Abstract
Irrational numbers didn’t have reoccurrence sequence but this paper calculated a sequence with respect to Quantum Perspective Model. One of the irrational numbers is the square root of five numbers. This article researches whether there is a link between the square root of five numbers and the genetic sequences. At first, the square root digits of the number five after the comma are added respectively. Secondly, the resulting sum corresponds to the nucleotide bases, the results obtained in this way are expressed as nucleotide bases (A, T, C, G, and U): (A) Adenine, (T) Thymine, (C) Cytosine, (G) Guanine, (U) Uracil. From this point of view, when the first three hundred digits of the square root of the number five after the comma are calculated, the gene sequence is obtained as follows: [ATTTATTCAATACATAACCCCATTGA]. Thirdly, in this sequence, some of reoccurrences were detected just like as “CAT” and “ATT”. Fourthly, after researching this sequence at NCBI (National Biotechnology Information Center), the search result is similar to bony fishes, especially DANIO RERIO (Zebra fish). Lastly, the genetic codes of Zebra fishes were found to be similar to human genetic codes. In summary, the connection between these results and the square root of the five in mathematical science and the genetic codes in biochemistry may shed light on explaining irrational numbers.
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Disclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.