Affinity For Androgen Receptor Research Articles

Development of radioiodinated nonsteroidal androgen receptor ligands for spect imaging of prostate cancer

The appropriate treatment strategy for prostate cancer is critically dependent on its accurate staging (1). Current screening techniques (CT, MRI, Ultrasound) fail to reliably distinguish clinically-localized disease from metastatic disease. A reliable noninvasive method for detection of prostate cancer metastases would thus be of immense clinical benefit for a) disease staging b) implementing the appropriate treatment strategy c) monitoring the effects of therapy. To address this need, many research groups have focused on the development of radiolabeled androgen receptor (AR) ligands for prostate cancer imaging, based on the observation that most prostate tumors and metastases express AR (2,3). The majority of these studies to date have focused on steroid-based ligands (2,4,5). The antiandrogens RU 59063 and RU 58841 (Table l), are prototypes of a new series of nonsteroidal androgen receptor ligands that display high AR affinity and selectivity (6,7). The ease of synthesis and structural modification of these compounds as compared to steroid-based AR ligands, prompted us to select them as leads for development of a SPECT AR radioligand. We have previously shown that substitution of the trifluoromethyl group of RU 59063 with iodine leads to an improvement in AR binding affinity (8). Accordingly, a series of iodinated analogs of RU 59063 and RU 58841 was synthesized for investigation as in vivo AR radioligands (Table 1). Compounds 1-4 were synthesized from 4-cyano-3-iodoaniline using previously reported methods (8). Radioiodination of compounds 1-4 with iodine-125 were achieved in 50-65% radiochemical yield by an ammonium sulfate catalyzed solid phase exchange procedure (Scheme 1). Radiolabeled products were purified either by elution through an anion exchange resin or

Chiral derivatives of 2-cyclohexylideneperhydro-4,7-methanoindenes, a novel class of nonsteroidal androgen receptor ligand: synthesis, X-ray analysis, and biological activity.

A series of 2-cyclohexylideneperhydro-4,7-methanoindene derivatives was synthesized as novel androgen receptor ligands. Asymmetric hydroboration of key intermediate 2 afforded single enantiomer alcohol derivatives (3aR)-3 and (3aS)-3 which could be further transformed to give 12 variously substituted keto alcohol target compounds. X-ray crystallography of the 4-bromobenzenesulfonyl ester (3aS)-13 was used to establish their absolute configuration. The binding of these compounds to the rat ventral prostate androgen receptor showed moderate affinity with IC(50) values of 1.2 microM and above but with substantial enantiomeric dependencies which varied in accordance to Pfieffer's rule. Surprisingly, the (3aS)-5alpha-alcohols displayed similar affinity to the (3aR)-5beta-alcohols, and molecular modeling suggested an alternative mode of binding for the (3aS) series. The three compounds with the best androgen receptor affinity were assayed in vivo for antiandrogenic and androgenic effects on sex accessory organ growth in castrated immature rats and were found to be ineffective.

1alpha,25-dihydroxyvitamin D3 inhibits prostate cancer cell growth by androgen-dependent and androgen-independent mechanisms.

We recently reported that 1alpha,25-dihydroxyvitamin D3 [1,25-(OH)2D3] inhibits the growth of the LNCaP human prostate cancer cell line by an androgen-dependent mechanism. In the present study we examined the actions and interactions of 1,25-(OH)2D3 and the androgen 5alpha-dihydrotestosterone (DHT) on two new human prostate cancer cell lines (MDA), MDA PCa 2a and MDA PCa 2b. Scatchard analyses revealed that both cell lines express high affinity vitamin D receptors (VDRs) with a binding affinity (Kd) for [3H]1,25-(OH)2D3 of 0.1 nM. However, the MDA cell lines contain low affinity androgen receptors (ARs) with a Kd of 25 nM for [3H]DHT binding. This is 50-fold lower than the AR in LNCaP cells (Kd = 0.5 nM). Their response to DHT is greatly reduced; 2a cells do not respond to 100 nM DHT, and 2b cells show a modest response at that high concentration. 1,25-(OH)2D3 causes significant growth inhibition in both MDA cell lines, greater (for 2b cells) or lesser (for 2a cells) than that in the LNCaP cell line. Moreover, 1,25-(OH)2D3 significantly up-regulates AR messenger RNA in all three cell lines, as shown by Northern blot analysis. The growth inhibitory effect of 1,25-(OH)2D3 on LNCaP cells is blocked by the pure antiandrogen, Casodex, as we previously reported. However, Casodex (at 1 microM) did not block the antiproliferative activity of 1,25-(OH)2D3 in MDA cells. In conclusion, the growth inhibitory action of 1,25-(OH)2D3 in the MDA cell lines appears to be androgen independent, whereas the actions of 1,25-(OH)2D3 in LNCaP cells are androgen dependent. Most importantly, the MDA cell lines, derived from a bone metastasis of human prostate carcinoma, remain sensitive to 1,25-(OH)2D3, a finding relevant to the therapeutic application of vitamin D and its low calcemic analogs in the treatment of advanced prostate cancer.

Androgen receptor antagonists (antiandrogens): structure-activity relationships.

Prostate cancer, acne, seborrhea, hirsutism, and androgenic alopecia are well recognized to depend upon an excess or increased sensitivity to androgens or to be at least sensitive to androgens. It thus seems logical to use antiandrogens as therapeutic agents to prevent androgens from binding to the androgen receptor. The two predominant naturally occurring androgens are testosterone (T) and dihydrotestosterone (DHT). DHT is the more potent androgen in vivo and in vitro. All androgen-responsive genes are activated by androgen receptor (AR) bound to either T or DHT and it is believed that AR is more transcriptionally active when bound to DHT than T. The two classes of antiandrogens, presently available, are the steroidal derivatives, all of which possess mixed agonistic and antagonistic activities, and the pure non-steroidal antiandrogens of the class of flutamide and its derivatives. The intrinsic androgenic, estrogenic and glucocorticoid activities of steroidal derivatives have limited their use in the treatment of prostate cancer. The non-steroidal flutamide and its derivatives display pure antiandrogenic activity, without exerting agonistic or any other hormonal activity. Flutamide (89) and its derivatives, Casodex (108) and Anandron (114), are highly effective in the treatment of prostate cancer. The combination of flutamide and Anandron with castration has shown prolongation of life in prostate cancer. Furthermore, combined androgen blockade in association with radical prostatectomy or radiotherapy are very effective in the treatment of localized prostate cancer. Such an approach certainly raises the hope of a further improvement in prostate cancer therapy. However, all antiandrogens, developed so-far display moderate affinity for the androgen receptor, and thus moderate efficacy in vitro and in vivo. There is thus a need for next-generation antiandrogens, which could display an equal or even higher affinity for AR compared to the natural androgens, and at the same time maintain its pure antiandrogenic activity, and thus providing improved androgen blockade using possibly antiandrogens alone.

Administration of potentially antiandrogenic pesticides (procymidone, linuron, iprodione, chlozolinate, p,p'-DDE, and ketoconazole) and toxic substances (dibutyl- and diethylhexyl phthalate, PCB 169, and ethane dimethane sulphonate) during sexual differentiation produces diverse profiles of reproductive malformations in the male rat.

Antiandrogenic chemicals alter sexual differentiation by a variety of mechanisms, and as a consequence, they induce different profiles of effects. For example, in utero treatment with the androgen receptor (AR) antagonist, flutamide, produces ventral prostate agenesis and testicular nondescent, while in contrast, finasteride, an inhibitor of 5 alpha-dihydrotestosterone (DHT) synthesis, rarely, if ever, induces such malformations. In this regard, it was recently proposed that dibutyl phthalate (DBP) alters reproductive development by a different mechanism of action than flutamide or vinclozolin (V), which are AR antagonists, because the male offsprings display an unusually high incidence of testicular and epididymal alterations--effects rarely seen after in utero flutamide or V treatment. In this study, we present original data describing the reproductive effects of 10 known or suspected anti-androgens, including a Leydig cell toxicant ethane dimethane sulphonate (EDS, 50 mg kg-1 day-1), linuron (L, 100 mg kg-1 day-1), p,p'-DDE (100 mg kg-1 day-1), ketoconazole (12-50 mg kg-1 day-1), procymidone (P, 100 mg kg-1 day-1), chlozolinate (100 mg kg-1 day-1), iprodione (100 mg kg-1 day-1), DBP (500 mg kg-1 day-1), diethylhexyl phthalate (DEHP, 750 mg kg-1 day-1), and polychlorinated biphenyl (PCB) congener no. 169 (single dose of 1.8 mg kg-1). Our analysis indicates that the chemicals discussed here can be clustered into three or four separate groups, based on the resulting profiles of reproductive effects. Vinclozolin, P, and DDE, known AR ligands, produce similar profiles of toxicity. However, p,p'-DDE is less potent in this regard. DBP and DEHP produce a profile distinct from the above AR ligands. Male offsprings display a higher incidence of epididymal and testicular lesions than generally seen with flutamide, P, or V even at high dosage levels. Linuron treatment induced a level of external effects consistent with its low affinity for AR [reduced anogenital distance (AGD), retained nipples, and a low incidence of hypospadias]. However, L treatment also induced an unanticipated degree of malformed epididymides and testis atrophy. In fact, the profile of effects induced by L was similar to that seen with DBP. These results suggest that L may display several mechanisms of endocrine toxicity, one of which involves AR binding. Chlozolinate and iprodione did not produce any signs of maternal or fetal endocrine toxicity at 100 mg kg-1 day-1. EDS produced severe maternal toxicity and a 45% reduction in size at birth, which resulted in the death of all neonates by 5 days of age. However, EDS only reduced AGD in male pups by 15%. Ketoconazole did not demasculinize or feminize males but rather displayed anti-hormonal activities, apparently by inhibiting ovarian hormone synthesis, which resulted in delayed delivery and whole litter loss. In summary, the above in vivo data suggest that the chemicals we studied alter male sexual differentiation via different mechanisms. The anti-androgens V, P, and p,p'-DDE produce flutamide-like profiles that are distinct from those seen with DBP, DEHP, and L. The effects of PCB 169 bear little resemblance to those of any known anti-androgen. Only in depth in vitro studies will reveal the degree to which one can rely upon in vivo studies, like those presented here, to predict the cellular and molecular mechanisms of developmental toxicity.

Season and physiological parameters modulate salmonid leucocyte androgen receptor affinity and abundance

Immune responses of ectothermic animals are known to vary seasonally. A loss of sensitivity to cortisol and testosterone (both normally immunosuppressive) in leucocytes from juvenile salmonids during winter has been previously documented. In an attempt to understand how the salmonid immune system changes in the winter, the present study investigated changes in androgen receptor affinity and abundance in salmonid leucocytes brought on by season, and physiological states such as stress and sexual maturation. In sexually immature fish, leucocyte androgen receptor affinity dropped more than four-fold during winter. TheKdrose from less than 1nMin July to 4nMin January. The number of androgen receptors present also rose dramatically in January (from 50fmol mg−1protein to 400fmol mg−1protein). An 18h confinement stress caused a significant drop in leucocyte androgen receptor binding affinity in sexually immature fish (Kdrose to 6nMfrom 2·7nM) but had no effect on the number of receptors present. Sexual maturation of rainbow trout led to an increased number of leucocyte androgen receptors, similar to the number seen in immature fish sampled during the spawning season (300fmol mg−1protein), and leucocyte androgen receptor affinity decreased significantly after ovulation (Kd14nM, up from 4nMbefore ovulation).

Pharmacological profile of RU 58642, a potent systemic antiandrogen for the treatment of androgen-dependent disorders

The pharmacological profile of RU 58642, a new non-steroidal antiandrogen was investigated both in vitro and in vivo. In vitro, the compound displays a strong and specific affinity for androgen receptor. In vivo, its antiandrogenic activity was evaluated in castrated rat supplemented with testosterone propionate and in intact animals on prostate, seminal vesicles weight and serum levels of testosterone by oral and subcutaneous route. In castrated rats RU 58642 induced a significant decrease in prostate weight at a dose as low as 0.3 mg/kg whatever the route of administration. In intact rats its activity was compared to that of other non-steroidal antiandrogens such as flutamide, nilutamide and bicalutamide. RU 58642 proved to be significantly more potent than the reference compounds in reducing prostate weight: 3–30 times orally and 3–100 times subcutaneously, and thus the most potent antiandrogen to date to our knowledge. These results suggest that this compound may be very useful in the treatment of systemic androgen-dependent diseases.

Identification of a functional androgen-response element in the exon 1-coding sequence of the cystatin-related protein gene crp2.

Two hormone-responsive segments, one in the region of the promoter and one in intron 1, are identified in two homologous androgen-regulated and differentially expressed rat genes encoding the cystatin-related proteins (CRPs). Footprint analysis with the androgen receptor (AR) DNA-binding domain on the promoter-containing fragments reveals an AR-binding site downstream of the transcription start point in the crp2 gene (ARBSd/crp2, +40/+63). It displays an androgen response element-like sequence motif 5'-AGAAGAaaaTGTACA-3' and overlaps with the ATG translation start codon. A double-stranded oligonucleotide containing this sequence forms a DNA-protein complex with the full-length AR synthesized by vaccinia, as seen in band shift assays. Additional AR-binding sites, ARBSu/crp1 and ARBSu/crp2, occur 5' upstream of the transcription start point and are located at an identical position (-142/ -120) in crp1 and crp2. The AR affinity for these two slightly different sequence motifs is relatively weak. The biological function of all three AR-binding sites as transcription control elements has been studied. The ARBSd/crp2 element clearly shows androgen-response element characteristics. The contribution of the common upstream element to the androgen-dependent control of reporter gene transcription is less clear. The transcription of a reporter gene construct containing the crp2 footprint fragment crp2F (-273/+88) is hormonally regulated as determined by transfection into the human breast cancer cell line T-47D. Androgens, but also glucocorticoids, efficiently stimulate steroid-dependent transcription of the chloramphenicol acetyltransferase gene. Mutation of the 5'-TGTACA-3' sequence in ARBSd/crp2 destroys the AR binding and abolishes the androgen-dependent synthesis of chloramphenicol acetyltransferase. A large fragment derived from intron 1 of the crp1 and crp2 gene can also provide the androgen-dependent transcription of chimeric constructs in T-47D cells. However, the induction measured is less than the one observed with crp2F (-273/+88), and this activity seems to reside in several subfragments that each display a low but consistent androgen responsiveness.

Reduced expression and normal nucleotide sequence of androgen receptor gene coding and promoter regions in a family with partial androgen insensitivity syndrome.

Androgen insensitivity syndrome (AIS) is an X-linked disorder of XY males characterized by varying degrees of impaired masculinization. In many AIS cases, mutations have been identified in the coding sequence of the human androgen receptor (AR) gene which impair receptor function. Cases have also been reported in which reduced AR mRNA expression may contribute to AIS in association with AR gene mutations. The purpose of this study was to define the molecular basis of AIS in members of a family with clinical and laboratory features of partial androgen insensitivity (PAIS). Genital skin fibroblast (GSF) cultures were established from foreskin tissue for androgen receptor binding analysis. Genomic DNA was obtained from blood leucocytes for AR gene nucleotide sequence analysis. AR mRNA levels were determined in total RNA extracted from GSF cultures. Three related subjects with perineo-scrotal hypospadias, bifid scrotum and microphallus were studied. The family pedigree of these subjects suggested an X-linked pattern of inheritance. Hormone assay results were consistent with AIS. AR binding capacity and affinity were determined in three subjects and compared with unaffected male controls. The coding sequence and 1.4 kb of promoter region of the AR gene were amplified in overlapping fragments by polymerase chain reaction from genomic DNA and sequenced. GSF AR mRNA was measured by a competitive PCR technique. In the PAIS subjects, AR affinity in cultured GSF was normal (Kd = 0.24, 0.30, 0.48 vs 0.27 +/- 0.07 (SD) nmol/l) but binding capacity was reduced (Bmax = 0.31, 0.36, 0.27 vs 1.26 +/- 0.37 (SD) fmol/microgram DNA). Sequence analysis of the CAG repeat polymorphism within exon 1 of the AR gene showed that both mothers were heterozygous at this locus, and that the three subjects had inherited the same allele. GSF AR mRNA levels were reduced in all three patients compared with controls (0.25, 0.74 and 0.74 vs 3.8 +/- 0.9 (SEM), range 1.8-7.3 amol/microgram total RNA). The nucleotide sequences of the entire AR coding region and of a 1.4 kb segment containing the promoter region were normal. Members of this family with clinical and biochemical evidence of X-linked partial androgen insensitivity syndrome demonstrated normal androgen receptor binding affinity and androgen receptor gene nucleotide sequence but reduced androgen receptor binding capacity and reduced androgen receptor mRNA. These results suggest that partial androgen insensitivity syndrome in this family may be caused by reduced expression of a normal androgen receptor gene.

Enhancement of the Affinity of Androgen Receptor in the Adrenal Medulla of Spontaneously Hypertensive Rats

We investigated the alteration of tyrosine hydroxylase (TH) mRNA expression and androgen receptor in the adrenal medulla of spontaneously hypertensive rats (SHR). The TH mRNA expression in the adrenal medulla of SHR was higher than that of Wistar Kyoto rats (WKY). The testosterone increased the TH mRNA expression of SHR, but not WKY. The affinity of androgen receptor in the adrenal medulla of SHR was higher than that of WKY; however, the number of androgen receptor was not different. These results suggested that the increased binding affinity of the androgen receptor of SHR may be related to TH gene transcription in the adrenal medulla.

Two Androgen Response Regions Cooperate in Steroid Hormone Regulated Activity of the Prostate-specific Antigen Promoter

Transcription of the prostate-specific antigen (PSA) gene is androgen regulated. The PSA promoter contains at position -170 the sequence AGAACAgcaAGTGCT, which is closely related to the ARE (androgen response element) consensus sequence GGTACAnnnTGTTCT. This sequence is a high affinity androgen receptor (AR) binding site and acts as a functional ARE in transfected LNCaP cells. A 35-base pair segment starting at -400 (ARR: androgen response region; GTGGTGCAGGGATCAGGGAGTCTCACAATCTCCTG) cooperates with the ARE in androgen induction of the PSA promoter. A construct with three ARR copies linked to a minimal PSA promoter showed a strong (104-fold) androgen induced activity. The ARR was also able to confer androgen responsiveness to a minimal thymidine kinase promoter. Both AR binding and transcriptional activity resided in a 20-base pair ARR subfragment: CAGGGATCAGGGAGTCTCAC (2S). Mutational analysis indicated that the sequence GGATCAgggAGTCTC in the 2S fragment is a functionally active, low affinity AR binding site. Like AR, the glucocorticoid receptor was able to stimulate PSA promoter activity. Both the ARE and ARR are involved in dexamethasone regulation of the PSA promoter. Both the AR and glucocorticoid receptor were 20-100-fold more active on ARR-PSA and ARR-thymidine kinase promoter constructs in LNCaP cells than in other cell types (COS, HeLa, Hep3B, and T47D cells), indicating (prostate) cell specificity.

Different patterns of metabolism determine the relative anabolic activity of 19-norandrogens.

Testosterone, the principal androgen secreted by Leydig cells, exerts a wide range of actions including growth of the male reproductive tract (androgenic effects) and growth of non-reproductive tissues such as muscle, kidney, liver, and salivary gland (anabolic effects). As androgenic steroids were discovered some were found to have relatively more anabolic than androgenic activity. The results reviewed in this report suggest that these differences result, in part, from the differential metabolism of the steroids in individual tissues and the varied activities of the individual metabolites. In the accessory sex organs (e.g. the prostate) testosterone is 5 alpha-reduced to dihydrotestosterone (DHT) which, due to its higher affinity for androgen receptors (AR), amplifies the action of testosterone. In contrast, when 19-nortestosterone (NT) is 5 alpha-reduced, its affinity for AR decreases, resulting in a decrease in its androgenic potency. However, their anabolic potency remains unchanged since significant 5 alpha-reduction of the steroids does not occur in the muscle. 7 alpha-methyl-19-nortestosterone (MENT) does not get 5 alpha-reduced due to steric hindrance from the 7 alpha-methyl group. Therefore, the androgenic potency of MENT is not amplified as happens with testosterone. These metabolic differences are responsible for the increased anabolic activity of NT and MENT compared to testosterone. Part of the biological effects of testosterone are mediated by its aromatization to estrogens. The fact that MENT is also aromatized to 7 alpha-methyl estradiol, a potent estrogen, in vitro by human placental and rat ovarian aromatase suggests that some of the anabolic actions of MENT may be mediated by this estrogen.

Stimulation of androgen-regulated transactivation by modulators of protein phosphorylation.

The effect of modulators of protein phosphorylation on the transcriptional activity of the androgen receptor (AR) was studied under transient expression conditions. Activators of protein kinase-A [8-bromo-cAMP (8-Br-cAMP)] and protein kinase-C (phorbol 12-myristate 13-acetate) or an inhibitor of protein phosphatase-1 and -2A (okadaic acid) influenced minimally pMMTV-chloramphenicol acetyl-transferase (CAT) activity in CV-1 cells cotransfected with an AR expression plasmid in the absence of androgen. In the presence of testosterone, however, all compounds enhanced AR-mediated transactivation by 2- to 4-fold. A nonsteroidal antiandrogen, Casodex, behaved as a pure antagonist; it blunted the action of testosterone and was not rendered agonistic by activators of protein kinase-A. A reporter plasmid containing two androgen response elements (AREs) in front of the thymidine kinase promoter (pARE2tk-CAT) was also used to examine promoter specificity. It was activated by 8-Br-cAMP, forskolin, or okadaic acid even without AR or androgen. However, when forskolin or okadaic acid was used together with androgen and AR, the resulting AR-dependent transactivation of pARE2tk-CAT was more than additive. Intact DNA- and ligand-binding domains, but not the N-terminal amino acid residues 40-147, of the receptor were mandatory for the synergism between protein kinase-A activators and androgen. Immunoreactive AR content in transfected COS-1 cells was not influenced by exposure to 8-Br-cAMP. Similar results were obtained by ligand binding assays. Quantitative or qualitative differences were not observed in DNA-binding characteristics between receptors extracted from cells treated with testosterone with or without protein kinase-A activator. Collectively, the synergistic stimulation of AR-dependent transactivation by androgen and protein kinase activators is not due to changes in cellular AR content or affinity of the receptor for the cognate DNA element; rather, this phenomenon seems to result from altered interaction of ligand-activated AR with other proteins in the transcription machinery.

Endurance and resistance exercise induce muscle fiber type specific responses in androgen binding capacity

This study examined the effects of different exercise training programs on androgen receptor content and receptor affinity to dihydrotestosterone in fast glycolytic (FG) and slow oxidative (SO) skeletal muscle fibers in rats. Twenty-four male Sprague-Dawley rats were equally divided into three groups: control, endurance exercise trained and resistance exercise trained. After the exercise programs were completed, the extensor digitorum longus (EDL), predominantly a FG muscle, and the soleus, predominantly a SO muscle, were isolated, weighed and both androgen receptor content and affinity to dihydrotestosterone were determined. Resistance training evoked a significant ( P < 0.05) hypertrophic response in the soleus but not the EDL. Endurance training was not associated with any significant hypertrophy in either the soleus or the EDL. Neither the endurance nor the resistance training program resulted in changes in androgen receptor affinity to dihydrotestosterone. However, alterations in androgen receptor content were noted. The endurance training program resulted in a significant increase in androgen receptor content in the soleus, but no significant difference in the EDL. The resistance training program elicited a significant decrease in androgen receptor content in the soleus, and a significant increase in the EDL. These results indicate that different exercise stimuli induce changes in androgen receptor content that are specific to skeletal muscle fiber type.

Sex hormone receptor binding, progestin selectivity, and the new oral contraceptives

The desired biologic effect of progestins used in OCs is progestational activity. Undesired pharmacologic properties such as androgenic activity are not necessary for contraception and increase the potential for adverse effects. A selective progestin has progestational effects at relatively low concentrations or doses and androgenic effects at only relatively high concentrations or doses. The degree to which progestational activity is maximized and androgenic activity is minimized is a measure of a progestin's selectivity. The ratio of its affinity for progesterone receptors to its affinity for androgen receptors is the selectivity index. To minimize the androgenic side effects associated with the older progestins, the doses used in OCs have been reduced over the years. These dose reductions have decreased the potential for undesired androgenic effects but also have negatively affected cycle control. Three new progestins, norgestimate, desogestrel, and gestodene, have relatively greater affinity for progesterone receptors than for androgen receptors when compared with the older agents, permitting a reduction in androgenic side effects without the need for further dose reduction. Preclinical receptor-binding studies and animal pharmacologic studies have documented the higher selectivity indexes of these new progestins. Their higher ratios of progestational to androgenic activity provide the basis for the reduction in androgenic adverse effects observed with their clinical use.

Clinical and metabolic features of desogestrel: A new oral contraceptive preparation

Desogestrel is a highly selective gonane progestin. A monophasic formulation containing 150 micrograms of desogestrel and 30 micrograms of ethinyl estradiol has recently been approved as an oral contraceptive (OC) in the United States. Although desogestrel-containing formulations are new to the United States, they have been the most widely prescribed OCs in Europe for almost 10 years. An extensive literature demonstrates that desogestrel-containing preparations are safe, effective, and well tolerated by most women. In light of desogestrel's high selectivity, low affinity for androgen receptors, and lack of interference with the increase in sex hormone-binding globulin, desogestrel-containing OCs may be particularly appropriate for women with androgen-induced skin disorders because of their high selectivity. Several European studies have found significant improvement or almost complete resolution of previously existing acne. Desogestrel provides excellent cycle control, no major impact on weight, minimal or no adverse effects on blood pressure, statistically significant increases in high-density lipoprotein cholesterol with low-density lipoprotein cholesterol usually unchanged or reduced, and little effect on glucose tolerance or insulin resistance.

Clinical and metabolic features of desogestrel: A new oral contraceptive preparation

Desogestrel is a highly selective gonane progestin. A monophasic formulation containing 150 of μg desogestrel and 30 μg of ethinyl estradiol has recently been approved as an oral contraceptive OC in the United States. Although desogestrel-containing formulations are new to the United States, they have been the most widely prescribed OCs in Europe for almost 10 years. An extensive literature demonstrates that desogestrel-containing preparations are safe effective and well tolerated by most women. In light of desogestrel's high selectivity, low affinity for androgen receptors, and lack of interference with the increase in sex hormone-binding globulin desogestrel-containing OCs may be particularly appropriate for women with androgen-induced skin disorders because of their high selectivity. Several European studies havefound significant improvement or almost complete resolution of previously existing acne. Deso estrel provides excellent cycle control no major impact on weight, minimal or no adverse effects on blood pressure, statistically significant increases in high-density lipoprotein cholesterol with low-density lipoprotein cholesterol usually unchanged or reduced and little effect on glucose tolerance or insulin resistance. Desogestrel is a highly selective gonane progestin. A monophasic formulation containing 150 of μg desogestrel and 30 μg of ethinyl estradiol has recently been approved as an oral contraceptive OC in the United States. Although desogestrel-containing formulations are new to the United States, they have been the most widely prescribed OCs in Europe for almost 10 years. An extensive literature demonstrates that desogestrel-containing preparations are safe effective and well tolerated by most women. In light of desogestrel's high selectivity, low affinity for androgen receptors, and lack of interference with the increase in sex hormone-binding globulin desogestrel-containing OCs may be particularly appropriate for women with androgen-induced skin disorders because of their high selectivity. Several European studies havefound significant improvement or almost complete resolution of previously existing acne. Deso estrel provides excellent cycle control no major impact on weight, minimal or no adverse effects on blood pressure, statistically significant increases in high-density lipoprotein cholesterol with low-density lipoprotein cholesterol usually unchanged or reduced and little effect on glucose tolerance or insulin resistance.

Efficacy and safety of a monophasic and a triphasic oral contraceptive containing norgestimate

Both monophasic and triphasic formulations of ethinyl estradiol plus nor9estimate, a pro9estin with marked pro9esterone-receptor affinity and minimal androgen-receptor affinity, have been evaluated in numerous clinical studies designed to determine if nor9estimate's receptor-binding profile provides enhanced safety without a reduction in efficacy. To date clinical trials have shown that both formulations of ethinyl estradiol/nor9estimate offer contraceptive efficacy equivalent to that of other oral contraceptives. Monophasic ethinyl estradiol/nor9estimate was associated with an incidence of breakthrough bleeding and spotting similar to that of monophasic ethinyl estradiol/norgestrel and an incidence of amenorrhea less than that of ethinyl estradiol/norgestrel. Cycle control with triphasic ethinyl estradiol/nor9estimate was similar to that with monophasic ethinyl estradiol/nor9estimate. Weight gain and elevated blood pressure were insignificant in clinical trials with both fixed-dose and phasic ethinyl estradiol/nor9estimate formulations. Perhaps of greatest importance, both monophasic and triphasic ethinyl estradiol/nor9estimate formulations consistently showed favorable impact on metabolic parameters including elevations in serum high-density lipoprotein cholesterol, and reductions in the low-density lipoprotein/high-density lipoprotein ratio, the parameter considered most sensitive for atherosclerotic risk. Both monophasic and triphasic ethinyl estradiol/nor9estimate formulations were associated with minimal and clinically neutral effects on carbohydrate metabolism.

Efficacy and safety of a monophasic and a triphasic oral contraceptive containing norgestimate

Both monophasic and triphasic formulations of ethinyl estradiol plus norgestimate, a progestin with marked progesterone-receptor affinity and minimal androgen-receptor affinity, have been evaluated in numerous clinical studies designed to determine if norgestimate's receptor-binding profile provides enhanced safety without a reduction in efficacy. To date clinical trials have shown that both formulations of ethinyl estradiol/norgestimate offer contraceptive efficacy equivalent to that of other oral contraceptives. Monophasic ethinyl estradiol/norgestimate was associated with an incidence of breakthrough bleeding and spotting similar to that of monophasic ethinyl estradiol/norgestrel and an incidence of amenorrhea less than that of ethinyl estradiol/norgestrel. Cycle control with triphasic ethinyl estradiol/norgestimate was similar to that with monophasic ethinyl estradiol/norgestimate. Weight gain and elevated blood pressure were insignificant in clinical trials with both fixed-dose and phasic ethinyl estradiol/norgestimate formulations. Perhaps of greatest importance, both monophasic and triphasic ethinyl estradiol/norgestimate formulations consistently showed favorable impact on metabolic parameters, including elevations in serum high-density lipoprotein cholesterol, and reductions in the low-density lipoprotein/high-density lipoprotein ratio, the parameter considered most sensitive for atherosclerotic risk. Both monophasic and triphasic ethinyl estradiol/norgestimate formulations were associated with minimal and clinically neutral effects on carbohydrate metabolism.

Nilutamide. A review of its pharmacodynamic and pharmacokinetic properties, and therapeutic efficacy in prostate cancer.

Nilutamide is a nonsteroidal antiandrogen with affinity for androgen receptors but not for progestogen, estrogen, or glucocorticoid receptors. Consequently, nilutamide blocks the action of androgens of adrenal and testicular origin which stimulate the growth of normal and cancerous prostatic tissue. Nilutamide has a long half-life which permits once-daily administration. Nilutamide is usually given in combination with surgical or chemical castration using gonadotrophin-releasing hormone (GnRH) [luteinising hormone-releasing hormone (LHRH)] agonists. In castrated patients the addition of nilutamide improves objective response rates, bone pain, urinary symptoms, tumour markers and time to disease progression. The tolerance of nilutamide is generally acceptable. Adverse effects are usually mild and reversible and consistent with androgen depletion. Unexpected but reversible adverse effects of nilutamide include delayed adaption to dark after exposure to bright light, transient increases in transaminases, and more severe but rare interstitial pneumonitis. Thus, nilutamide is a welcome treatment option that may be particularly useful in patients to whom the convenience of once-daily administration is seen as a worthwhile benefit.