Annealing Temperature Ta Research Articles

Shape memory effect in metallic glasses

Shape memory effect in metallic glasses

Effect of Fe content on crystallization behavior and soft magnetic properties in FINEMET-type alloys

The effect of Fe content on crystallization behavior and soft magnetic properties in Fe75.8+xSi9.3-xB8.9P3Nb2.5Cu0.5 (x = 0 ~ 7 at.%) alloys were investigated. The phase structure identified by XRD reveals that the glass forming ability (GFA) of alloys decreases with Fe increasing. TEM results confirm that the non-uniform structure of as-cast alloys and high Fe content are beneficial to the rapid nucleation of α-Fe when nucleation element of Cu is a constant, but the ability of Nb to hinder the growth of α-Fe grains is weakened, which will lead to the coercivity (Hc) to be highly sensitive to annealing temperature (Ta).

Change of longitudinal spin Seebeck voltage with annealing in Y3Fe5O12 films formed by densely packed nanocrystals

The changes of longitudinal spin Seebeck (LSSE) voltage with annealing temperature Ta and time in Y3Fe5O12 (YIG) films formed by densely packed nanocrystals on a Si substrate have been investigate. The value of thermoelectric performance (TP) decreases monotonically with increasing Ta from 1073 K to 1273 K, and it decreases by up to 24% (64%) in the YIG films with Pt = 5 nm (10 nm). The decreased TP is also observed with increasing annealing time. These results indicate that the microstructural changes in the YIG films by annealing temperature and time are caused the decreased TP, which are corresponded with a reduced coherence of the magnons in the YIG films.

Effect of annealing temperature on structure and high-temperature soft magnetic properties of (Fe0.9Co0.1)72.7Al0.8Si13.5Cu1Nb3B8V1 nanocrystalline alloy

The structure and soft magnetic properties of nanocrystalline (Fe0.9Co0.1)72.7Al0.8Si13.5Cu1Nb3B8V1 alloy annealed at 510−690 °C were investigated by XRD patterns and initial permeability. It was observed that annealing within the ranges of 510−630 °C, only soft magnetic crystalline phase precipitated from the amorphous matrix. With the increase of annealing temperature, the grain size (D) and volume fraction of the crystalline phase (Vcry) both gradually increase from 11.9 nm to 13.7 nm and from 58 % to 89 % respectively. In the meanwhile, the thickness of the amorphous layer (Λ) gradually decreases from 2.37 nm to 0.54 nm. The change of initial permeability with temperature (μi -T curves) showed that the μi declines with increasing temperature. However, the rate of descent is different and the higher annealing temperature (Ta) corresponds to the slower attenuation of μi. The high-temperature μi gradually improves with annealing temperature (Ta) increasing up to 630 °C, and the higher μi of 1500 can be held up to 600 °C. However, the high-temperature μi dramatically deteriorates after annealing at 690 °C due to the precipitating hard magnetic phase from the residual amorphous matrix.

False negatives in GBA1 sequencing due to polymerase dependent allelic imbalance

A variant in the GBA1 gene is one of the most common genetic risk factors to develop Parkinson’s disease (PD). Here the serendipitous finding is reported of a polymerase dependent allelic imbalance when using next generation sequencing, potentially resulting in false-negative results when the allele frequency falls below the variant calling threshold (by default commonly at 30%). The full GBA1 gene was sequenced using next generation sequencing on saliva derived DNA from PD patients. Four polymerase chain reaction conditions were varied in twelve samples, to investigate the effect on allelic imbalance: (1) the primers (n = 4); (2) the polymerase enzymes (n = 2); (3) the primer annealing temperature (Ta) specified for the used polymerase; and (4) the amount of DNA input. Initially, 1295 samples were sequenced using Q5 High-Fidelity DNA Polymerase. 112 samples (8.6%) had an exonic variant and an additional 104 samples (8.0%) had an exonic variant that did not pass the variant frequency calling threshold of 30%. After changing the polymerase to TaKaRa LA Taq DNA Polymerase Hot-Start Version: RR042B, all samples had an allele frequency passing the calling threshold. Allele frequency was unaffected by a change in primer, annealing temperature or amount of DNA input. Sequencing of the GBA1 gene using next generation sequencing might be susceptible to a polymerase specific allelic imbalance, which can result in a large amount of flase-negative results. This was resolved in our case by changing the polymerase. Regions displaying low variant calling frequencies in GBA1 sequencing output in previous and future studies might warrant additional scrutiny.

Evolution of the surface passivation mechanism during the fabrication of ex-situ doped poly-Si(B)/SiOx passivating contacts for high-efficiency c-Si solar cells

Passivating the contacts of crystalline silicon (c-Si) solar cells (SC) with a poly-crystalline silicon (poly-Si) layer on top of a thin silicon oxide (SiOx) is currently sparking interest for reducing carrier recombination at the interface between the metal electrode and the c-Si substrate. However, due to the interrelation between different mechanisms at play, a comprehensive understanding of the surface passivation provided by the poly-Si/SiOx contact in the final SC has not been achieved yet. In the present work, we report on an original ex-situ doping process of the poly-Si layer through the deposition of a B-rich dielectric layer followed by an annealing step to diffuse B dopants in the layer. We propose an in-depth investigation of the passivation scheme of the resulting B-doped poly-Si/SiOx contact by first comparing the surface passivation provided by ex-situ doped and intrinsic poly-Si/SiOx contacts at different steps of the fabrication process. The excellent surface passivation properties obtained with the ex-situ doped poly-Si(B) contact (iVoc = 733 mV and J0 = 6.1 fA cm−2) attests to the good quality of this contact. We then propose further STEM, ECV and ToF-SIMS characterizations to assess: i) the evolution of the microstructure and B-doping profile through ex-situ doping and ii) the diffusion profile of hydrogen in the poly-Si contact. Our results show a gradual filling of the poly-Si layer with active B dopants with increasing annealing temperature (Ta), which strengthens the field-effect passivation and enables an iVoc increase after annealing up to 800 °C. We also observe a diffusion of O from the SiON:B doping layer to the interfacial SiOx layer during annealing, that likely enhances the passivation stability of our ex-situ doped poly-Si contact with increasing Ta. Finally, we conclude that the mechanism dominating the surface passivation changes during the fabrication process of the poly-Si/SiOx contact from field-effect passivation after annealing (performed for B-diffusion in the contact) to chemical passivation after following hydrogenation of the samples (performed by depositing a H-rich silicon nitride layer).

Structural and optical properties of thermally evaporated and annealed Ge20Se76Sn4 thin films

Amorphous Ge20Se76Sn4 thin films of thickness ~150 nm were prepared, from bulk Ge20Se76Sn4, by thermal evaporation technique. The differential scanning calorimetry analysis of bulk Ge20Se76Sn4 exhibits one glass transition, one crystallization peak, and one melting point. The inclusion of Sn by substituting Se or Ge-atoms into the Ge–Se matrix has been studied using energy-dispersive spectral X-ray, and Fourier-transform infrared spectroscopy. The X-ray diffraction affirms that films annealed at annealing temperature (Ta) ≤ 553 K are amorphous; meanwhile, films annealed at Ta≥ 603 K are crystalline. It was found that the annealing process can be used to tune the linear and nonlinear optical parameters and constants. The decrease in the indirect optical bandgap energy (Eg) with an increase in Ta for Ta ≥ 603 K could be ascribed to the increase in the crystallinity and increasing the density of defects in the bandgap. The estimated Eg were correlated with the refractive index (n) using seven different approaches and the average value of n was increased as Ta increased. It is suggested that the structural, and optical characteristics of the thermally evaporated Ge20Se76Sn4 thin films can be tuned and engineered by the annealing process. Profound analysis of optical parameters for the Ge20Se76Sn4 thin films suggests the utilization of these glasses for numerous photonic applications.

Controllable intrinsic Gilbert damping in Pt buffered [Co/Ni]n multilayers with enhanced perpendicular magnetic anisotropy

We systematically investigate the magnetization precession processes of post-prepared and after-annealing Pt buffered [Co/Ni]n multilayers with adjustable perpendicular magnetic anisotropy (PMA) by time-resolved magneto-optical Kerr effect. The PMA of the [Co/Ni]n multilayers could be modulated by changing the number of Co/Ni periods n, Pt thickness tPt and annealing temperature Ta, respectively. With a fixed tPt, both uniaxial magnetic anisotropy Ku and intrinsic damping constant α0 could be modulated by the variation of n. We observed that α0 is linearly proportional to Ku, since both of them originate from the spin–orbit coupling (SOC). For a fixed n, with the increase of tPt, Ku exhibits a non-monotonic change behavior, but α0 increases monotonously. It is found that α0 shows a nonlinear positve correlation to Ku. It suggests that the SOC is not the only factor affecting the damping process. Finally, for the specific sample, both α0 and Ku also display the different variation behaviors with increasing Ta. In this case, the changes in film microstructure caused by the annealing have different contributions to Ku and α0, resulting in a negative correlation between Ku and α0. The findings could be helpful to design the potential application of [Co/Ni]n multilayers system in STT-MRAM with high density, low power and high thermal stability.

Synthesis and Investigation of the Structure and Optical Properties of Nano -Ni-Cr Films

The thermal evaporation technique was used to prepare the Ni-Cr films with a thickness of 200 nm and a rate of deposition of 0.22nm/Sec. The annealing was performed at 373 and 473 K. The structural and optical analyses of the grown layers were achieved and XRD patterns showed amorphous structure transferred to polycrystalline for film annealed at 373 and 473 K. AFM analysis showed that the surface of Ni-Cr films is homogenous and the average roughness, optical energy gap and absorption coefficient were increased with increasing annealing temperature (Ta).

Effects of annealing temperature on the structure and photoluminescence properties of the ZnO/ZnAl2O4/Ca5Al6O14/Ca3Al4ZnO10:0.1% Ce3+ mixed-phases nanophosphor prepared by citrate sol–gel process

Mixed-phases of the undoped ZnAl2O4/ZnO/Ca5Al6O14 (ZZC) and Ce3+ doped ZnAl2O4/ZnO/Ca5Al6O14/Ca3Al4ZnO10 (ZZCC:0.1% Ce3+) were successfully prepared using the sol–gel method. The 0.1% Ce3+ concentration was kept constant while the annealing temperature (Ta) was varied from 500 to 1300 °C. X-ray diffraction (XRD) results showed that the prepared materials consist of the mixture of the cubic (ZnAl2O4), hexagonal wurtzite (ZnO) and orthorhombic (Ca5Al6O14 and Ca3Al4ZnO10) crystal structures, which highly depends on the Ta. Energy dispersive x-ray spectroscopy (EDS) analysis confirmed the presence of all the expected elementary compositions. Scanning electron microscopy (SEM) results showed that varying the Ta does not influence the morphology of the prepared nanophosphor material. Transmission electron microscopy confirmed that the prepared powders were in the nanoscale region. The photoluminescence (PL) results showed emission peaks located at 409, 488, 545, 589, 615, 695 and 785 nm, which were attributed to the intrinsic defects within ZZC mixed phases. There was no emission observed from the Ce3+ transition. Optimum photoluminescence intensity was observed at the Ta = 600 °C. The commission Internationale de I’Eclairage coordinates (CIE) showed that the emission colour could be tuned by varying the Ta.

Age hardening in superhard ZrB2-rich Zr1-xTaxBy thin films

We recently showed that sputter-deposited Zr1-xTaxBy thin films have hexagonal AlB2-type columnar nanostructure in which column boundaries are B-rich for x < 0.2, while Ta-rich for x ≥ 0.2. As-deposited layers with x ≥ 0.2 exhibit higher hardness and, simultaneously, enhanced toughness. Here, we study the mechanical properties of ZrB2.4, Zr0.8Ta0.2B1.8, and Zr0.7Ta0.3B1.5 films annealed in Ar atmosphere as a function of annealing temperature Ta up to 1200 °C. In-situ and ex-situ nanoindentation analyses reveal that all films undergo age hardening up to Ta = 800 °C, with the highest hardness achieved for Zr0.8Ta0.2B1.8 (45.5±1.0 GPa). The age hardening, which occurs without any phase separation or decomposition, can be explained by point-defect recovery that enhances chemical bond density. Although hardness decreases at Ta > 800 °C due mainly to recrystallization, column coarsening, and planar defect annihilation, all layers show hardness values above 34 GPa over the entire Ta range.

Optimization of crystallization behavior and soft magnetic properties of the Si-free Fe-B-P-C-Cu nanocrystalline alloys by Cu content tuning

The effect of Cu content on amorphous forming ability (AFA), crystallization behavior and soft magnetic properties of the new Si-free Fe84-xB9P3C4Cux (x = 0.7, 0.9, 1.1, 1.3 and 1.5) alloys were systematically investigated. The phase structure identified by XRD reveals that the alloys for Cu content less than 1.3 at. % have good AFA. The dependence of activation energies of nucleation and growth on Cu content shows that the growth of α-Fe grains is more difficult than the nucleation for the alloy ribbons with Cu ≤ 1.1 at. %, which is beneficial to obtain finer nanocrystalline α-Fe grains during crystallization annealing, while for those with Cu > 1.1 at. %, the growth of α-Fe grains is easier than the nucleation. The relationship between coercivity (Hc) and the annealing temperature (Ta) indicates that appropriate Cu content is beneficial to improve the stability of soft magnetic properties, especially, when annealed near the temperature of the first crystallization peak. The nanocrystalline Fe82.9B9P3C4Cu1.1 alloy exhibits a high saturation magnetic flux density of 1.84 T ~ 1.85 T and a low Hc of 13.0 A/m ~ 8.9 A/m annealed in the range of 703 K ~ 763 K.

“Seat of the soul”? The structure and function of the pineal gland in women with alleged spirit possession—Results of two experimental studies

The effects of thermal treatment and Aluminum Oxide [Al2O3] spacer thickness on the de-excitation traces and cross-relaxation among Thulium(III) ions [Tm3+], which prominently impact on the electroluminescence (EL) from different characteristic transitions inside the devices based on Aluminum Oxide upon Thulium(III) Oxide [[Al2O3]/[Tm2O3]] nanolaminate thin solid films, were investigated. The suitable annealing temperatures (Ta) for activating [Tm3+] ions was between 600.0 °C and 800.0 °C, while higher annealing temperatures lead to the reduced EL intensity and life time, resulting from the formation of Thulium Oxide nonstoichiometric compound [TmOx] clusters or agglomerations. All phenomena confirm the critical [Al2O3] spacer thickness of around 3.0 nm, concerning both non-radioactive interaction among excited [Tm3+] ions derived from Förster mode and the acceleration distance for the injected electrons in [Al2O3] matrix.

Effect of annealing on photoluminescence of MgAl1.8Y0.14Eu0.06O4

MgAl2O4 and MgAl1.8Y0.14Eu0.06O4 powders were prepared by sol–gel method and annealed at 600, 800, and 1000 °C. X-ray diffraction patterns confirm the cubic spinel phase with space group Oh7Fd3-m. Increasing the annealing temperature (Ta) resulted in increased octahedral bond lengths and bonding angles resulting in the crystalline phase of the samples. Scanning electron microscopy reveals the micron size flakes morphology and agglomerated grains. The presence of elements such as Mg, Al, Eu, and Y was confirmed by Energy dispersive x-ray spectra. Photoluminescence (PL) was not observed in MgAl2O4 but in the excitation spectra of MgAl1.8Y0.14Eu0.06O4 at emission wavelength 615 nm, both f orbital transitions of Eu3+ ions and charge transfer bands were observed. The intensity of the peak at 392 nm corresponding to the 7F0 → 5L6 transition is strongly dependent on annealing and it is increasing with Ta. Out of 5D0 → 7FJ(= 0, 1, 2, 3, 4) characteristic transitions of Eu3+ ions, the electric dipole transition - 5D0 → 7F2 (618 nm) is prominent in the PL emission spectra. Annealing has further increased the intensity of PL emission spectra. The presence of Eu2+ ions is evident from the broad peak observed around 340 nm (assigned to the 4f65d to 4f7 (8S7/2) transition) in the excitation spectra at emission wavelength 480 nm. The intensity of this peak is decreasing with increasing Ta.

Annealing temperature dependent structural and electrical properties of (Mn,Ni,Co)3O4 thin films

Here, we demonstrated that polycrystalline (Mn,Ni,Co)3O4 films with a high negative temperature coefficient of resistance (NTCR) behavior can be achieved at low annealing temperatures (≤400 °C) via a liquid flow deposition method. The processing conditions applied to obtain the high-quality films were investigated with focus on the flow rate of the oxidizing agent (H2O2) and annealing temperature (Ta). The introduction of an appropriate amount of H2O2 solution into the deposition system led to the partial oxidation of Me2+ ions (Me = Mn, Ni and Co) to Me3+ which subsequently adsorbed to the films, with only little effect on the film surface quality. The pre-existing Mn3+ ions enabled the possibility of reducing the final annealing temperature to 300 °C for the film crystallization with a pure cubic spinel phase. We also studied the dependence of the electrical properties on the Ta in the range of 285–400 °C. It was found that the films were highly conductive and showed a typical NTCR characteristic at annealing temperatures of 300 °C and above. Notably, at Ta ≥ 350 °C, the films exhibited an absolute temperature coefficient of resistance (TCR) exceeding 2.43% K−1 together with a moderate resistivity (ρ) of <3 kΩ cm, indicating their excellent potential for application in infrared detectors. In addition, the films showed good electrical stability with time, as their aging coefficient (ΔR/Ro) varied in a range of 5.9–6.4% after 500 h of aging in air at 150 °C. To the best of our knowledge, there have been no reports on cubic spinel Mn3O4-based thin films at temperatures below 400 °C.

Scaling of quadratic and linear magneto-optic Kerr effect spectra with L21 ordering of Co2MnSi Heusler compound

Spectral ellipsometry is a useful technique allowing fast, nondestructive, and contactless characterization of thin films and constituent materials. In this Letter, we show that both the linear magneto-optic Kerr effect (LinMOKE, proportional to the magnetization M) and the quadratic MOKE (QMOKE, proportional to M2) can be a useful extension of spectral ellipsometry and are able to sense the crystallographic ordering of Heusler compounds. This is demonstrated for the Heusler compound Co2MnSi, which has a crystallographic transition from a B2 to an L21 structure with increasing annealing temperature Ta. We investigated a set of Co2MnSi thin films deposited on MgO(001) substrates and annealed from 300 to 500 °C. The amplitude of LinMOKE and QMOKE spectra, detected in the extended visible spectral range of 0.8–5.5 eV, scales linearly with Ta, and this effect is pronounced at the resonant peaks of the QMOKE spectra below 2.0 eV. Furthermore, the spectra of the magneto-optic (MO) parameters, which fully describe the MO response of Co2MnSi up to the second order in M, are obtained depending on Ta. Finally, the spectra are compared with ab initio calculations of a purely L21-ordered Co2MnSi Heusler compound.

Molybdenum-Suboxide Thin Films as Anode Layers in Planar Lithium Microbatteries

In this paper, we investigate the effects of operational conditions on structural, electronic and electrochemical properties on molybdenum suboxides (MoO3-δ) thin films. The films are prepared using pulsed-laser deposition by varying the deposition temperature (Ts), laser fluence (Φ), the partial oxygen pressure (PO2) and annealing temperature (Ta). We find that three classes of samples are obtained with different degrees of stoichiometric deviation without post-treatment: (i) amorphous MoO3-δ (δ &lt; 0.05) (ii) nearly-stoichiometric samples (δ ≈ 0) and (iii) suboxides MoO3-δ (δ &gt; 0.05). The suboxide films 0.05 ≤ δ ≤ 0.25 deposited on Au/Ti/SiO2/flexible-Si substrates with appropriate processing conditions show high electrochemical performance as an anode layer for lithium planar microbatteries. In the realm of simple synthesis, the MoO3-δ film deposited at 450 °C under oxygen pressure of 13 Pa is a mixture of α-MoO3 and Mo8O23 phases (15:85). The electrochemical test of the 0.15MoO3-0.85Mo8O23 film shows a specific capacity of 484 µAh cm−2 µm−1 after 100 cycles of charge-discharge at a constant current of 0.5 A cm−2 in the potential range 3.0-0.05 V.

Simultaneous detection of pork and wild boar meat in chicken sausages using the combination of a single primer and real-time polymerase chain reaction (qPCR)

The identification of meat species in food products and pharmaceuticals is vital to minimize food adulteration practices. Due to its specificity, polymerase chain reaction (PCR)-based methods are the most commonly reported methods for detection of food adulterants. This study was aimed to evaluate the use of real-time PCR with a species-specific primer to identify two non-halal types of meat, namely pork and wild boar meat (WBM), in chicken sausages. The primer was designed using online software PrimerQuest from NCBI (National Center for Biotechnology Information) to target the mitochondrial ND1 gene of Sus scrofa domestica . The annealing temperature (Ta) of the primer used during real-time PCR analysis was optimized to achieve the highest response fluorescence unit at the lowest cycles. Real-time PCR using the primers of NK-ND1-Ssc1 (Forward: 5’ AAAGGACCCAACGTTGTAGG 3’ and Reverse: 5’ TAGTGCTAGGGATAAGGCTAGG 3’) was validated with several parameters, namely specificity, the limit of detection for sensitivity, linearity, efficiency, and repeatability. The optimum annealing temperature of NK-ND1-Ssc1 was 58.1 o C. The sensitivity evaluation revealed that the limits of detection (LoD) of pork and WBM in reference sausage samples containing 100% pork and WBM were 500 pg and 50 pg, respectively, which correspond to 0.3% meat in sausage products. The efficiency values of real-time PCR amplification were 93.1% and 94.8% for pork and WBM with coefficient variations of 0.2884% and 0.4998%, respectively. The validated method was subsequently applied to analyze the commercial samples, and among the twelve (12) samples evaluated, there was one sample positive of containing non-halal meat (pork or WBM). Real-time PCR using species-specific primers, e.g., NK-ND1-Ssc1, is specific and sensitive; therefore, this method can be used as an alternative technique for authentication of halal meat.

The particulars properties of annealing temperature and spacer thickness on cross-relaxation and decay dynamics in Aluminum Oxide upon Thulium(III) oxide nanolaminate silicon-based electroluminescent and optoelectronics devices

The effects of thermal treatment and Aluminum Oxide [Al2O3] spacer thickness on the de-excitation traces and cross-relaxation among Thulium(III) ions [Tm3+], which prominently impact on the electroluminescence (EL) from different characteristic transitions inside the devices based on Aluminum Oxide upon Thulium(III) Oxide [[Al2O3]/[Tm2O3]] nanolaminate thin solid films, were investigated. The suitable annealing temperatures (Ta) for activating [Tm3+] ions was between 600.0 °C and 800.0 °C, while higher annealing temperatures lead to the reduced EL intensity and life time, resulting from the formation of Thulium Oxide nonstoichiometric compound [TmOx] clusters or agglomerations. All phenomena confirm the critical [Al2O3] spacer thickness of around 3.0 nm, concerning both non-radioactive interaction among excited [Tm3+] ions derived from Förster mode and the acceleration distance for the injected electrons in [Al2O3] matrix.

Synthesis and Characterization of a-Si&lt;sub&gt;x&lt;/sub&gt;C&lt;sub&gt;y&lt;/sub&gt; Thin Films Prepared by RF Magnetron Co-Sputtering Technique

Si-C based alloys have attracted much attention due to their potential applications in electronic and optical devices. In this paper, a-SixCy thin films with different Silicon (Si) content are obtained by sputtering of SiC; co-sputtering of SiC and Si targets at different deposition temperatures (Td) such as 200oC, 350oC and 500oC. It is annealed at various annealing temperature (Ta) using conventional thermal annealing (CTA) and Rapid Thermal Annealing (RTA) techniques. The effect of excess Si incorporation and the unintentional oxidation during various stages of sample preparation are discussed. Their structural and optical properties are investigated using spectroscopic ellipsometry, X-Ray Diffraction spectroscopy (XRD), and Fourier Transform Infrared spectroscopy (FTIR). The refractive index value (n1.95eV) varies between 1.6 to 3.6, suggesting the transition from porous silicon carbide to Si-rich silicon carbide or silicon oxycarbide upon increasing Td and Ta, which is also supported by the FTIR spectra. The emergence of absorption peak between ~950 cm−1 and 1100 cm−1 with the increase of Ta and excess silicon is attributed to Si-O a stretching vibration bond which is an indication of Si richness and unintentional oxidation during annealing. Detailed analysis on the process parameters and the evolution of phase transformations are discussed.