed that inhibition of kinesin-like protein KIFC1 and transforming acidic coiled-coil-containing protein 3 (TACC3) induced greater levels of apoptosis in MYC high models. Moreover, inhibition of KIFC1 robustly triggered cGAS-STING activity in MYC high cells as evidenced by increased protein abundance of phospho-TBK1 and IFIT1 in a dose-dependent manner. In addition, sublethal KIFC1 inhibition resulted in increased levels of MHC-I surface expression in MYC high models. Our findings suggest that inhibition of MYC regulated mitotic spindle genes, specifically KIFC1, can serve to preferentially eliminate MYC overexpressing aggressive cancers. Furthermore, sublethal concentrations of a KIFC1 inhibitor can stimulate a tumor cell-intrinsic inflammatory-pathway. Future studies will determine if targeting KIFC1 can enhance the response of MYC high cancers to immunotherapy. Citation Format: Mauricio Jacobo, Andrei Goga. Evaluation of mitotic spindle inhibitors as cell autonomous inflammatory stimulants in MYC overexpressing breast cancers [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 5269.

Abstract 5737: Enhancing cancer treatment Via a nanostructured chemoimmunotherapy gel facilitating interleukin-2 delivery and immunogenic cell death induction

Abstract Background: The landscape of immunotherapy, employing recombinant cytokines like interleukin-2 (IL-2), confronts challenges marked by its short half-life, systemic toxicity, and constrained tumor accumulation. These hurdles are particularly evident in the context of the immunosuppressive milieu characterizing pancreatic ductal adenocarcinoma (PDAC). Chemo-immuno-therapeutic synergies, notably those provoking immunogenic cell death (ICD), have demonstrated superior efficacy. This investigation delves into Pt-NHC as a type II ICD inducer to surmount immunosuppression and amplify antitumor immunity within a highly tumor-accumulated liposomal drug delivery system. Additionally, the co-administration of the angiotensin receptor blocker, losartan, mitigates desmoplasia in PDAC, further augmenting the efficacy of immunotherapy. Methods: To address the constraints of IL-2, a lipid-coated nanogel, IL2-Pt@Nanogel, was innovated, amalgamating silk fibroin-loaded IL-2 with Pt-NHC. The nanogel aimed to enhance IL-2 pharmacokinetics and optimize tumor targeting. Concurrently, losartan was employed to alleviate desmoplasia within the tumor microenvironment. Result: The chemoimmunotherapy nanogel, when coupled with losartan, showcased therapeutic potential in murine models of desmoplastic PDAC. Pt-NHC induced ER-localized reactive oxygen species (ROS) and DAMP release, reshaping the immunosuppressive microenvironment by repolarizing M2-type macrophages to M1 and diminishing the regulatory T-cell population. Co-delivery of IL-2 and Pt-NHC in the nanogel enhanced T-cell infiltration and activation, curbing tumor progression in primary and liver metastasized PDAC models. Importantly, the addition of losartan reduced collagen accumulation within tumors, resulting in heightened infiltration of effector T cells and more pronounced suppression of tumor growth in PDAC and metastasized liver. Conclusion: This study introduces an innovative nanogel delivery system (IL2-Pt@Nanogel) for chemoimmunotherapy, effectively addressing the challenges associated with IL-2 therapy. Leveraging the enhanced permeability and retention (EPR) effect, the nanogel improves IL-2 stability and tumor delivery. Pt-NHC incorporation induces ICD, reshaping the tumor microenvironment, and in synergy with losartan, elicits robust anticancer immunity. This strategy holds promise for clinical translation as a secure and efficient treatment for immunosuppressive and desmoplastic cancers, such as PDAC, presenting a distinctive therapeutic avenue. Citation Format: Hsuan Yu Mu, Yen-Nhi Ngoc Ta, Jing Rui Max Tham, Fu-Fei Hsu, Yu-Chieh Lin, Hsi-Chien Huang, Yun-Chieh Sung, Chih-I Huang, Ching-Ling Wu, Chao-Hung Chang, Sheng Yang, Tsung-Ying Lee, Jane Wang, Dan G. Duda, Yves Boucher, Jen-Huang Huang, Wee Han Ang, Yunching Chen. Enhancing cancer treatment Via a nanostructured chemoimmunotherapy gel facilitating interleukin-2 delivery and immunogenic cell death induction [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 5737.

Abstract 2729: Discovery and characterization of LILRB2XPD-L1 bispecific antibody SPX-303

Abstract The advent of immunotherapy has led to deep and sometimes durable remissions in certain cancers. However, the variable response rates and development of resistance mechanisms pose significant challenges to the current therapies. The immunosuppressive nature in the tumor microenvironment (TME) can drive many of these observations. Reversing this immunosuppression is a promising avenue for enhancing and broadening the applicability of IO therapies. Macrophages are critically modulated by LILRB2, a pivotal receptor in their maturation and polarization to the M2 immunosupressive phenotype. We report the discovery and development of a novel anti-LILRB2/PD-L1 bispecific antibody, SPX-303, designed using an anti-LILRB2 IgG4 derived from a mouse hybridoma screen and linked with an anti-PD-L1 epitope. SPX-303 demonstrates sub-nanomolar binding affinity to both LILRB2 and PD-L1 targets, effectively blocking the interaction between LILRB2 and its ligand, as well as inhibiting PD-1 binding to PD-L1. In in vitro functional assays, SPX-303 exhibits effects comparable to the parental monomeric anti-LILRB2 (SPX-104) in redirecting macrophage polarization from M2 to M1 stage, as observed in both cultured PBMC and human monocyte-derived macrophage (HMDM) models. Furthermore, SPX-303 demonstrates a synergistic effect in inducing T cell activation in the autologous mixed lymphocyte reaction assay (auto-MLR), surpassing the effects of the anti-LILRB2 epitope (SPX-104) and the anti-PDL1 fragment (single-domain anti-PDL1) alone or in combination. In vivo experiments reveal that SPX-303 significantly inhibits tumor growth. Collectively, these results support SPX-303 as a novel therapeutic antibody that effectively enhances anti-cancer immunity in the treatment of advanced solid tumors. The pre-clinical data as well as the clinical plan of SPX-303 will be presented. Citation Format: Anthony Haight, Qian Chen, Brandon William, Dinh-Duc Nguyen, Robert Cai, Jichun Ma, Michael White, Jindong Jin, Jadon Shen, Martin Siekierzycki, Victoria Hall, Hua Jin, Roland Meier, Justin Moser. Discovery and characterization of LILRB2XPD-L1 bispecific antibody SPX-303 [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 2729.

Abstract 4123: Attenuating breast cancer metastasis with BCL-XL-targeting PROTACs

Abstract B-cell lymphoma X-large (BCL-XL) emerges as a significant player in cancer progression. In our recent findings, we unveil the efficacy of proteolysis-targeting chimeras (PROTACs) directed against BCL-XL, demonstrating their capacity to not only eliminate cancer cells but also target tumor-induced regulatory T cells (TI-Tregs). Notably, BCL-XL's role in promoting breast cancer metastasis extends beyond its anti-apoptotic function. We posit that BCL-XL-targeting PROTACs (BCL-XL-Ps) hold promise for treating metastatic breast cancer. Their potential lies in directly eliminating circulating tumor cells during vulnerable stages and/or triggering anti-cancer immunity through Treg cell depletion. Our experiments underscore the potency of IAP-based PROTACs in facilitating BCL-XL degradation via the ubiquitin-proteasome system (UPS) while mitigating on-target platelet toxicity. Treatment of breast cancer-bearing mice with these compounds demonstrates a tangible reduction in breast cancer metastasis to the lungs. Additionally, our studies reveal a significant depletion of tumor-infiltrating Tregs in mice treated with BCL-XL-Ps. While affirming BCL-XL as a viable therapeutic target for breast cancer metastasis, further exploration into the mechanisms behind BCL-XL-P targeting is imperative. Our future endeavors will be devoted to unraveling whether our BCL-XL-Ps effectively target both tumor-intrinsic BCL-XL, potentially inducing tumor cell death, and tumor-infiltrating Tregs, thereby fostering an adaptive immune response against the tumor cells. Citation Format: Madison E. Carelock, Peiyi Zhang, Mo Jiao, Umasankar De, Zeng Jin, Rachel M. Stump, Sarah G. Williams, Guangrong Zheng, Weizhou Zhang. Attenuating breast cancer metastasis with BCL-XL-targeting PROTACs [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 4123.

Abstract 656: A novel dual-targeting peptide HS1002 enhances anti-tumor activity via GnRH/human telomerase reverse transcriptase (hTERT) interaction in human prostate cancer cells

Abstract Human telomerase reverse transcriptase (hTERT) is overexpressed in most human cancers. hTERT is considered as an important target for cancer therapy. In the present study, a new peptide HS1002 were synthesized with sequence of pGlu-His-Trp-Ser-Tyr-Arg-Leu-Arg-Phe-Ile-Pro-NHEt based on the GnRH agonist and hTERT. The aim of this study was to evaluate HS1002 for its anticancer activity by dual-targeting to GnRH/hTERT in prostate cancer cells. Upon comparison with different prostate cancer cell lines, HS1002 exhibited highest cytotoxicity against LNCaP cells. The hTERT expression correlated with telomerase activity in LNCaP cells, was significantly inhibited by HS1002, resulting in reduction of proliferation, metastasis and increase in apoptosis. Additionally, HS1002 suppressed c-Myc and AKT/ERK pathway in LNCaP cells. In the tumor-bearing nude mice model, HS1002 significantly inhibited tumor growth and downregulated the expression of hTERT and Ki-67 in tumor tissue as evidenced by western blot and immunohistochemistry analysis, respectively. Moreover, repeated subcutaneous injection of HS1002 resulted in the reduction of both serum testosterone levels and seminal vesicle weight. HS1002 also increased cytosolic calcium influx and CRE-luciferase activity in GnRHR-overexpressing HEK293 cells compared to mock-transfected transfected cells. Furthermore, a potent cytotoxicity in LNCaP cells was exhibited by HS1002-activated peripheral blood mononuclear cell (PBMC) with interleukin (IL)-2 using LDH release assay. In addition, a flow-cytometric analysis confirmed an elevation in the production of granzyme B and IFN-γ in CD8+ T cells in the MC38 syngeneic mouse model by HS1002. These data indicate that the inhibition of hTERT expression by HS1002 suppresses prostate cancer cell growth and induced anti-cancer immunity. Therefore, HS1002 might be used as a novel therapeutic drug for prostate cancer. Citation Format: Jae Hyeon Park, Ju Ri Kim, Hwa Young Cha, Hyung Sik Kim. A novel dual-targeting peptide HS1002 enhances anti-tumor activity via GnRH/human telomerase reverse transcriptase (hTERT) interaction in human prostate cancer cells [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 656.

Abstract 5280: Minimizes T cells DNA damage induced by PARP inhibitors and enhances its anti-tumor efficacy

Abstract Background: Poly (ADP-ribose) polymerase (PARP) inhibitors have emerged as promising targeted therapies for ovarian and breast cancer. The sustained remission induced by PARP inhibitors largely depends on T cell activity. However, the direct effects of PARP inhibitors on T cells, as well as their precise impact on T cell DNA integrity and subsequent anti-tumor immune responses, have not been fully elucidated. Method & Result: Following treatment with 25 μM olaparib or 15 μM niraparib for 48 hours, T cell viability decreased by 39.20% and 41.89%, respectively. Reduced proliferation and increased cell death were also observed, as indicated by reduced Ki-67 and elevated cleaved Caspase-3 levels. RNA sequencing further revealed a significant enrichment of DNA damage pathways in T cells after olaparib treatment, which was validated by elevated γH2AX levels in T cells using western blots and immunofluorescence. To assess PARP inhibitor-induced DNA damage in clinical settings, paired ovarian cancer samples pre- and post-niraparib monotherapy were obtained from the NANT trial (NCT04507841). Post-treatment tumor samples exhibited a higher number of γH2AX+ T cells compared to their pre-treatment counterparts. To identify the key protein mediating T cell inhibition induced by PARP inhibitors, a whole genomic CRISPR knock-out screening was conducted in human T cells, revealing an enrichment of sgRNAs targeting PARP1 after PARP inhibitor treatment. This outcome was further confirmed by the knockout of PARP1 in human T cells in vitro, leading to the restored viability and reduced levels of DNA damage after olaparib treatment. Importantly, following cytosine base editors (CBEs) of PARP1 in CAR-T cells, improved anticancer activity was observed both in vitro and in two ovarian cancer patient-derived xenografts (PDX) models when combined with PARP inhibitors. Conclusion: This study observed that PARP inhibitors can cause significant DNA damage in human T cells, resulting in cell death, inhibited proliferation, and impairment of anti-cancer immunity. PARP1 was identified as the target for PARP inhibitor-induced T cell death, and its knockout or point mutation led to improved anticancer efficacy of T cells when used in combination with PARP inhibitors. [JH Liu and XF Jiao contributed equally as co-first authors.] Citation Format: Jiahao Liu, Xiaofei Jiao, Wei Mu, Huayi Li, Li Zhu, Xuejiao Zhao, Gordon B. Mills, Qinglei Gao, Yong Fang. Minimizes T cells DNA damage induced by PARP inhibitors and enhances its anti-tumor efficacy [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 5280.

Abstract 5279: Sequential treatment with PARPi and WEE1i minimizes T cell DNA damage and enhances its immune response

Abstract Background: DNA damage response (DDR) targeted therapy, like PARP inhibitors (PARPi) and WEE1 inhibitors (WEE1i), have demonstrated potent anti-cancer activity and are pronounced to activate the cytosolic immunity pathway. Our previous work showed that sequential inhibition of PARP and WEE1 could kill tumor cells as effective as their concurrent application, with ameliorated toxicity to normal cells, suggesting high clinical translational potential of this regimen. However, the effect of sequential treatment on T lymphocytes and anti-cancer immunity remains largely unknown. Methods and results: T cells were treated with 25 μM olaparib, or 250 nM AZD1775, or olaparib combined with AZD1775 (concurrent group) for 48h, or olaparib for 24h followed by AZD1775 for 24h (sequential group) in vitro. AZD1775 and concurrent treatment reduced the T cell viability to 19% and 14.3%, while sequential treatment maintained the viability to 58.6%, closed to olaparib monotherapy (61.6%). And the most potent proliferation capacity accompanied with the lowest apoptosis level were both recorded after sequential treatment, manifested by the increasing of Ki67 and EdU and the decreasing of cleaved caspase-3. Reverse-phase protein arrays (RPPA) analyses identified relieved DNA damage in T cells receiving sequential treatment. Alkaline comet assay and detecting of γH2AX further confirmed that the T cell DNA damage caused by PARPi and WEE1i was obviously alleviated after sequential therapy. Furthermore, sequential treatment activated cGAS-STING pathway effectively and upregulated the production of CCL5, CXCL10 and IFNβ of downstream type I interferon response compared with monotherapy and concurrent treatment in ovarian cancer cell lines (SKOV3, OVCAR8, A2780). We also evaluated an ID8 intraperitoneal syngeneic immunocompetent mouse model. T cells isolated from tumors, ascites, spleen and peripheral blood in sequential group were presented with the highest proliferation potential and the lowest level of DNA damage. And the tumor burden of mice in sequential group was obviously subsided, which was comparable to that in concurrent group. Conclusions: This study demonstrated that targeting PARP and/or WEE1 impaired the T cell viability and led to DNA damage. However, administrating PARPi and WEE1i sequentially diminished this inhibitory effect on T cells on the premise of ensuring their anti-tumor effect. These data provide strong rational for the further investigation on exploring the clinical significance of sequential treatment with PARPi and WEE1i. Citation Format: Xiaofei Jiao, Jiahao Liu, Wei Mu, Li Zhu, Xuejiao Zhao, Gordon B. Mills, Qinglei Gao, Yong Fang. Sequential treatment with PARPi and WEE1i minimizes T cell DNA damage and enhances its immune response [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 5279.

Dendritic Cell Immunotherapy for Ovarian Cancer: An Overview of Our Achievements

Epithelial ovarian carcinoma (EOC) is the fifth leading cause of cancer-related death in women, largely reflecting the early dissemination of this malignant disease to the peritoneum. Due to its immunological features, EOC has poor response to immune checkpoint inhibitors (ICIs), including a limited tumor mutational burden (TMB), poor infiltration by immune cells, and active immunosuppression. Thus, novel strategies are needed to overcome the frequent lack of pre-existing immunity in patients with EOC. We developed and tested an autologous dendritic cell (DC)-based vaccine (DCVAC), which has recently been shown to be safe and to significantly improve progression-free survival (PFS) in two independent randomized phase II clinical trials enrolling patients with EOC (SOV01, NCT02107937; SOV02, NCT02107950). In addition, our exploratory data analyses suggest that the clinical benefits of the DCVAC were more pronounced in patients with EOC with lower-than-median TMBs and reduced CD8+ T cell infiltration. Thus, the DC-based vaccine stands out as a promising clinical tool to jumpstart anticancer immunity in patients with immunologically “cold” EOC. Our findings underscore the need for personalized immunotherapy and the clinical relevance of potential tumor-related biomarkers within the immunotherapy field. Additional clinical trials are needed to address these strategies as well as the potential value of the TMB and immune infiltration at baseline as biomarkers for guiding the clinical management of EOC.

Ultrasound-triggered with ROS-responsive SN38 nanoparticle for enhanced combination cancer immunotherapy.

Controlled generation of cytotoxic reactive oxygen species (ROS) is essential in cancer therapy. Ultrasound (US)-triggered sonodynamic therapy (SDT) has shown considerable ability to trigger in situ ROS generation. Unfortunately, US therapy alone is insufficient to trigger an efficient anticancer response, owing to the induction of multiple immunosuppressive factors. It was identified that 7-ethyl-10-hydroxycamptothecin (SN38) could notably inhibit DNA topoisomerase I, induce DNA damage and boost robust anticancer immunity. However, limited by the low metabolic stability, poor bioavailability, and dose-limiting toxicity, the direct usage of SN38 is inadequate in immune motivation, which limits its clinical application. Hence, new strategies are needed to improve drug delivery efficiency to enhance DNA topoisomerase I inhibition and DNA damage and elicit a vigorous anticancer cancer immunity response. Considering US irradiation can efficiently generate large amounts of ROS under low-intensity irradiation, in this study, we aimed to design a polymeric, ROS-responsive SN38 nanoformulation for in vivo drug delivery. Upon the in-situ generation of ROS by US therapy, controlled on-demand release of SN38 occurred in tumor sites, which enhanced DNA damage, induced DC cell maturation, and boosted anticancer immunity. Our results demonstrated that a new strategy of involving the combination of a SN38 nanoformulation and US therapy could be used for cancer immunotherapy.

Integration of Ethanol and the Immune Modulator Curcumin for Immunoablation of Hepatocellular Carcinoma

PurposeTo investigate immuno-ethanol ablation using an ethanol and immune adjuvant formulation as a potent immunoablation approach that can achieve an enhanced anticancer effect in the treatment of hepatocellular carcinoma (HCC). Materials and MethodsEthanol concentration– and exposure time–dependent cellular responses were investigated. Curcumin was combined with ethanol as an immunoablation agent. Cellular uptake of curcumin, cancer cell killing, and inflammatory markers of ethanol-curcumin treatment were characterized. To evaluate the potential in vivo anticancer immunity of ethanol-curcumin treatment, each right and left lobe of rat liver was concurrently inoculated with N1S1 HCC cells and a mixture of treated N1S1 cells (ethanol only or ethanol-curcumin) in Sprague Dawley rats (each group: 5 rats; control: nontreated N1S1 cells). Tumor growth and immune response were characterized with 7T magnetic resonance (MR) imaging, flow cytometry analysis, and immunohistology. ResultsAn optimized ethanol-curcumin (10% ethanol and 0.5% weight/volume (w/v) curcumin solution) treatment contributed to an enhanced cellular uptake of curcumin, increased cancer cell killing, and decreased inflammatory reaction. Ethanol-curcumin–treated N1S1 cell implantation in the rat liver demonstrated N1S1 HCC tumor rejection. The secondary tumor growth by nontreated N1S1 cell inoculation was significantly suppressed at the same time. Activated anticancer immunity was evidenced by significantly increased CD8+ T cell infiltration (3.5-fold) and CD8+–to–regulatory T cell ratio (4.5-fold) in the experimental group compared with those in the control group. ConclusionsEnhanced anticancer effect of immuno-ethanol ablation could be achieved with ethanol-curcumin agent. The results underscore the importance of optimized immunoablation therapeutic procedures for enhanced therapeutic outcomes.

Phototruncation cell tracking with near-infrared photoimmunotherapy using heptamethine cyanine dye to visualise migratory dynamics of immune cells

Noninvasive invivo cell tracking is valuable in understanding the mechanisms that enhance anti-cancer immunity. We have recently developed a new method called phototruncation-assisted cell tracking (PACT), that uses photoconvertible cell tracking technology to detect invivo cell migration. This method has the advantages of not requiring genetic engineering of cells and employing tissue-penetrant near-infrared light. We applied PACT to monitor the migration of immune cells between a tumour and its tumour-draining lymph node (TDLN) after near-infrared photoimmunotherapy (NIR-PIT). PACT showed a significant increase in the migration of dendritic cells (DCs) and macrophages from the tumour to the TDLN immediately after NIR-PIT. This migration by NIR-PIT was abrogated by inhibiting the sphingosine-1-phosphate pathway or Gαi signaling. These results were corroborated by intranodal immune cell profiles at two days post-treatment; NIR-PIT significantly induced DC maturation and increased and activated the CD8+ T cell population in the TDLN. Furthermore, PACT revealed that NIR-PIT significantly enhanced the migration of CD8+ T cells from the TDLN to the tumour four days post-treatment, which was consistent with the immunohistochemical assessment of tumour-infiltrating lymphocytes and tumour regression. Immune cells dramatically migrated between the tumour and TDLN following NIR-PIT, indicating its potential as an immune-stimulating therapy. Also, PACT is potentially applicable to a wide range of immunological research. This work was supported by the Intramural Research Program of the National Institutes of Health, National Cancer Institute, Centre for Cancer Research (grant number: ZIA BC011513 and ZIA BC011506).

Vitamin D in Cutaneous T-Cell Lymphoma.

Cutaneous T-cell lymphoma (CTCL) is characterized by the proliferation of malignant T cells in inflamed skin lesions. Mycosis fungoides (MF)-the most common variant of CTCL-often presents with skin lesions around the abdomen and buttocks ("bathing suit" distribution), i.e., in skin areas devoid of sun-induced vitamin D. For decades, sunlight and vitamin D have been connected to CTCL. Thus, vitamin D induces apoptosis and inhibits the expression of cytokines in malignant T cells. Furthermore, CTCL patients often display vitamin D deficiency, whereas phototherapy induces vitamin D and has beneficial effects in CTCL, suggesting that light and vitamin D have beneficial/protective effects in CTCL. Inversely, vitamin D promotes T helper 2 (Th2) cell specific cytokine production, regulatory T cells, tolerogenic dendritic cells, as well as the expression of immune checkpoint molecules, all of which may have disease-promoting effects by stimulating malignant T-cell proliferation and inhibiting anticancer immunity. Studies on vitamin D treatment in CTCL patients showed conflicting results. Some studies found positive effects, others negative effects, while the largest study showed no apparent clinical effect. Taken together, vitamin D may have both pro- and anticancer effects in CTCL. The balance between the opposing effects of vitamin D in CTCL is likely influenced by treatment and may change during the disease course. Therefore, it remains to be discovered whether and how the effect of vitamin D can be tilted toward an anticancer response in CTCL.

Design, Synthesis, and Structure-Activity Relationship of Novel Pyridazinone-Based PARP7/HDACs Dual Inhibitors for Elucidating the Relationship between Antitumor Immunity and HDACs Inhibition.

Histone deacetylases (HDACs) inhibitors such as vorinostat (SAHA) has been used to treat hematologic malignancies (rather than solid tumors) and have been found to suppress the JAK/STAT, a critical signal pathway for antitumor immunity, while PARP7 inhibitor RBN-2397 could activate the type I interferons (IFN-I) pathway, facilitating downstream effects such as STAT1 phosphorylation and immune activation. To elucidate whether simultaneous inhibition of these two targets could interfere with these two signal pathways, a series of pyridazinone-based PARP7/HDACs dual inhibitors have been designed, synthesized, and evaluated in vitro and in vivo experiments. Compound 9l was identified as a potent and balanced dual inhibitor for the first time, exhibiting excellent antitumor capabilities both in vitro and in vivo. This suggests that 9l can be used as a valuable tool molecule for investigating the relationship between anticancer immunity and HDAC inhibition.

Engagement of sialylated glycans with Siglec receptors on suppressive myeloid cells inhibits anticancer immunity via CCL2.

The overexpression of sialic acids on glycans, called hypersialylation, is a common alteration found in cancer cells. Sialylated glycans can enhance immune evasion by interacting with sialic acid-binding immunoglobulin-like lectin (Siglec) receptors on tumor-infiltrating immune cells. Here, we investigated the effect of sialylated glycans and their interaction with Siglec receptors on myeloid-derived suppressor cells (MDSCs). We found that MDSCs derived from the blood of lung cancer patients and tumor-bearing mice strongly express inhibitory Siglec receptorsand are highly sialylated. In murine cancer models of emergency myelopoiesis, Siglec-E knockout in myeloid cells resulted in prolonged survival and increased tumorinfiltration of activated T cells. Targeting suppressive myeloid cells by blocking Siglec receptors or desialylation strongly reduced their suppressive potential. We further identified CCL2 as a mediator involved in T-cell suppression upon interaction between sialoglycans and Siglec receptors on MDSCs. Our results demonstrated that sialylated glycans inhibit anticancer immunity by modulating CCL2 expression.

Biomimetic MOF‐Based Nano‐Immunoactivator via Disruption of Ion Homeostasis for Strengthened Tumor Microwave‐Immunotherapy

AbstractImmunogenic cell death (ICD) is a promising strategy for anticancer immunity by inducing antigen‐presenting cell maturation. However, the traditional ICD inducers, such as chemotherapeutic agents, have largely hampered their application by severe side effects and low tumor selectivity. The changes intra/extracellular ion concentrations affect the growth and metastasis of tumor cells. Interference with ion homeostasis can induce tumor cell death and elicit immune responses. Here, a biomimetic Ga‐based metal–organic framework (MOF) coated with red blood cell–platelet fusion membrane (RPM), that is, 5‐fluorouracil@GaMOF@RPM (5‐FUGR) nano‐immunoactivator, is reported as a highly efficient ICD inducer for enhanced microwave (MW)‐immunotherapy. Following intravenous administration, 5‐FUGR accumulates to tumor site via RPM biomimetic modification‐mediated long circulation and active targeting. The structure of 5‐FUGR undergoes degradation and releases Ga3+. MW combined with high concentrations of Ga3+ disrupts intracellular ion homeostasis, which leads to severe oxidative stress and intracellular Ca2+ retention to promote apoptosis of tumor cells. More importantly, 5‐FUGR combined with MW not only completely eradicates 4T1 primary tumors, but also induces efficient ICD, immune initiation, and memory effects to inhibit metastatic and recurrence of the tumor. Thus, 5‐FUGR, as a strong ICD inducer, provides new insights into achieving tumor immunity in combination with other therapies.

Abstract IA005: Regional combating of immunosuppressive forces in the ovarian tumor microenvironment

Abstract IA005: Regional combating of immunosuppressive forces in the ovarian tumor microenvironment