Analysis Of Genetic Sequences Research Articles

Suppression of UVB-Induced MMP-1 Expression in Human Skin Fibroblasts Using Lysate of Lactobacillus iners Derived from Korean Women's Skin in Their Twenties.

The process of skin aging is intricate, involving intrinsic aging, influenced by internal factors, and extrinsic aging, mainly caused by exposure to UV radiation, resulting in photoaging. Photoaging manifests as skin issues such as wrinkles and discoloration. The skin microbiome, a diverse community of microorganisms on the skin's surface, plays a crucial role in skin protection and can be affected by factors like humidity and pH. Probiotics, beneficial microorganisms, have been investigated for their potential to enhance skin health by regulating the skin microbiome. This can be accomplished through oral probiotics, impacting the gut-skin axis, or topical applications introducing live bacteria to the skin. Probiotics mitigate oxidative stress, suppress inflammation, and maintain the skin's extracellular matrix, ultimately averting skin aging. However, research on probiotics derived from human skin is limited, and there is no established product for preventing photoaging. The mechanism by which probiotics shield the skin microbiome and skin layers from UV radiation remains unclear. Recently, researchers have discovered Lactobacillus in the skin, with reports indicating a decrease in this microorganism with age. In a recent study, scientists isolated Lactobacillus iners KOLBM20 from the skin of individuals in their twenties and confirmed its effectiveness. A comparative analysis of genetic sequences revealed that strain KOLBM20 belongs to the Lactobacillus genus and closely relates to L. iners DSM13335(T) with a 99.20% similarity. Importantly, Lactobacillus iners KOLBM20 displayed anti-wrinkle properties by inhibiting MMP-1. This investigation demonstrated the inhibitory effect of KOLBM20 strain lysate on MMP-1 expression. Moreover, the data suggest that KOLBM20 strain lysate may prevent UVB-induced MMP-1 expression by inhibiting the activation of the ERK, JNK, and p38 signaling pathways induced by UVB. Consequently, KOLBM20 strain lysate holds promise as a potential therapeutic agent for preventing and treating skin photoaging.

Highly pathogenic avian influenza A(H5N1) virus infection in foxes with PB2-M535I identified as a novel mammalian adaptation, Northern Ireland, July 2023.

We report cases of mammalian infection with highly pathogenic avian influenza (HPAI) virus A(H5N1) clade 2.3.4.4b in Northern Ireland. Two common gulls (Larus canus) and two red fox kits (Vulpes vulpes), were found dead in close vicinity. Comparison of viral whole genome sequences obtained from the animals identified a novel mammalian adaptation, PB2-M535I. Analysis of genetic sequences from other recent mammalian infections shows that this mutation has arisen on at least five occasions in three European countries since April 2023.

First Record of Culicoides Occidentalis in Sinaloa, Mexico.

Culicoides species adults were collected in light traps located on the coast of Elota, Sinaloa, Mexico, in February 2022. All specimens were females, and it was determined based on their morphology that they belonged to the Culicoides variipennis complex. The identification of the species was carried out by means of a comparative analysis of genetic sequences of the cytochrome c oxidase subunit I gene, which resulted in C. occidentalis, this being its first report in Sinaloa and its third nationwide.

Black spot disease related to a trematode ectoparasite causes oxidative stress in Xyrichtys novacula

Xyricthys novacula is very popular fish species in the Balearic Islands and a main target for recreational fishing. Over the last years, spots were observed on many individuals, which seems to be progressively more common. The aim of the present study was to identify the parasite, determine its abundance in a marine protected area (MPA) and in a non-protected one with more anthropic influence, and to evaluate the antioxidant and immune responses to this parasite presence by studying biomarkers in both liver and epithelial mucus. Analysis of genetic sequences established with 98.6–98.4% certainty that the parasite is a digenean fluke Scaphanocephalus sp. An average abundance of 12.3 ± 11.3 and 1.3 ± 1.3 parasites per individual was found for the non-protected area and the MPA, respectively. The activities of lysozyme and superoxide dismutase and total immunoglobulin concentration were significantly higher in mucus of X. novacula with more parasites. Similarly, in liver, a higher parasite load is related to higher activities of catalase, glutathione peroxidase and glutathione S-transferase, whereas malondialdehyde remained similar. In conclusion, Scaphanocephalus sp. affects X. novacula, inducing an immune and antioxidant response in epithelial mucus and in liver. The potential influence of the environment on parasite transmission, prevalence and abundance require further research to determine whether it makes fish more susceptible to infections.

Secuenciación del genoma del SARS-CoV-2 en Andalucía, metodología y estudio de las variantes

The incorporation of genomic sequencing techniques through next-generation sequencing has revolutionized clinical microbiology, innovating and improving the clinical diagnosis of infectious diseases. Today, whole genome sequencing in infectious diseases has many applications in virology, bacteriology, antibiotic resistance, epidemiology, and public health. With the appearance of SARS-CoV-2, the importance of the analysis and study of genetic sequences has been underlined. Since the initial identification of SARS-CoV-2, to date, more than 414,575 complete genomic sequences have been shared worldwide through public access databases. The ability to monitor viral evolution in near real time has a direct impact on the public health response to the COVID-19 pandemic. This paper presents the importance of genomic sequencing in microbiology, infectious diseases, epidemiology and public health, and describes how SARS-CoV-2 sequencing has been implemented in Andalusia, and what the main results are to date.

Accounting for spatial sampling patterns in Bayesian phylogeography

Statistical phylogeography provides useful tools to characterize and quantify the spread of organisms during the course of evolution. Analyzing georeferenced genetic data often relies on the assumption that samples are preferentially collected in densely populated areas of the habitat. Deviation from this assumption negatively impacts the inference of the spatial and demographic dynamics. This issue is pervasive in phylogeography. It affects analyses that approximate the habitat as a set of discrete demes as well as those that treat it as a continuum. The present study introduces a Bayesian modeling approach that explicitly accommodates for spatial sampling strategies. An original inference technique, based on recent advances in statistical computing, is then described that is most suited to modeling data where sequences are preferentially collected at certain locations, independently of the outcome of the evolutionary process. The analysis of georeferenced genetic sequences from the West Nile virus in North America along with simulated data shows how assumptions about spatial sampling may impact our understanding of the forces shaping biodiversity across time and space.

Primer design of D-loop region for wild population genetics of Rusa timorensis in Indonesia

Rusa timorensis (Javan deer) is endemic wildlife in Indonesia and is estimated at less than 10.000 individuals with continuously declining populations due to habitat loss and illegal hunting in the wild. This declining low population indicates a greater risk of extinction. Unfortunately, the genetic information of the wild Javan deer population for conservation management strategies still lacks data due to challenging sampling in the wild. Most recent studies were analysing the breeding populations outside Indonesia. Here, we propose the primer design of the D-loop genetic marker to determine the genetic population of wild Javan deer. We used metadata analysis of genetic sequences and new samples from five wild populations to design the specific primer of the D-loop region of the wild Javan deer in Indonesia. We used software, i.e.., Primer3 to design the primers, BLAST for specificity and Oligo Analyzer™ Tool for efficiency of the primer. The Annealing temperature optimisation started with pre-denaturation at 94 °C followed by 35 cycles of denaturation at 95°C; 51-56°C annealing for each one degree’s different per PCR treatment; and 72°C extensions. We successfully designed a specific primer (RL-3.1a) to amplify 235 bp of the D-loop region at 52°C annealing’s temperature.

Neurological complications associated with coronavirus disease-2019 (COVID-19): MRI features

Severe acute respiratory syndrome coronavirus 2 (SARS-COV-2) is an RNA virus, which is a strain of Severe Acute Respiratory Syndrome-related CoronaVirus (SARSr-CoV), of Coronavirus family. On 31 December 2019, a cluster of cases of unknown pneumonia in Wuhan-China was reported to the World Health Organization (WHO) that subsequently spreading as coronavirus disease 2019-(COVID-19) pandemic worldwide. On 12 January 2020, novel SARS-COV-2 was declared the cause of COVID-19 from the initial analysis of the virus genetic sequences obtained from lower respiratory tract specimen of 41 patients admitted to a designated hospital in Wuhan. The classical COVID-19 presentation is respiratory symptoms. Neuroradiological findings were reported. Our aim is to document neurological complication of COVID-19. We observed confirmed 23 COVID-19 patients presented with severe neurological symptoms. Brain-MRI showed predominately; cerebrovascular thromboembolism-related acute infarcts, autoimmune-meningoencephalitis, Acute disseminated encephalomyelitis (ADEM)-like white matter lesions. ConclusionDifferent neurological presentations are associated with COVID-19, necessitating further studies to clarify the mechanism of its CNS involvement.

Can Irrational Numbers (Such as Square Root of the Number Five) Be Reached by Analysis of Genetic Sequences?

Irrational numbers didn’t have reoccurrence sequence but this paper calculated a sequence with respect to Quantum Perspective Model. One of the irrational numbers is the square root of five numbers. This article researches whether there is a link between the square root of five numbers and the genetic sequences. At first, the square root digits of the number five after the comma are added respectively. Secondly, the resulting sum corresponds to the nucleotide bases, the results obtained in this way are expressed as nucleotide bases (A, T, C, G, and U): (A) Adenine, (T) Thymine, (C) Cytosine, (G) Guanine, (U) Uracil. From this point of view, when the first three hundred digits of the square root of the number five after the comma are calculated, the gene sequence is obtained as follows: [ATTTATTCAATACATAACCCCATTGA]. Thirdly, in this sequence, some of reoccurrences were detected just like as “CAT” and “ATT”. Fourthly, after researching this sequence at NCBI (National Biotechnology Information Center), the search result is similar to bony fishes, especially DANIO RERIO (Zebra fish). Lastly, the genetic codes of Zebra fishes were found to be similar to human genetic codes. In summary, the connection between these results and the square root of the five in mathematical science and the genetic codes in biochemistry may shed light on explaining irrational numbers.

Use of Bioinformatics Technologies and Databases to Teach Analysis of Genetic Sequences to Undergraduate Students in Physics, Biotechnology, and Biology: The Specific Case of the SARS-CoV-2 Spike Protein

Worldwide, the implementation of computational tools has allowed the advancement of our understanding, specifically, biotechnological information tools have made possible to tackle global challenges such as the COVID-19 pandemic; therefore, such tools are essential for science students. We propose an activity to teach the use of information and database biotechnologies and their utility for the alignment and comparison of sequences. We use as query sequence the corresponding to SARS-CoV-2 Spike protein in its closed state, and we compare it with 200 sequences obtained from the NCBI databases to identify the mutations and their domain. In the results, we show the frequency of the mutations, domain, and country of the isolated SARS-CoV-2 genome. The activity we propose is aimed at first-year undergraduate students in physics, biology, and biotechnology.

Determining Ancestry between Rodent- and Human-Derived Virus Sequences in Endemic Foci: Towards a More Integral Molecular Epidemiology of Lassa Fever within West Africa.

Lassa fever is a viral hemorrhagic illness responsible for thousands of human deaths in West Africa yearly. Rodents are known as natural reservoirs of the causative Lassa mammarenavirus (LASV) while humans are regarded as incidental, spill-over hosts. Analysis of genetic sequences continues to add to our understanding of the evolutionary history, emergence patterns, and the epidemiology of LASV. Hitherto, the source of data in such investigations has mainly comprised human clinical samples. Presently, a rise in the quantity of virus strains accessed through ecological studies over the last 15 years now allows us to explore how LASV sequences obtained from rodents might affect phylogenetic patterns. In this study, we phylogenetically compared LASV sequences obtained from both rodents and humans across West Africa, including those from two localities highly endemic for the disease: Ekpoma in Nigeria and Kenema in Sierra Leone. We performed a time-calibrated phylogeny, using a Bayesian analysis on 198 taxa, including 102 sequences from rodents and 96 from humans. Contrary to expectation, our results show that LASV strains detected in humans within these localities, even those sampled recently, are consistently ancient to those circulating in rodents in the same area. We discuss the possibilities connected to this preliminary outcome. We also propose modalities to guide more comprehensive comparisons of human and rodent data in LASV molecular epidemiological studies.

A familial cluster of pneumonia associated with the 2019 novel coronavirus indicating person-to-person transmission: a study of a family cluster

SummaryBackgroundAn ongoing outbreak of pneumonia associated with a novel coronavirus was reported in Wuhan city, Hubei province, China. Affected patients were geographically linked with a local wet market as a potential source. No data on person-to-person or nosocomial transmission have been published to date.MethodsIn this study, we report the epidemiological, clinical, laboratory, radiological, and microbiological findings of five patients in a family cluster who presented with unexplained pneumonia after returning to Shenzhen, Guangdong province, China, after a visit to Wuhan, and an additional family member who did not travel to Wuhan. Phylogenetic analysis of genetic sequences from these patients were done.FindingsFrom Jan 10, 2020, we enrolled a family of six patients who travelled to Wuhan from Shenzhen between Dec 29, 2019 and Jan 4, 2020. Of six family members who travelled to Wuhan, five were identified as infected with the novel coronavirus. Additionally, one family member, who did not travel to Wuhan, became infected with the virus after several days of contact with four of the family members. None of the family members had contacts with Wuhan markets or animals, although two had visited a Wuhan hospital. Five family members (aged 36–66 years) presented with fever, upper or lower respiratory tract symptoms, or diarrhoea, or a combination of these 3–6 days after exposure. They presented to our hospital (The University of Hong Kong-Shenzhen Hospital, Shenzhen) 6–10 days after symptom onset. They and one asymptomatic child (aged 10 years) had radiological ground-glass lung opacities. Older patients (aged >60 years) had more systemic symptoms, extensive radiological ground-glass lung changes, lymphopenia, thrombocytopenia, and increased C-reactive protein and lactate dehydrogenase levels. The nasopharyngeal or throat swabs of these six patients were negative for known respiratory microbes by point-of-care multiplex RT-PCR, but five patients (four adults and the child) were RT-PCR positive for genes encoding the internal RNA-dependent RNA polymerase and surface Spike protein of this novel coronavirus, which were confirmed by Sanger sequencing. Phylogenetic analysis of these five patients' RT-PCR amplicons and two full genomes by next-generation sequencing showed that this is a novel coronavirus, which is closest to the bat severe acute respiatory syndrome (SARS)-related coronaviruses found in Chinese horseshoe bats.InterpretationOur findings are consistent with person-to-person transmission of this novel coronavirus in hospital and family settings, and the reports of infected travellers in other geographical regions.FundingThe Shaw Foundation Hong Kong, Michael Seak-Kan Tong, Respiratory Viral Research Foundation Limited, Hui Ming, Hui Hoy and Chow Sin Lan Charity Fund Limited, Marina Man-Wai Lee, the Hong Kong Hainan Commercial Association South China Microbiology Research Fund, Sanming Project of Medicine (Shenzhen), and High Level-Hospital Program (Guangdong Health Commission).

A health metadata-based management approach for comparative analysis of high-throughput genetic sequences for quantifying antimicrobial resistance reduction in Canadian hog barns

New Canadian regulations have required that all use of antibiotics in livestock animal production should be under veterinary prescription and oversight, while the prophylactic use and inclusion of these agents in animal feed as growth promoters are also banned. In response to this new rule, many Canadian animal producers have voluntarily implemented production practices aimed at producing animals effectively while avoiding the use of antibiotics. In the swine industry, one such program is the ‘raised without antibiotics’ (RWA) program.In this paper, we describe a comprehensive investigative methodology comparing the effect of the adoption of the RWA approach with non-RWA pig production operations where antibiotics may still be administered on animals as needed. Our experimental approach involves a multi-year longitudinal investigation of pig farming to determine the effects of antibiotic usage on the prevalence of antimicrobial resistance (AMR) and pathogen abundance in the context of the drug exposures recorded in the RWA versus non-RWA scenarios.Surveillance of AMR and pathogens was conducted using whole-genome sequencing (WGS) in conjunction with open source tools and data pipeline analyses, which inform on the resistome, virulome and bacterial diversity in animals and materials associated with the different types of barns. This information was combined and correlated with drug usage (types and amounts) over time, along with animal health metadata (stage of growth, reason for drug use, among others). The overarching goal was to develop a set of interconnected informatic tools and data management procedures wherein specific queries could be made and customized, to reveal statistically valid cause/effect relationships.Results demonstrating possible correlations between RWA and AMR would support the Canadian pig industry, as well as regulatory agencies in new efforts, focused on reducing overall antibiotics use and in curbing the development and spread of AMR related to animal agriculture.

MicroRNA-485-5p inhibits the progression of hepatocellular carcinoma through blocking the WBP2/Wnt signaling pathway

microRNA-485-5p (miR-485-5p) has been shown to act as a tumor-suppressor gene in some cancers, such as ovarian epithelial tumors and oral tongue squamous cell carcinoma. However, with regard to the anti-tumor role of miR-485-5p in hepatocellular carcinoma (HCC), evidence is unexpectedly limited. In the present study, we investigated the expression and the role of miR-485-5p in the progression of HCC. Microarray analysis revealed that miR-485-5p was downregulated and WBP2 was upregulated in HCC, which was consistent with RT-qPCR and immunohistochemistry assays in the HCC tissues we collected. A negative correlation between the expression of miR-485-5p and WBP2 was also found in HCC tissues. It was predicted and confirmed that miR-485-5p could bind to WW domain binding protein 2 (WBP2) through in silico analysis of genetic sequences and an in vitro dual-luciferase reporter gene assay. Next, gain- or loss-of-function studies were applied in the HCC cell line (Huh7) to examine the effects of miR-485-5p and WBP2 on HCC cell behavior. The effects of miR-485-5p and WBP2 on the Wnt/β-catenin signaling pathway were determined by TOP/FOP flash luciferase assays. miR-485-5p was shown to downregulate WBP2 and block the Wnt/β-catenin signaling pathway. As expected, elevated miR-485-5p levels and inhibition of WBP2 protein expression exerted inhibitory effects on HCC cell proliferation, migration and invasion and, induced apoptosis. In vivo experiments were finally conducted, which confirmed that upregulation of miR-485-5p or depletion of WBP2 attenuated tumor growth. Collectively, our results suggest miR-485-5p can downregulate WBP2 to inhibit the development of HCC by the blockade of the Wnt/β-catenin signaling, providing a novel molecular target for HCC treatment.

Ethical issues associated with HIV molecular epidemiology: a qualitative exploratory study using inductive analytic approaches

BackgroundHIV molecular epidemiology is increasingly recognized as a vital source of information for understanding HIV transmission dynamics. Despite extensive use of these data-intensive techniques in both research and public health settings, the ethical issues associated with this science have received minimal attention. As the discipline evolves, there is reasonable concern that existing ethical and legal frameworks and standards might lag behind the rapid methodological developments in this field. This is a follow-up on our earlier work that applied a predetermined analytical framework to examine the perspectives of a sample of scientists from the fields of epidemiology, public health, virology and bioethics on key ethical issues associated with HIV molecular epidemiology in HIV network research.MethodsFourteen in-depth interviews were conducted with scientists from the fields of molecular epidemiology, public health, virology and bioethics. Inductive analytical approaches were applied to identify key themes that emerged from the data.ResultsOur interviewees acknowledged the potential positive impact of molecular epidemiology in the fight against HIV. However, they were concerned that HIV phylogenetics research messages may be incorrectly interpreted if not presented at the appropriate level. There was consensus that HIV phylogenetics research presents a potential risk to privacy, but the probability and magnitude of this risk was less obvious. Although participants acknowledged the social value that could be realized from the analysis of HIV genetic sequences, there was a perceived fear that the boundaries for use of HIV sequence data were not clearly defined.Conclusions Our findings highlight distinct ethical issues arising from HIV molecular epidemiology. As the discipline evolves and HIV sequence data become increasingly available, it is critical to ensure that ethical standards keep pace with biomedical advancements. We argue that the ethical issues raised in this study, whether real or perceived, require further conceptual and empirical examination.

Determining Ancestry between Rodent- and Human-Derived Lassa Virus Sequences in Endemic Foci within West Africa: Indications of Reverse Zoonosis

Background: Lassa fever is a viral haemorrhagic illness responsible for thousands of human deaths in West Africa yearly. Rodents are known as natural reservoirs of the causative Lassa virus (LASV) while humans are regarded as incidental, spill-over hosts. Analysis of genetic sequences continues to add to our understanding of the evolutionary history, emergence patterns and the epidemiology of LASV. Methods: In this study we phylogenetically compare LASV sequences obtained from both rodents and humans across West Africa, including those from two localities highly endemic for the disease: Ekpoma in Nigeria and Kenema in Sierra Leone. We performed a time-calibrated phylogeny, using a Bayesian analysis on 185 taxa including 89 sequences from rodents and 96 from humans. Findings: Our results show that LASV strains detected in humans within these localities, even those sampled recently, are consistently ancient to those circulating in rodents in the same area. Interpretation: This indicates humans are likely more involved in maintaining and spreading LASV than is currently realized. It also suggests there may have been certain emergence events where rodents became infected, even if indirectly, by humans. While this finding does not dispel the basic concept of rodent-to-human transmission, it recommends a broader, bi-directional model; one that recognises the role of reverse zoonosis in LASV epidemiology. Funding Statement: European Foundation Initiative for African Research into Neglected Tropical Diseases (EFINTD) under grants 1/85/022 & 89 540 and the German Research Foundation (DFG) under grant FI 1781/2-1. Declaration of Interests: The authors declare they have no conflict of interest.

The Matrix Method of Representation, Analysis and Classification of Long Genetic Sequences

The article is devoted to a matrix method of comparative analysis of long nucleotide sequences by means of presenting each sequence in the form of three digital binary sequences. This method uses a set of symmetries of biochemical attributes of nucleotides. It also uses the possibility of presentation of every whole set of N-mers as one of the members of a Kronecker family of genetic matrices. With this method, a long nucleotide sequence can be visually represented as an individual fractal-like mosaic or another regular mosaic of binary type. In contrast to natural nucleotide sequences, artificial random sequences give non-regular patterns. Examples of binary mosaics of long nucleotide sequences are shown, including cases of human chromosomes and penicillins. The obtained results are then discussed.

Direct translational analysis of electrophoretically separated DNA using a cell-free protein synthesis system

Abstract Cell-based protein production has low throughput and restricted flexibility in process design. For the development of a rapid platform for translational analysis of genetic sequences by bypassing time- and labor-consuming steps of cell-based gene expression methods, we attempted in this study to combine the techniques of gel electrophoresis and cell-free protein synthesis in a streamlined manner. After an electrophoretic separation of the DNAs of varying sizes, DNAs in the gel matrices were directly incubated in a reaction mixture for cell-free protein synthesis, which led to successful expression of functional proteins.

Metagenomic Classification Using an Abstraction Augmented Markov Model.

The abstraction augmented Markov model (AAMM) is an extension of a Markov model that can be used for the analysis of genetic sequences. It is developed using the frequencies of all possible consecutive words with same length (p-mers). This article will review the theory behind AAMM and apply the theory behind AAMM in metagenomic classification.

An extension of fuzzy topological approach for comparison of genetic sequences

Bioinformatics is a relatively new discipline where Mathematics are applied in the analysis of genetic sequences. The analysis of the genetic material of living organisms which consist of nucleic acids DNA and RNA is of great importance for diagnosis and taxonomy reasons. In the present paper we propose a new methodology for the representation of genetic sequences as fuzzy sets in the I 12 space which can significantly improve the results of Sadegh-Zadeh and Torres & Nieto. An important characteristic of our proposed methodology is that the location of Amino acids along the genetic sequences play an important role thus extending in a significant way the computational efficiency advantage of genetic sequence representation. We present some characteristic examples using the new proposed methodology where we calculate the distance and similarity degree of given polynucleotides.