Sperm Analysis Research Articles

Correlation of sibling couple infertility history with semen parameters of infertile men, a cohort study.

Infertility is a growing issue globally, particularly in industrialized cultures, affecting 13%-18% of couples of reproductive ages. In recent years, numerous studies have aimed to identify prognostic factors for infertility and abnormal semen analysis. To date, no study has examined the relationship between the number of infertile siblings and abnormal sperm parameters. This study aims to investigate whether the number of infertile siblings can be considered a prognostic factor for abnormal sperm parameters. Semen samples were collected from the male partners of couples experiencing infertility issues. Study participants completed a questionnaire detailing demographic information including age and family history of infertility. Each participant provided two semen samples, with a minimum 15-day interval between collections. Sperm concentration, motility, and morphology were assessed for each sample. Clinical investigators conducted physical examinations, using an orchidometer to measure testicular size. The number of infertile brothers and testis volume were prognostic factors for abnormal sperm count (OR = 1.374, p-value = 0.03; OR = 0.786, p-value < 0.001; respectively) and abnormal motility (OR = 1.514, p-value = 0.018; OR = 26.74, p-value < 0.001, respectively). There was no significant association between the percentage of abnormal morphology of sperm cells and the mentioned prognostic factors. The optimal cut-off point of the number of infertile brothers for both abnormal sperm count and abnormal sperm motility was one. It is recommended that males with at least one infertile brother, undergo sperm analysis to identify individuals at risk of infertility.

Association of novel DNAH11 variants with asthenoteratozoospermia lead to male infertility

BackgroundBi-allelic variants in DNAH11 have been identified as causative factors in Primary Ciliary Dyskinesia, leading to abnormal respiratory cilia. Nonetheless, the specific impact of these variants on human sperm flagellar and their involvement in male infertility remain largely unknown.MethodsA collaborative effort involving two Chinese reproductive centers conducted a study with 975 unrelated infertile men. Whole-exome sequencing was employed for variant screening, and Sanger sequencing confirmed the identified variants. Morphological and ultrastructural analyses of sperm were conducted using Scanning Electron Microscopy and Transmission Electron Microscopy. Western Blot Analysis and Immunofluorescence Analysis were utilized to assess protein levels and localization. ICSI was performed to evaluate its efficacy in achieving favorable pregnancy outcomes for individuals with DNAH11 variants.ResultsIn this study, we identified seven novel variants in the DNAH11 gene in four asthenoteratozoospermia subjects. These variants led the absence of DNAH11 proteins and ultrastructure defects in sperm flagella, particularly affecting the outer dynein arms (ODAs) and adjacent structures. The levels of ODA protein DNAI2 and axoneme related proteins were down regulated, instead of inner dynein arms (IDA) proteins DNAH1 and DNAH6. Two out of four individuals with DNAH11 variants achieved clinical pregnancies through ICSI. The findings confirm the association between male infertility and bi-allelic deleterious variants in DNAH11, resulting in the aberrant assembly of sperm flagella and contributing to asthenoteratozoospermia. Importantly, ICSI emerges as an effective intervention for overcoming reproductive challenges caused by DNAH11 gene variants.

Supplementation of Rooster Semen Extender with Aqueous Extract of Urtica dioicafor a Long Time Preservation by Low Temperature.

The peroxidation of spermatozoa membrane phospholipids is a primary cause of irreversible changes in the preservation of avian semen. To address this issue, the objective of the present study was to assess the potential of Urtica dioica extracts in protecting avian spermatozoa during prolonged storage. Gas chromatography-mass spectroscopic techniques were employed to evaluate the bioactive compounds present in the aqueous and ethanolic extracts obtained from the aerial parts and roots of U. dioica. Semen samples were collected from 16 roosters twice a week and were diluted in Lake's extender containing different concentrations (0, 0.5, and 1 mg/100 mL) of the various extracts. Subsequently, the extended semen samples were cooled and stored at 5°C, and the sperm quality parameters were assessed at 0, 12, 24, and 36 hours of storage. The data from this experiment clearly demonstrate that the addition of nettle root aqueous extracts to the semen diluent, especially at a concentration of 0.5 mg/100 mL, resulted in a significant improvement in various sperm quality parameters. Notably, there were enhancements in total and progressive sperm motilities, viability, fertility, membrane integrity, acrosomal membrane integrity, and a reduction in malondialdehyde production in rooster semen stored in vitro for up to 36 hours. Interestingly, the present study reveals that the beneficial effects of the aqueous extracts from different parts of the nettle were supported not only by the conventional manual method but also by the computer-assisted sperm analysis system. This dual confirmation further emphasizes the positive impact of the aqueous extract on various sperm traits during cooled semen preservation. In conclusion, this study highlights the potential of U. dioica extracts, particularly the aqueous extract from nettle roots at a concentration of 0.5 mg/100 mL, in safeguarding avian spermatozoa during prolonged storage. The significant improvements in various sperm quality parameters and the validation of results through both manual and computer-assisted analysis methods provide strong evidence for the application of U. dioica extracts in avian breeding programs and artificial insemination practices.

A modified U-Net to detect real sperms in videos of human sperm cell.

This study delves into the crucial domain of sperm segmentation, a pivotal component of male infertility diagnosis. It explores the efficacy of diverse architectural configurations coupled with various encoders, leveraging frames from the VISEM dataset for evaluation. The pursuit of automated sperm segmentation led to the examination of multiple deep learning architectures, each paired with distinct encoders. Extensive experimentation was conducted on the VISEM dataset to assess their performance. Our study evaluated various deep learning architectures with different encoders for sperm segmentation using the VISEM dataset. While each model configuration exhibited distinct strengths and weaknesses, UNet++ with ResNet34 emerged as a top-performing model, demonstrating exceptional accuracy in distinguishing sperm cells from non-sperm cells. However, challenges persist in accurately identifying closely adjacent sperm cells. These findings provide valuable insights for improving automated sperm segmentation in male infertility diagnosis. The study underscores the significance of selecting appropriate model combinations based on specific diagnostic requirements. It also highlights the challenges related to distinguishing closely adjacent sperm cells. This research advances the field of automated sperm segmentation for male infertility diagnosis, showcasing the potential of deep learning techniques. Future work should aim to enhance accuracy in scenarios involving close proximity between sperm cells, ultimately improving clinical sperm analysis.

Therapeutic potential of Sertoli cells in vivo: alleviation of acute inflammation and improvement of sperm quality

BackgroundInflammation-induced testicular damage is a significant contributing factor to the increasing incidence of infertility. Traditional treatments during the inflammatory phase often fail to achieve the desired fertility outcomes, necessitating innovative interventions such as cell therapy.MethodsWe explored the in vivo properties of intravenously administered Sertoli cells (SCs) in an acute lipopolysaccharide (LPS)-induced inflammatory mouse model. Infiltrating and resident myeloid cell phenotypes were assessed using flow cytometry. The impact of SC administration on testis morphology and germ cell quality was evaluated using computer-assisted sperm analysis (CASA) and immunohistochemistry.ResultsSCs demonstrated a distinctive migration pattern, importantly they preferentially concentrated in the testes and liver. SC application significantly reduced neutrophil infiltration as well as preserved the resident macrophage subpopulations. SCs upregulated MerTK expression in both interstitial and peritubular macrophages. Applied SC treatment exhibited protective effects on sperm including their motility and kinematic parameters, and maintained the physiological testicular morphology.ConclusionOur study provides compelling evidence of the therapeutic efficacy of SC transplantation in alleviating acute inflammation-induced testicular damage. These findings contribute to the expanding knowledge on the potential applications of cell-based therapies for addressing reproductive health challenges and offer a promising approach for targeted interventions in male infertility.

Enhancing evaluation of bull fertility through multivariate analysis of sperm

Computer-assisted sperm analysis (CASA) has become the predominant tool for assessing bull semen in artificial insemination programs. Despite such popularity CASA's ability to predict fertility has been limited, especially when emphasis is based upon single motion characteristics. Our hypothesis is that numerical sets of CASA measures provide a more effective method to differentiate the potential fertilization capacity of bulls and that bulls can be clustered based upon sets of CASA measures. Therefore, we used CASA to evaluate frozen-thawed semen samples from 307 Holstein and 152 Jersey bulls sourced from USDA-ARS's National Animal Germplasm Program gene bank. Sperm was evaluated immediately after thawing and 30 min later. We evaluated sperm kinetic and morphometric means and variances to capture the structure of CASA data in relation to various sources of variation. These data were subjected to univariate and multivariate statistical methods to investigate animal and management factors affecting sperm characteristics measured by CASA. Clustering with K-means identified 4 clusters of bulls based upon each cluster's set of CASA parameters after thawing. There was little overlap among clusters for sets of CASA measures. At the extremes, bull cluster 1 (BC1, n = 180) and BC3 (n = 101) had different sire conception rates (SCR) -0.07 vs -1.29, respectively and sets of CASA measures. Interestingly, BC2 had CASA measures that could be perceived as negative, e.g., cell size at 8.18mm2 vs 6.37mm2 for BC4 and total motility of 29.7% vs 48.7% for BC3, but SCR for BC2 was higher (-0.79) than BC3 (-1.29). Despite such discrepancies for some BC2 CASA values it appears the potentially negative effects were offset by the levels of other CASA values. Our findings suggest improved approaches for using CASA could lie in evaluating multiple CASA measures as sets within specific numerical ranges rather than as independent measures.

Reply to Editorial Comment on “Predictive Value of Teratospermia During Initial Sperm Analysis on the Success of Intrauterine Insemination Cycles”

Reply to Editorial Comment on “Predictive Value of Teratospermia During Initial Sperm Analysis on the Success of Intrauterine Insemination Cycles”

Homozygous ACTL9 mutations cause irregular mitochondrial sheath arrangement and abnormal flagellum assembly in spermatozoa and male infertility.

To identify novel variants in ACTL9 and new phenotypes responsible for male infertility. Genomic DNA was extracted from peripheral blood samples for whole-exome sequencing (WES). Computer-assisted sperm analysis (CASA) was used to test the motility of spermatozoa. The ultrastructure of flagella and the mitochondrial sheath were assessed by scanning electron microscopy (SEM) and transmission electron microscopy (TEM). Immunostaining was used to validate the localization and expression of ACTL9 and ACTL7A. An Actl9-mutated mouse model was used to validate the phenotypes by CASA and TEM. We identified novel homozygous variants in ACTL9 in two independent Chinese families. Spermatozoa with ACTL9 mutations showed decreased CASA parameters and a higher proportion of spermatozoa with abnormal morphology, exhibiting coiled flagella and a thickened midpiece. The spermatozoa were characterized by chaotic or irregular '9+2' structures and irregular mitochondrial sheath arrangements in the flagellum. Actl9 knock-in mice also showed abnormal CASA parameters and irregular '9+2' structures in flagella. Our study expands the mutation spectrum and phenotypic spectrum of ACTL9.

Assessment of Human Sperm Kinematic Parameters Using Computer-Assisted Semen Analysis

Infertility affects approximately 15% of couples trying to conceive, as reported by the World Health Organization. It is diagnosed when conception does not occur despite unprotected intercourse over the course of at least one year. The spermiogram test is a fundamental tool for identifying whether infertility originates from the male or female partner. Traditionally, sperm analysis is performed manually in reproductive clinics and laboratories, which may lead to variability in results due to subjective technician eval-uations. Recent advancements have introduced computer-assisted systems with image processing capabilities to enhance sperm quality analysis. This study presents a novel computer-assisted sperm analysis (CASA) system designed to evaluate sperm motility through digital micrographs, utilizing 14 distinct kinematic parameters. The algorithms and parameters developed offer a quantitative approach to characterizing infertility.

Hyperglycemia adversely affects critical physiological events related to rat sperm capacitation

Hyperglycemia, the hallmark of diabetes mellitus (DM), is the main cause of DM-related systemic complications, including reproductive issues. Furthermore, the incidence of DM in males of reproductive ages is becoming an increasing concern, as the complexity of sperm capacitation (an essential process for fertilizing the egg) extends beyond conventional sperm parameters such as count, viability, and motility. Capacitation defects cause male infertility, and DM-related hyperglycemia may affect this process. We explore the effects of uncontrolled hyperglycemia on sperm using alloxan-induced hyperglycemic Wistar rats. In addition to assessing conventional sperm parameters, we also evaluated functional indicators, including hyperactivation (HA) with a pharmacological approach and assessed its effects with a computer-assisted sperm analysis (CASA); fluorescence indicators to monitor membrane potential (EmR, DiSC3(5)) and mitochondrial membrane potential (Ψ, JC-1); CatSper activity, using its ability to permeate Na+ ions, and ATP levels with the luciferin-luciferase reaction. We confirmed previous findings with our hyperglycemic model, which replicated the typical reduction on conventional sperm parameters. In sperm from hyperglycemic rats, we observed increased motility and HA levels after pharmacological treatment. Additionally, CatSper activity was unaffected by hyperglycemia, while EmR was hyperpolarized under non-capacitating condition. Finally, we noted a low percentage of hyperpolarized Ψ and reduced ATP content. This study highlights the significance of impact of hyperglycemia on sperm physiology and capacitation. We proposed that low ATP levels perturb energy state, signaling pathways, ion channels activity, motility, and HA. Our findings offer insight into DM-associated infertility and potential treatment strategies.

Morphological and morphometric sperm analysis of dwarf sperm whale (Kogia sima)

Nowadays, an increase in the number of marine species at risk of extinction has been observed. Therefore, studies on the reproductive characteristics of these animals are essential. This animal is considered relatively rare, and there is scarce information regarding its reproductive biology and physiology. Thus, this study aims to describe the morphology and morphometry of sperm obtained from dwarf sperm whale. The material used in this work was collected during the necropsy of a dwarf sperm whale specimen. Thus, seminal samples were fixed and stained with panoptic stain. In morphometric analysis, the results obtained were: acrosome length of 0.83±0.01 μm, head length of 1.5±0.02 μm, intermediate part of 0.4±0.00 μm and total length of 27.3±0.51 μm. In terms of morphology, the defects observed were double head, heavily curled tail, abnormal small head, simply bent tail, piriform head, heavily bent tail and specimens within the normal range. In this context, the morphometric and morphological sperm analysis of Kogia sima described in this study can assist future studies regarding the reproductive physiology of these animals.

Evaluation of Ethanolic Extract of Prosopis Farcta and Trehalose on Cryopreserved Goat Epididymal Spermatozoa.

The purpose of this study, carried out in two experiments, was to investigate the antioxidant effect of Prosopis farcta in Experiment 1, and trehalose in Experiment 2 in the freezing extender, on the quality of frozen-thawed goat epididymal spermatozoa. Sperm samples were added to based egg-yolk Tris-extender containing experimental treatments. The first experimental treatments included the following: an extender of the control group without additive and extender containing 50, 100, or 150 µg/mL of Prosopis farcta ethanolic extract (PEE1, PEE2, and PEE3, respectively). Treatments of the second experiment include an extender of the control group without additive, an extender containing 100 mM of trehalose (Tr), an extender containing 100 µg/mL PEE2, and 100 µg/mL PEE2 + 100 mM Tr. The results of the first experiment showed that PEE2 compared with the control group led to a significant decrease (p < 0.05) in malondialdehyde (MDA) concentration. Also, PEE1 and PEE2 treatments resulted in a significant increase (p < 0.05) in motility parameters by computer-assisted sperm analysis, and MDA concentrations decreased significantly (p < 0.05) in all treatments compared with the control group. In general, the results of the present experiment showed that Prosopis farcta ethanolic extract at the level of 100 µg/mL was effective in improving the quality of frozen-thawed goat epididymal spermatozoa. Also, a combination of Prosopis farcta ethanolic extract and trehalose can be successful in freezing goat epididymal spermatozoa.

Off-axis digital lensless holographic microscopy based on spatially multiplexed interferometry.

Digital holographic microscopy (DHM) is a label-free microscopy technique that provides time-resolved quantitative phase imaging (QPI) by measuring the optical path delay of light induced by transparent biological samples. DHM has been utilized for various biomedical applications, such as cancer research and sperm cell assessment, as well as for in vitro drug or toxicity testing. Its lensless version, digital lensless holographic microscopy (DLHM), is an emerging technology that offers size-reduced, lightweight, and cost-effective imaging systems. These features make DLHM applicable, for example, in limited resource laboratories, remote areas, and point-of-care applications. In addition to the abovementioned advantages, in-line arrangements for DLHM also include the limitation of the twin-image presence, which can restrict accurate QPI. We therefore propose a compact lensless common-path interferometric off-axis approach that is capable of quantitative imaging of fast-moving biological specimens, such as living cells in flow. We suggest lensless spatially multiplexed interferometric microscopy (LESSMIM) as a lens-free variant of the previously reported spatially multiplexed interferometric microscopy (SMIM) concept. LESSMIM comprises a common-path interferometric architecture that is based on a single diffraction grating to achieve digital off-axis holography. From a series of single-shot off-axis holograms, twin-image free and time-resolved QPI is achieved by commonly used methods for Fourier filtering-based reconstruction, aberration compensation, and numerical propagation. Initially, the LESSMIM concept is experimentally demonstrated by results from a resolution test chart and investigations on temporal stability. Then, the accuracy of QPI and capabilities for imaging of living adherent cell cultures is characterized. Finally, utilizing a microfluidic channel, the cytometry of suspended cells in flow is evaluated. LESSMIM overcomes several limitations of in-line DLHM and provides fast time-resolved QPI in a compact optical arrangement. In summary, LESSMIM represents a promising technique with potential biomedical applications for fast imaging such as in imaging flow cytometry or sperm cell analysis.

Heat stress mediates toxicity of rutile titanium dioxide nanoparticles on fertilisation capacity in the broadcast spawning mussel Mytilus galloprovincialis

Titanium dioxide nanoparticle (nTiO2) pollution of marine environments is rapidly increasing with potentially deleterious effects on wildlife. Yet, the impacts of nTiO2 on reproduction remain poorly understood. This is especially the case for broadcast spawners, who are likely to be more severely impacted by environmental disturbances because their gametes are directly exposed to the environment during fertilisation. In addition, it is unclear whether rising water temperatures will further exacerbate the impact of nTiO2 toxicity. Here, in a series of fertilisation trials, we systematically examine the main and interactive effects of nTiO2 exposure and seawater temperature on fertilisation success in the Mediterranean mussel Mytilus galloprovincialis. Specifically, our fertilisation trials explored whether nTiO2 exposure influences fertilisation rates when (i) eggs alone are exposed, (ii) both sperm and eggs are exposed simultaneously, and (iii) whether increases in seawater temperature interact with nTiO2 exposure to influence fertilisation rates. We also ask whether changes in nTiO2 concentrations influence key sperm motility traits using computer-assisted sperm analysis (CASA). In fertilisation trials for treatment groups (i) and (ii), we found no main effects of nTiO2 at environmentally relevant concentrations of 5, 10 and 50 μg L−1 on fertilisation capacity relative to the control. Consistent with these findings, we found no effect of nTiO2 exposure on sperm motility. However, in treatment group (iii), when fertilisation trials were conducted at higher temperatures (+6 °C), exposure of gametes from both sexes to 10 μg L−1 nTiO2 led to a reduction in fertilisation rates that was significantly greater than when gametes were exposed to elevated temperature alone. These interacting effects of nTiO2 exposure and seawater temperature demonstrate the toxic potential of nTiO2 for fertilisation processes in a system that is likely to be impacted heavily by predicted future increases in sea surface temperatures.

Evaluation of sperm DNA fragmentation index among infertile individuals: a comprehensive analysis of the associated factors—a cross-sectional study

BackgroundEnsuring the integrity of sperm DNA is of paramount importance for the production of healthy offspring. The process of sperm formation involves intricate molecular adjustments that condense and safeguard its genetic material. However, the risk posed by sperm DNA fragmentation (SDF) can impede natural and assisted fertility and may arise from various testicular and post-testicular factors. While there are recommendations against routine SDF testing, recent research has sparked debate by demonstrating the positive impact of such testing on fertility outcomes.ObjectiveTo identify the factors associated with SDF among infertile individuals.Methods and materialsThe medical records of infertile men referred to our hospital were comprehensively reviewed and included in the study as they met the inclusion criteria. Patients dissatisfied with participation in the study or those with incomplete medical records were excluded. The association of SDF, sperm analysis, and demographic characteristics were evaluated for further investigation.ResultsThe average age of participants was 36.1 ± 8.1 years. The average semen volume was 2.5 ± 0.3 cc with a semen pH of 7.4 ± 0.2. The average sperm count was 10.9 ± 0.7 million, sperm motility was 36.9 ± 2.4%, and normal sperm morphology was 41.7 ± 2.7%. SDF levels below 15% were seen in 27.9%, between 15 and 30% in 32.4%, and above 30% in 39.7% of patients. Significant associations were found between the SDF and various factors in sperm analysis, including sperm count (P < 0.001), semen volume (P < 0.001), semen pH (P < 0.001), sperm motility (P < 0.001), normal sperm morphology (P < 0.001), and age (P < 0.001). Moreover, alcohol consumption (P = 0.04), smoking (P = 0.01), and the presence of varicocele (P = 0.03) were significantly associated with.ConclusionThis study emphasizes the significance of SDF among individuals experiencing infertility and investigates its correlation with various sperm test parameters. It also sheds light on the vital roles played by factors such as age, smoking, alcohol consumption, and the presence of varicocele, which are highly likely to cause variations in SDF levels. The results of our research will add to the existing pool of knowledge on infertility and potentially have implications for clinical practice and the care of patients.

Semen Parameters Can Be Used As A Credible Marker with Doppler Ultrasonography in the Diagnosis of Subclinical Varicocele Cases

OBJECTIVES: The link between varicoceles and male infertility has been a problem of debate for more than half a century. A substantial amount of data about varicocelectomies’ effects has been provided, but inadequate study designs and heterogeneity of current studies make these data rarely conclusive. This article investigates whether semen and sperm analysis in subclinical varicocele patients without any clinical signs diagnosed by Doppler Ultrasonography (USG) can be used as a diagnostic tool. STUDY DESIGN: The current prospective study included infertile male patients (n=44) enrolled in the Urology Clinic of Biruni University Hospital from January 2017 to January 2018. Patients were divided into two groups: 1st group as the control group (CG) (n=22): No varicocele as determined by Doppler USG, and 2nd group as the test group (TG) (n=22): Subclinical varicocele (SCV) as determined by Doppler USG. A semen analysis was done. Sperm were dyed with aniline blue and chromomycin A3 (CMA3), acridine orange (AO), propidium iodide (PI), and Rhodamine 123 (Rh123) for the determination of sperm maturation, sperm DNA fragmentation, apoptosis, and sperm mitochondrial membrane potential, respectively. Student-t Test was used for statistical analysis. p&lt;0.05 was considered significant. RESULTS: The sperm concentration of the CG was higher than the TG (p=0.98, p&gt;0.05). Forward sperm motility in the CG was higher than in the TG (p&lt;0.001, p&lt;0.05). Sperm with normal morphology in the TG was lower than in the CG (p&lt;0.001, p&lt;0.05). Sperm neck anomalies were higher in varicocele cases (p&lt;0.001, p&lt;0.05). Sperm maturation at the TG was lower than the CG (p&lt;0.001, p&lt;0.05). A high apoptotic sperm rate was found at the TG (p&lt;0.001, p&lt;0.05). Sperm mitochondria potential at the TG was lower than the CG (p&lt;0.001, p&lt;0.05). Sperm chromatin condensation at the TG was higher than the CG (p&lt;0.001, p&lt;0.05). CONCLUSIONS: The analysis of sperm DNA and apoptosis in SCV cases can be used as a reliable diagnostic tool to confirm Doppler USG.

Comparison of computer-assisted sperm analysis and smartphone-applied sperm analysis for evaluation of frozen-thawed bull semen.

This study aims to compare the efficacy of computer-assisted sperm analysis (CASA) and smartphone-applied sperm analysis (SASA) in assessing the quality of frozen-thawed bull semen. A total of 75 straws (n = 75) semen samples were used from different production batches of five Holstein bulls. The semen analyses were conducted in three groups: Group I (CASA-37°C), semen samples were evaluated using the CASA system at 37°C (n = 25); Group II (SASA-25°C), semen samples were assessed using the SASA system at a temperature of room heat (25°C) (n = 25); and Group III (SASA-37°C), semen samples were evaluated using the SASA system at 37°C (n = 25). The frozen-thawed bull semen samples were analysed in terms of total motility (TM), progressive motility (PM), immotile, velocity average path (VAP), velocity curve linear (VCL), velocity straight line (VSL) and sperm concentration. There was no significant difference between the groups in terms of spermatozoa concentration (p > .05). However, significant differences among the groups were observed for total motile spermatozoa values (p < .001). Values of progressive motile spermatozoa were lower in Group I and Group II compared to Group III (p < .001). The immotile spermatozoa values were significant between the groups (p < .001) and were found to be proportional to total motile spermatozoa values. Additionally, the VAP, VCL and VSL values were comparable between Group II and Group III, but lower when compared to Group I. In conclusion, the results of the study demonstrate that the Sperm Cell™ system can accurately analyse the concentration of frozen-thawed bull semen. The analyses performed at room temperature indicate a parallelism between the PM value and CASA results. However, it is thought that SASA devices require a series of standardization studies in different semen extenders, different sample concentrations and different animal species, analogous to the standardization evolution process of CASA devices in semen analysis.

Microscopic ferning in human pre-ejaculate is highly correlated with the absence of sperm

ObjectiveWe characterize microscopic ferning in pre-ejaculate samples with and without sperm. Study designHealthy, male, withdrawal-experienced participants provided up to three paired pre-ejaculate and ejaculate samples. We centrifuged ejaculate samples to obtain a supernatant without sperm. After sperm analysis, we dried and evaluated pre-ejaculate, ejaculate, and supernatants for microscopic ferning. ResultsOf 57 pre-ejaculate samples (N = 24 men), seven (12.3%) contained sperm, none of which exhibited ferning. Sixty-six percent (33/50) of pre-ejaculate samples without sperm exhibited ferning. Neither ejaculate nor supernatant samples exhibited ferning. ConclusionFerning may distinguish clinical pre-ejaculate with and without sperm. Ferning exhibited 100% specificity for pre-ejaculate without sperm.

The relationship between semen quality in male infertility clinic patients and bisphenol A：A Chinese cross-sectional study

Bisphenol A (BPA) is a growing concern as an endocrine-disrupting chemical due to its adverse health effects. However, the association between BPA and sperm quality in adult human males remains unclear. The aim of this study was to assess the daily life exposure level of BPA and analyze its correlation with sperm quality in males. Patients who sought treatment in Chinese infertility clinics between May and October 2023 were selected as study subjects. We determined participants' serum BPA content using high-performance liquid chromatography. Sperm count and motility were assessed using a computer-aided sperm analysis system, while sperm morphology was analyzed using an improved Papanicolaou stain. A total of 405 participants, averaging 33.01 ± 5.44 years old, were included. We observed low semen quality among participants in infertility clinics. Principal component analysis was performed for each semen quality index, and three principal components reflecting sperm motility, count, and morphology were extracted. The participants' mean serum BPA level was 6.96 ng/mL. Negative correlations were observed between serum BPA content and total sperm count, sperm density, forward motility rate, and non-forward motility rate. A positive correlation was found between the non-motile sperm rate and the head deformity rate. Morphological abnormalities were the predominant adverse effects observed. Despite low daily life BPA exposure, long-term low-dose exposure in the general population may damage semen quality. This study provides a scientific basis for managing health risks associated with BPA exposure.

Evaluation of protamine 2 genes in spermatozoa of teratospermic and oligospermic men in Nigeria

There have been several reports of single nucleotide polymorphisms (SNPs) linked to different kinds of male infertility. The aim of the study was to evaluate single nucleotide polymorphisms in protamine 2 gene (PRM2) in spermatozoa of teratospermic and oligospermic infertile men in Nigeria. At some fertility clinics in Lagos, Nigeria, twenty-two (22) teratospermic and thirty-five (35) oligospermic infertile men as well as thirty (35) normospermic fertile men (control) who volunteered and gave consent were recruited for the cross-section study after meeting the inclusion criteria and confirmation of their fertility statuses by the use of computer-Assisted Sperm Analyzer (CASA). Semen was collected from the participants under the WHO guideline for semen collection and processing. Spermatozoa’s DNA was extracted with the use of Proteinase K Storage Buffer. Nanodrop 1000 spectrophotometer was used to quantify the isolated genomic DNA. PRM II F: 5-AGGGCCCTGCTAGTTGTGA-3' and PRM II R: 3'- CAGATCTTGTGGGCTTCTCG -5, were used as primers. Sequencing of sperm DNA was done using the BigDye Terminator kit on a 3510 ABI sequencer by Inqaba Biotechnological, Pretoria South Africa. Agarose gel electrophoresis was used to show the amplified PRM2. In the study, 7 SNPs in the teratospermic infertile men, 8 SNPs in the oligospermic infertile men and 7 SNPs in the normospermic fertile men were discovered. The SNPs between the teratospermic infertile men and the oligospermic infertile men are significantly different. We propose that considerably larger genome-wide investigations are required to confidently validate these SNPs and find new SNPs linked with male infertility.